CN102978287A - Method for utilizing stamen petalody to mark male sterility genes of Brassica campestris ssp.chinensis - Google Patents

Abstract

The invention relates to a method for utilizing stamen petalody to mark male sterility genes of Brassica campestris ssp.chinensis, belongs to the field of a biotechnology and is used for marker-assisted selection breeding of a Brassica campestris ssp.chinensis male sterility line. The method comprises the following step of: amplifying DNA (Deoxyribonucleic Acid) synthesized by RNA (Ribonucleic Acid) inverse transcription of a stamen petalody line and a maintainer line thereof by utilizing a mark primer AFLP17 (Amplified Fragment Length Polymorphism 17) or a mark primer SCAR33, wherein if a 300bp segment can be amplified, the male sterility genes of the Brassica campestris ssp.chinensis do not exist. The method can be used for carrying out cDNA-AFLP and SCAR molecular marker sieving on the DNA synthesized by the RNA inverse transcription of the Brassica campestris ssp.chinensis stamen petalody line W053 and the maintainer line W052 thereof, can effectively expand the marker-assisted selection breeding of the Brassica campestris ssp.chinensis male sterility line, and greatly improves the selection efficiency, so that the breeding progress is accelerated.

Description

A kind of method of utilizing stamen lobe mark Chinese cabbage male sterility gene

One, technical field

The invention discloses a kind of method of utilizing stamen lobe mark Chinese cabbage male sterility gene, belong to biological technical field, be used for the molecular marker assisted selection breeding of Chinese cabbage male sterile line.

Two, technical background

In recent years, the demand of Chinese cabbage (Brassica campestris L.ssp.chinensis Makino) constantly increases, but it has the characteristic of not anti-accumulating, and kind is comparatively single.This just makes the importance of heterosis utilization day by day highlight, and obtains to have the Chinese cabbage kind of high-quality, high yield, strong stress resistance by hybridization.At present, the approach that is widely used in the preparing hybrid kind mainly contains self incompatible line, chemical emasculation and male sterile line etc., but front two kinds of approach have very large defective respectively aspect workload and the effect.Therefore, the utilization of male sterile line becomes the first-selected approach of current heterosis utilization.

Generally, no matter be cytoplasmic male sterility (CMS) or nuclear male sterility (GMS), what show mostly that staminody causes can not produce pollen or not produce the male sterile type of active pollen, although its male organs are degenerated, deformity, but still remaining (Yu Mina, 2008).Yet, stamen lobe mutant shows as the petal dislocation and is expressed in stamen position so that stamen disappearance, the bisexuality flower becomes anandrous unisexuality female flower, consequent male sterile is stable, thorough, it is a kind of new male sterile type, for the male sterile research on mechanism provides good material, also enriched the male sterile type of existing Chinese cabbage (Zhang Yanfeng, 2010) simultaneously.Therefore, prediction is that the degree of correlation of the differential gene that obtains of material and male-sterile character can be higher with this new product.

Stamen lobe homeotic mutation is more common in the model plant Arabidopis thaliana, and report is also arranged in the farm crop, and landblink far waits (2005) to find stamen lobe mutant in the materials such as swede type rape, mustard type rape, radish.Mostly concentrate on the mechanism aspect of flower development for the research of this class mutant material, and it is rare to utilize it to transfer the research of male sterile genes involved.This test is take Chinese cabbage stamen lobe strain W053 and maintenance line W052 thereof as material, and at the test initial stage, we find that the stamen disappearance often appears in W053, the phenomenon that petal increases, and this characteristic has metastable heredity.

Traditional breeding method seed selection sterile line cycle is long, efficient is low, and this also is the important application that limits at present Chinese cabbage male-sterile line breeding and application.Molecular marker assisted selection is not subjected to the restriction of envrionment conditions, can realize selecting seedling stage, reduces workload, accelerates breeding process, improves the breeding efficiency of Chinese cabbage sterile line.

