CN103173444A - Functional marker for accurately distinguishing chilli from pimento as well as detection primer group and detection method thereof - Google Patents
Functional marker for accurately distinguishing chilli from pimento as well as detection primer group and detection method thereof Download PDFInfo
- Publication number
- CN103173444A CN103173444A CN2013101022253A CN201310102225A CN103173444A CN 103173444 A CN103173444 A CN 103173444A CN 2013101022253 A CN2013101022253 A CN 2013101022253A CN 201310102225 A CN201310102225 A CN 201310102225A CN 103173444 A CN103173444 A CN 103173444A
- Authority
- CN
- China
- Prior art keywords
- pimento
- plant
- capsicum
- pcr
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a functional marker for accurately distinguishing chilli from pimento as well as a detection primer group and a detection method thereof. The detection primers include F1: GCCATCAGTGTATGCTTT, F2: CATACCGCTCCACGGAAAAGAC, and R: CGTAAACTTCCGTTGTAAT. The detection method comprises the following steps of: 1) extracting the plant genome DNA; 2) performing PCR amplification by use of three functional marker primers by taking the plant genome DNA as a template; and 3) performing agarose gel electrophoresis of the PCR product, and observing the amplification result, wherein if the PCR product only has one stripe with length of 1,363bp, the plant is chilli; if the PCR product only has one stripe with length of 1,171bp, the plant is pimento; and if the PCR product has both stripes, the plant is a hybrid plant of chilli and pimento. The method disclosed by the invention can effectively and accurately detect a single plant genotype in a segregation population established by chilli and pimento and predict corresponding phenotype so as to perform targeted selection of the segregation population and improve the breeding efficiency; and moreover, the method also can be used for detecting the seed purity.
Description
Technical field
The invention belongs to the molecular mark field, relate to functional label and detection primer sets and the detection method of a kind of accurate differentiation capsicum and pimento.
Background technology
Capsicum (
CapsicumL.) be a kind of important vegetable crop, extensively cultivate in South and North America, Europe, Asia, Oceania etc. all over the world, be divided into 5 cultivars according to morphology and cytologic characteristic, be respectively
Capsicum annuum,
C. frutescens,
C. chinense,
C. baccatumWith
C. pubescens, wherein
C. annuumBe to cultivate in the world the cultivar the most extensive, that type is the abundantest, so far worldwide, pepper breeding mainly exists
C. annuumLaunch on this cultivar (Pickersgill, 1997).
Capsicum is well received by consumers because of its unique pungent, not only can eat raw, can also be processed into hot sauce, red chilly powder etc., and moreover, the Capsaicinoids in its fruit also is with a wide range of applications at medicine industry.Therefore, Chinese scholars conducts in-depth research the generation of capsicum pungent, and result shows, the capsicum pungent is by single dominant gene
Pun1(
CGene) control, it has epistatic action to all other pungent genes involveds, and when isozygotying recessiveness, namely pungent lacks (Boswell, 1937 when this gene; Webber, 1912).Up to the present, three have been identified
Pun1Spontaneous mutation allelotrope, one of them be from
C. annuumAllelotrope
Pun 1 1, with
Pun 1Compare,
Pun 1 1There is one section in genome sequence across the base deletion of the approximately 2.5kb in promoter region and First Exon district, causes this gene to transcribe and to translate, so that pungent disappearance (Stewart Jr et al, 2005).Pimento is the mutation of capsicum, carries
Pun1Spontaneous mutation allelotrope
Pun 1 1
In the practices of breeding, breeding man need to take full advantage of the excellent genes of capsicum and pimento, and it is integrated, traditional breeding method is both are hybridized and carry out the selection of offspring's segregating population large Tanaka, this traditional system of selection is the low and waste land for growing field crops resource of efficient often, therefore, the functional label detection technique of setting up a kind of efficiently and accurately is the effective way that addresses this problem.
It is inner that functional label derives from the gene order of controlling phenotype, after the phenotypic function of sldh gene sequence, (answering) allelotrope sequence polymorphism and corresponding phenotypic effect thereof according to this gene, thereby develop DNA marker (Andersen and L ü bberstedt, 2003) that to distinguish and to predict (answering) allelotrope and contrast character.Functional label due to derive from gene inner show with gene be divided into from, and with the phenotype direct correlation, therefore, compare with other molecule marker in molecular breeding uses and have many advantages, main manifestations is in the following areas: one, accurately and reliably: can avoid owing to being divided into from, functional label with target gene the selection mistake that produces due to the restructuring exchange, more effective when the target gene detection of colony; Two, generally applicable: can use under multiple different genetic background, all effective to biological engineering colony and natural population; Three, avoid Linkage drag: because being derives from gene inside, directly reflect the objective trait performance, when therefore utilizing backcross transformation to carry out the transfer of good character, Linkage drag can be better avoided in the application of functional label, reduces the not beneficial gene of donor to the importing of acceptor.