Along with molecular biological development, the molecular marker screening and the molecular marker assisted selection that all take much count of carrying out fertile gene in the genome both at home and abroad.On vegetable crop, Wu state equality (2012) is utilized the SRAP technology, and screening has obtained 1 and the closely linked molecule marker of fertility restorer gene in pimento cytoplasmic male sterilty restorer.Huang Zhen (2009) utilizes the AFLP technology, has obtained 5 fertility-related genes in swede type rape, and successfully is converted into the SCAR mark, has set up simultaneously the molecular marker-assisted selection method of swede type rape adelomorphic cell genic male sterile line.Zhang Hui (2010) utilizes SRAP and SSR technology, and screening has obtained 5 male sterile genes involveds in Chinese cabbage, and successfully is converted into more stable SCAR mark.Li Jingjing etc. (2012) utilize the AFLP technology, have obtained 7 and the closely linked molecule marker of esp gene in swede type rape recessive epistasis nuclear male sterility amphitypy system.

The application of cDNA-AFLP technology is very extensive and ripe at present, mainly for the analysis of gene differential expression aspect.This test is take Chinese cabbage stamen lobe strain W053 and maintenance line W052 thereof as material, utilize this technology, optimize each reaction system of cDNA-AFLP, obtain the fragment that two storerooms have polymorphism, these genes are carried out the analysis of information biology, the design primer is converted into more stable SCAR mark with differential gene, finally obtains the male sterile genes involved.Be not material with this new product of Chinese cabbage stamen lobeization also at present, carry out analysis of gene differential expression by this technology, and then obtain the successful report of male sterile genes involved.

Three, summary of the invention

Technical problem

Purpose of the present invention filters out one or several and the closely linked molecule marker of Chinese cabbage male sterility gene, set up Chinese cabbage male sterile line molecular marker assisted selection system, thereby improve the efficiency of selection of Chinese cabbage male sterile line, for heterotic utilization provides ideal material.

Technical scheme

1, a kind of method of utilizing stamen lobe mark Chinese cabbage male sterility gene, it is characterized in that: use labeled primer AFLP17, left end primer sequence: GACTGCGTACCAATTCAGC, right-hand member primer sequence: GATGAGTCCTGAGTAATGC: perhaps use labeled primer SCAR33, left end primer sequence: CTGAGTAATCGGGCATGCAA, right-hand member primer sequence: GTAATCGCAGCCCAGACAAC.Amplification if can amplify the fragment of 300bp, then indicates the existence of Chinese cabbage male sterility gene by stamen lobe strain and the synthetic DNA of maintenance line RNA reverse transcription thereof;

2, according to claim 1 a kind of utilize stamen lobe mark Chinese cabbage male sterility gene method, AFLP17 and two kinds of molecule marker primers of SCAR33 of wherein adopting are to screen by the following method acquisition:

1) selects Chinese cabbage stamen lobe strain W053 and maintenance line W052 thereof;

2) be used for the preparation of the dna profiling of selection markers primer:

Extract the total RNA of plant tissue and reverse transcription synthetic dsdna, operate according to the included specification sheets of corresponding reagent box; Utilize recognition sequence respectively restriction enzyme EcoRI and the MseI of 6bp and 4bp suitable joint is cut and added to the double-stranded DNA enzyme, enzyme is cut system 20 μ l, wherein 10 * NEB, 2 μ l, DNA 2 μ l, 100 * BSA0.2 μ l, ECORI-HF 0.5 μ l, MSEI0.5 μ l adds ddH ₂O to 20 μ l, 37 ℃ of reaction 3h join this 20 μ l product in the 5 mixed in advance μ l linked systems again, comprise T4 ligase 0.5 μ l, 10 * T4 ligase buffer, 0.5 μ l, MseI adapter 0.5 μ l, EcoRI-HF adapter 0.5 μ l, 10mMATP 0.5 μ l, dd H ₂O 2.5 μ l, 16 ℃ are spent the night; Use corresponding primer to increase in advance and obtain a large amount of templates, 20 μ l systems, wherein DNA connects product 5 μ l, EcoR primer (GACTGCGTACCAATTC) 3 μ l, Mse primer (GATGAGTCCTGAGTAA) 3 μ l, 2.5mM dNTP 2 μ l, 5U rTaq 0.25 μ l, 10 * buffer (Mg ²⁺) 2 μ l, ddH ₂O 4.75 μ l are used for selective amplification after the product dilution;

3) screening of labeled primer:

Use 64 pairs of selective amplification primers to carry out PCR reaction, system is 20 μ l, template 2 μ l wherein, left end primer 1 μ l, right-hand member primer 1 μ l, 10 * PCR buffer (Mg ²⁺Free) 2 μ l, dNTP (2.5mM) 1.6 μ l, Mg ²⁺1.2 μ l, 5U rTaq 0.2 μ l adds ddH ₂O to 20 μ l; The PCR response procedures is: 94 ℃ of denaturation 2min, and first round Amplification: 94 ℃ of 30s, 65 ℃ of 30s, 72 ℃ of 45s, 12 take turns circulation, whenever take turns 0.7 ℃ of circulation lapse of temperature.Second takes turns Amplification: 94 ℃ of 30s, and 56 ℃ of 30s, 72 ℃ of 45s repeat 23 circulations, and last 72 ℃ are extended 5min; The PCR product carries out the electrophoretic separation analysis on 6% denaturing polyacrylamide gel, after finishing, electrophoresis shows band by argentation, filter out the polymorphic bands between stamen lobe strain W053 and maintenance line W052 thereof, thereby obtain the AFLP labeled fragment of 1 300bp of Chinese cabbage male sterility gene, its labeled primer is AFLP17;

4) recovery of differential fragment, Clone and sequence:

Differential band is scraped off with clean blade, place in the 1.5ml centrifuge tube of the bacterium of going out, the dd H2O that adds 100 μ l, in boiling water, boiled 30 minutes, be cooled to and get 2 μ l after the room temperature and be used as template, use pre-amplification primer to carry out pcr amplification, then agarose gel electrophoresis detects, cutting-out contains the sepharose piece of purpose band, reclaims the retrieve and purification that the included scheme of test kit is carried out DNA according to sepharose; The DNA that recovery is obtained is connected with the PMD18-T carrier, and 10 μ l systems comprise pMD 18-T Vector 1 μ l, DNA4 μ l, and Solution I 5 μ l, 16 ℃ are spent the night.Competence is taken out from-70 ℃ of refrigerators, place on ice and melt, add 10 μ l connecting fluids, after placing 30min on ice, 42 ℃ of water-bath 80s take out rapidly ice bath 2min, add the LB liquid nutrient medium of 500 μ l again, centrifuge tube is positioned on the shaking table, 37 ℃, 250rpm recovery 45-60min takes out, the centrifugal 3min of 4000rpm at room temperature, remove supernatant liquor, remain about 100 μ l liquid, inhale with the rifle head and beat suspended sediment, be coated on after stirring on the culture medium flat plate that adds the ammonia benzyl, place 37 degree to cultivate 10 to 14 hours.Choose bacterium with the toothpick of the bacterium of going out in advance when treating to grow single bacterium colony on the culture medium flat plate, place the LB liquid nutrient medium and the sealing that have added the ammonia benzyl, in 37 ℃, the 250rpm concussion was cultivated 12 to 16 hours; Carry out PCR take bacterium liquid as template and detect, have the bacterium liquid of single purpose band to send Nanjing Genscript Biotechnology Co., Ltd.'s order-checking;

5) the AFLP mark is converted into more stable SCAR mark:

According to the sequencing result of AFLP amplifying specific sequence, utilize Primer Premier 5.0 design SCAR primers, carry out pcr amplification, reaction system 20 μ l, wherein 10 * PCR buffer (Mg ²⁺Free) 2 μ l, Mg ²⁺1.2 μ l, dNTP (2.5mM) 1.6 μ l, each 1 μ l of primer, double-stranded DNA 2 μ l, 5U rTaq 0.2 μ l adds ddH ₂O to 20 μ l; Amplification program is: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 58 ℃ of annealing 45s, 72 ℃ are extended 80s, 40 circulations; 72 ℃ are extended 5min, the PCR product detects in 1% agarose gel electrophoresis, automated imaging on the UVP imaging system, filter out the polymorphic bands between Chinese cabbage stamen lobe strain W053 and maintenance line W052 thereof, thereby obtain the SCAR labeled fragment of 1 300bp of Chinese cabbage male sterility gene, its labeled primer is SCAR33.