Capsicum (
CapsicumL.) its molecular biology research is started late for other several model plants, and Fine Mapping and clone's gene is limited, therefore, has restricted development and the utilization of functional label, and the present invention is fully verifying
Pun1Develop functional label on the basis of allelic sequence variation and phenotypic effect, the acceleration function is marked at the utilization process in Vegetable Breeding and fundamental research.
Summary of the invention
The object of the present invention is to provide the functional label of a kind of accurate differentiation capsicum and pimento to detect primer, test kit and detection method.
The present invention is based on
Pun1(the GENBANK accession number is gene: allelic sequence variation development functional label AY819029.1), 3 primers have been designed dexterously, primers F 1 is positioned at the First Exon district, and primers F 2 is across the about deletion sequence of 2.5kb, and primer R is public primer (Fig. 1).When plant is capsicum, can only be that primers F 1 and R combination amplifies specific band 1; When plant is pimento, can only be that primers F 2 and R combination amplifies specific band 2; When plant was the heterozygous plant of capsicum and pimento, 2 special bands increased simultaneously.
The technical solution used in the present invention is:
The functional label of a kind of accurate differentiation capsicum and pimento, it is positioned at capsicum
Pun1The 27th bp on gene (SEQ ID NO.1)～2587 bp.
The PCR primer sets of a kind of accurate differentiation capsicum and pimento comprises following 3 primers:
F1：GCCATCAGTGTATGCTTT（SEQ ID NO.2）；
F2：CATACCGCTCCACGGAAAAGAC（SEQ ID NO.3）；
R：CGTAAACTTCCGTTGTAAT（SEQ ID NO.4）。
The PCR test kit of a kind of accurate differentiation capsicum and pimento, it contains above-mentioned PCR primer sets.
Also contain 10 * PCR buffer in described test kit, dNTPs and Taq enzyme.
A kind of method of accurate differentiation capsicum and pimento comprises the steps:
1) extract the plant genomic dna;
2) take the plant genomic dna as template, utilize 3 functional label primers to carry out pcr amplification, 3 primers are respectively:
F1：GCCATCAGTGTATGCTTT（SEQ ID NO.2），
F2：CATACCGCTCCACGGAAAAGAC（SEQ ID NO.3），
R：CGTAAACTTCCGTTGTAAT（SEQ ID NO.4）；
3) the PCR product is carried out agarose gel electrophoresis and separate, observe amplification: if the PCR product only has the single band of long 1363bp, this plant is capsicum; If only have the single band of long 1171bp, this plant is pimento; And if have simultaneously this two band, this plant is the heterozygous plant of capsicum and pimento.
Step 1) is to adopt the CTAB method to extract the genomic dna of plant leaf.
Step 2) in, the PCR system is 20 μ L, comprises 2 μ L 10 * PCR buffer, and 1.5 μ L concentration are the dNTPs of 2.5 mM, concentration is each 1 μ L of primers F 1, primers F 2 and primer R of 10 μ M, 1 μ L concentration is the template DNA of 40 ng/ μ L, and Taq enzyme 1 U adds the water constant volume to 20 μ L.
Step 2) in, the PCR response procedures is: 94 ℃ of denaturation 5 min; 94 ℃ of sex change 30 s, 57 ℃ of annealing 1 min, 72 ℃ are extended 90 s, 5 circulations; 94 ℃ of sex change 30 s, 62 ℃ of annealing 1 min, 72 ℃ are extended 90 s, 5 circulations; 94 ℃ of sex change 30 s, 60 ℃ of annealing 1 min, 72 ℃ are extended 90 s, 25 circulations; 72 ℃ are extended 10 min.
The described electrophoretic separation of step 3) sepharose concentration used is 1%, and voltage is 4-5V/cm, and the time is 1 h.
The invention has the beneficial effects as follows:
(1) the present invention is based on the functional label of allelic sequence variation design, and mark is positioned at gene inside, can be because the restructuring exchange cause selecting mistake, and accuracy rate is high.
(2) the present invention is the codominant marker, good reproducibility, and the change because of reaction conditions does not cause the detected result deviation.
(3) the present invention is based on round pcr, (can detect 300～500 samples every day) simple to operate can carry out autotelic selection to breeding material in seedling stage in the laboratory, saves the breeding cost and accelerates breeding process.
(4) the present invention can detect and predict its phenotype in any vegetative period the single plant of capsicum/pimento, and does not affect its normal growth.