The present invention has obtained an AFLP mark of Chinese cabbage male sterility gene, and is translated into more stable SCAR mark.

Beneficial effect

What the present invention selected is that Chinese cabbage stamen lobe strain and maintenance thereof are that material is carried out the screening of Chinese cabbage male sterile molecular marker and the foundation of molecular marker assisted selection system.Compare with present technology, its advantage is:

(1) mark is stable.This research identifies one of AFLP mark, and is converted into more stable SCAR mark take Chinese cabbage stamen lobe strain and this a pair of near isogenic line of maintenance line thereof as material.

(2) the molecular marker assisted selection system is easy to operate, saves cost.The Conventional herd breeding method cycle of Chinese cabbage male sterile line is long, and cost is high, time-consuming again effort.Obtained to be applicable to the cDNA-AFLP reaction system of Chinese cabbage by the present invention, optimized the flow process of denaturing polyacrylamide gel electrophoresis, 1 AFLP mark and 1 SCAR molecule marker of having filtered out the Chinese cabbage male sterility gene are used for assisted Selection, set up the efficient method that reclaims fast the purpose band from gel, the molecular marker-assisted selection method of setting up can be realized selecting seedling stage, reduce workload, greatly improve the efficiency of selection of Chinese cabbage male sterile line, thereby accelerate breeding process.

Four, description of drawings

Fig. 1 NAU-AFLP ₃₀₀The screening of mark

Different primers is combined in two cDNA-AFLP amplification collection of illustrative plates in the strain, and wherein the left side is 100bp DNA LadderMarker.Stamen lobe strain is labeled as T, the swimming lane on corresponding every pair of primer the right, and maintenance line is labeled as B, the swimming lane on corresponding every pair of primer left side.Primer is numbered 1-22, and the arrow indication is the differential band that primer 17 increases and obtains in stamen lobe strain, called after NAU-AFLP ₃₀₀

Fig. 2 NAU-SCAR ₃₀₀The screening of mark

The left side is the Marker of DL1000, and four swimming lanes in front are 4 individual plants of maintenance line, are labeled as B, and four swimming lanes in back are 4 individual plants of stamen lobe strain, are labeled as T.Band is increased in stamen lobe strain by primer SCAR33 and obtains called after NAU-SCAR ₃₀₀

Five, embodiment

Implementation procedure of the present invention is:

One, materials and methods

Chinese cabbage stamen lobe strain W053 and this near isogenic line of maintenance line W052 thereof are from Chinese cabbage seminar of Olericulture section of gardening institute of Agricultural University Of Nanjing.

Two, the molecular marker screening analysis mainly utilizes AFLP mark and SCAR mark.

Use 64 pairs of selective amplification primers to carry out PCR reaction, system is 20 μ l, template 2 μ l wherein, left end primer 1 μ l, right-hand member primer 1 μ l, 10 * PCR buffer (Mg ²⁺Free) 2 μ l, dNTP (2.5mM) 1.6 μ l, Mg ²⁺1.2 μ l, 5U rTaq 0.2 μ l adds ddH ₂O to 20 μ l; The PCR response procedures is: 94 ℃ of denaturation 2min, and first round Amplification: 94 ℃ of 30s, 65 ℃ of 30s, 72 ℃ of 45s, 12 take turns circulation, whenever take turns 0.7 ℃ of circulation lapse of temperature.Second takes turns Amplification: 94 ℃ of 30s, and 56 ℃ of 30s, 72 ℃ of 45s repeat 23 circulations, and last 72 ℃ are extended 5min; The PCR product carries out the electrophoretic separation analysis on 6% denaturing polyacrylamide gel, after finishing, electrophoresis shows band by argentation, filter out the polymorphic bands between stamen lobe strain W053 and maintenance line W052 thereof, thereby obtain the AFLP labeled fragment of 1 300bp of Chinese cabbage male sterility gene, its labeled primer is AFLP17;

Differential band is scraped off with clean blade, place in the 1.5ml centrifuge tube of the bacterium of going out, the dd H2O that adds 100 μ l, in boiling water, boiled 30 minutes, be cooled to and get 2 μ l after the room temperature and be used as template, use pre-amplification primer to carry out pcr amplification, then agarose gel electrophoresis detects, cutting-out contains the sepharose piece of purpose band, reclaims the retrieve and purification that the included scheme of test kit is carried out DNA according to sepharose; The DNA that recovery is obtained is connected with the PMD18-T carrier, and 10 μ l systems comprise pMD 18-T Vector 1 μ l, DNA 4 μ l, and Solution I 5 μ l, 16 ℃ are spent the night.Competence is taken out from-70 ℃ of refrigerators, place on ice and melt, add 10 μ l connecting fluids, after placing 30min on ice, 42 ℃ of water-bath 80s take out rapidly ice bath 2min, add the LB liquid nutrient medium of 500 μ l again, centrifuge tube is positioned on the shaking table, 37 ℃, 250rpm recovery 45-60min takes out, the centrifugal 3min of 4000rpm at room temperature, remove supernatant liquor, remain about 100 μ l liquid, inhale with the rifle head and beat suspended sediment, be coated on after stirring on the culture medium flat plate that adds the ammonia benzyl, place 37 degree to cultivate 10 to 14 hours.Choose bacterium with the toothpick of the bacterium of going out in advance when treating to grow single bacterium colony on the culture medium flat plate, place the LB liquid nutrient medium and the sealing that have added the ammonia benzyl, in 37 ℃, the 250rpm concussion was cultivated 12 to 16 hours; Carry out PCR take bacterium liquid as template and detect, have the bacterium liquid of single purpose band to send Nanjing Genscript Biotechnology Co., Ltd.'s order-checking;

According to the sequencing result of AFLP amplifying specific sequence, utilize Primer Premier 5.0 design SCAR primers, carry out pcr amplification, reaction system 20 μ l, wherein 10 * PCR buffer (Mg ²⁺Free) 2 μ l, Mg ²⁺1.2 μ l, dNTP (2.5mM) 1.6 μ l, each 1 μ l of primer, double-stranded DNA 2 μ l, 5U rTaq 0.2 μ l adds ddH ₂O to 20 μ l; Amplification program is: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 58 ℃ of annealing 45s, 72 ℃ are extended 80s, 40 circulations; 72 ℃ are extended 5min, the PCR product detects in 1% agarose gel electrophoresis, automated imaging on the UVP imaging system, filter out the polymorphic bands between Chinese cabbage stamen lobe strain W053 and maintenance line W052 thereof, thereby obtain the SCAR labeled fragment of 1 300bp of Chinese cabbage male sterility gene, its labeled primer is SCAR33.

Three, results and analysis

Molecular marker screening is the result show, use 64 pairs of primers that two strains are carried out the denaturing polyacrylamide gel electrophoresis analysis, find the AFLP mark of a Chinese cabbage stamen lobe gene, the fragment of the 300bp that namely amplifies with primer AFLP17, called after NAU-AFLP ₃₀₀(Fig. 1).Respectively 4 individual plants of stamen lobe strain and 4 individual plants of maintenance line are carried out augmentation detection according to the primers of this fragment, the result shows, this combination of primers all can amplify a stable specific band in 4 individual plants of Chinese cabbage stamen lobe strain, be approximately 300bp, consistent with the expection clip size, and all do not amplify corresponding band (Fig. 2) in the maintenance line individual plant, show successfully this AFLP mark to be converted into the SCAR mark called after NAU-SCAR ₃₀₀Because SCAR is marked at the specificity in the Chinese cabbage stamen lobe strain, we infer that the SCAR mark of acquisition may be chain with male-sterile character.

Obtained to be applicable to the cDNA-AFLP reaction system of Chinese cabbage, optimized the flow process of denaturing polyacrylamide gel electrophoresis, 1 AFLP mark and 1 SCAR molecule marker of having filtered out the Chinese cabbage male sterility gene are used for assisted Selection, set up the efficient method that reclaims fast the purpose band from gel, the molecular marker-assisted selection method of setting up can be realized selecting seedling stage, reduce workload, greatly improve the efficiency of selection of Chinese cabbage male sterile line, thereby accelerate breeding process.

Claims (2)

1. a method of utilizing stamen lobe mark Chinese cabbage male sterility gene is characterized in that: use labeled primer AFLP17, left end primer sequence: GACTGCGTACCAATTCAGC, right-hand member primer sequence: GATGAGTCCTGAGTAATGC; Perhaps use labeled primer SCAR33, left end primer sequence: CTGAGTAATCGGGCATGCAA, right-hand member primer sequence: GTAATCGCAGCCCAGACAAC.Amplification if can amplify the fragment of 300bp, then indicates the existence of Chinese cabbage male sterility gene by stamen lobe strain and the synthetic DNA of maintenance line RNA reverse transcription thereof.

2. a kind of method of utilizing stamen lobe mark Chinese cabbage male sterility gene according to claim 1, AFLP17 and two kinds of molecule marker primers of SCAR33 of wherein adopting are to screen by the following method acquisition:

1) selects Chinese cabbage stamen lobe strain W053 and maintenance line W052 thereof;

2) be used for the preparation of the dna profiling of selection markers primer:

Extract the total RNA of plant tissue and reverse transcription synthetic dsdna, restriction enzyme EcoRI and the MseI of 6bp and 4bp cut and add suitable joint with the double-stranded DNA enzyme respectively to utilize recognition sequence, use corresponding primer to increase in advance and obtain a large amount of templates, be used for selective amplification after the product dilution;

3) screening of labeled primer:

Use 64 pairs of selective amplification primers to carry out PCR reaction, system is 20 μ l, template 2 μ l wherein, left end primer 1 μ l, right-hand member primer 1 μ l, 10 * PCR buffer (Mg ²⁺Free) 2 μ l, dNTP (2.5mM) 1.6 μ l, Mg ²⁺1.2 μ l, 5U rTaq 0.2 μ l adds ddH ₂O to 20 μ l; The PCR response procedures is: 94 ℃ of denaturation 2min, and first round Amplification: 94 ℃ of 30s, 65 ℃ of 30s, 72 ℃ of 45s, 12 take turns circulation, whenever take turns 0.7 ℃ of circulation lapse of temperature.Second takes turns Amplification: 94 ℃ of 30s, and 56 ℃ of 30s, 72 ℃ of 45s repeat 23 circulations, and last 72 ℃ are extended 5min; The PCR product carries out the electrophoretic separation analysis on 6% denaturing polyacrylamide gel, after finishing, electrophoresis shows band by argentation, filter out the polymorphic bands between stamen lobe strain W053 and maintenance line W052 thereof, thereby obtain the AFLP labeled fragment of 1 300bp of Chinese cabbage male sterility gene, its labeled primer is AFLP17;

4) recovery of differential fragment, Clone and sequence:

Scrape differential band and place the 1.5ml centrifuge tube, add 100 μ l dd H2O, in boiling water, boiled 30 minutes, get 2 μ l after the cooling and do template, use pre-amplification primer to carry out pcr amplification, the PCR product is carried out retrieve and purification; The DNA that recovery obtains is connected with the PMD18-T carrier and transforms intestinal bacteria; Bacterium liquid PCR detects, and the Nanjing Genscript Biotechnology Co., Ltd. that send that chooses the single purpose band checks order;

5) the AFLP mark is converted into more stable SCAR mark:

According to the sequencing result of AFLP amplifying specific sequence, utilize Primer Premier 5.0 design SCAR primers, carry out pcr amplification, reaction system 20 μ l, wherein 10 * PCR buffer (Mg ²⁺Free) 2 μ l, Mg ²⁺1.2 μ l, dNTP (2.5mM) 1.6 μ l, each 1 μ l of primer, double-stranded DNA 2 μ l, 5U rTaq 0.2 μ l adds ddH ₂O to 20 μ l; Amplification program is: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 58 ℃ of annealing 45s, 72 ℃ are extended 80s, 40 circulations; 72 ℃ are extended 5min, the PCR product detects in 1% agarose gel electrophoresis, automated imaging on the UVP imaging system, filter out the polymorphic bands between Chinese cabbage stamen lobe strain W053 and maintenance line W052 thereof, thereby obtain the SCAR labeled fragment of 1 300bp of Chinese cabbage male sterility gene, its labeled primer is SCAR33.

Images