Description of drawings
Fig. 1 is the principle of design figure that functional label of the present invention detects primer;
Fig. 2 is 10 F
1(swimming lane 1～10 is 10 F to the detection electrophorogram of individual plant
1Individual plant, swimming lane 11,12 is respectively female parent and male parent, swimming lane 13 is 5000 ladder);
Fig. 3 is 15 F
2Individual plant the detection electrophorogram (swimming lane 1～15 is 15 F
2Individual plant, swimming lane 16,17 is respectively female parent and male parent, swimming lane 18 is 5000 ladder).
Embodiment
The present invention is further illustrated below in conjunction with embodiment, but be not limited to this.
Embodiment
Pimento male sterile especially pimento cytoplasmic male sterilty (CMS) is difficult to find restorer and can not realizes the pimento three series mating.In order to accelerate the flow of research of pimento CMS, need to recover the transformation that GENE SOURCES is carried out the pimento restorer with capsicum in the breeding practice process.
Take carry recover gene capsicum 12A as male parent, this material fruit erietiform, food flavor is peppery; Target material pimento self-mating system 15A is maternal, and this material Horticultural Characters is good, and combining ability is high, the fruit bird-caging, and food flavor is sweet, and both hybridize acquisition F
1, to F
1True and false hybrid verifies, step is as follows:
1, design of primers
With capsicum
Pun1Gene (SEQ ID NO.1) is compared pimento
Pun 1 1There is one section on gene across the base deletion of the approximately 2.5kb in promoter region and First Exon district, the present embodiment is according to this allelic sequence variation, 3 primers have been designed dexterously, primers F 1 is positioned at the First Exon district, primers F 2 is across the about deletion sequence of 2.5kb, namely be positioned at 8 bases after front 14 bases of deletion sequence and deletion sequence, totally 22 bases, primer R is public primer (Fig. 1).When plant is capsicum, it can only be the specific band that primers F 1 and R combination amplifies long 1363bp; When plant is pimento, it can only be the specific band that primers F 2 and R combination amplifies long 1171bp; When plant was the heterozygous plant of capsicum and pimento, 2 special bands increased simultaneously.Article 3, the sequence that detects primer is as follows:
F1：GCCATCAGTGTATGCTTT（SEQ ID NO.2）；
F2：CATACCGCTCCACGGAAAAGAC（SEQ ID NO.3）；
R：CGTAAACTTCCGTTGTAAT（SEQ ID NO.4）。
2, PCR detects, and step is as follows:
(1) after the single fruit sowing 6 seeds of each carpostrote kind in seedling-raising cup, carry out cultivation management at 25～30 ℃, the greenhouse of relative humidity 50～70%, when seedling grew to 5～6 true leaves, each single fruit selected 1 individual plant, every individual plant is got 1～2 tender leaf, extracts the plant genomic dna with the CTAB method.
(2) take above-mentioned DNA as template, utilize 3 detection primers to carry out pcr amplification.
Reaction system is 20 μ L: comprise 2 μ L 10 * PCR buffer, 1.5 μ L dNTPs(concentration are 2.5 mM), primers F 1, primers F 2 and primer R(concentration are 10 μ M) each 1 μ L, 1 μ L template DNA (concentration is 40 ng/ μ L),
TaqEnzyme 1 U adds the water constant volume to 20 μ L.
The PCR response procedures is: 94 ℃ of denaturation 5 min, (72 ℃ are extended 90 s for 94 ℃ of sex change 30 s, 57 ℃ of annealing 1 min) 5 circulations; (72 ℃ are extended 90 s for 94 ℃ of sex change 30 s, 62 ℃ of annealing 1 min) 5 circulations; (72 ℃ are extended 90 s for 94 ℃ of sex change 30 s, 60 ℃ of annealing 1 min) 25 circulations; 72 ℃ are extended 10 min.
(3) above-mentioned PCR product carries out the agarose gel electrophoresis separation, sepharose concentration used is 1%, voltage is 4-5V/cm, time is 1 h, after ethidium bromide staining in gel imaging system instrument observations and take pictures, result shows that 10 individual plants all amplify two special bands (Fig. 2) of long 1363bp and 1171bp, shows to be true hybrid for 10 single fruits (in Fig. 2, swimming lane 1～10 is 10 F
1Individual plant, swimming lane 11,12 is respectively female parent and male parent, swimming lane 13 is 5000 ladder).
(4) with hybrid F
1Plant in the land for growing field crops, normal management, the front bagging selfing of blooming obtains F
2Seed.
To segregating generation F
2Select, step is as follows:
(1) 200 individual plants of sowing are in seedling-raising cup, carry out cultivation management at 25～30 ℃, the greenhouse of relative humidity 50～70%, and when seedling grew to 5～6 true leaves, every individual plant was got 1～2 tender leaf, extracted the plant genomic dna with the CTAB method.
(2) repeat above-mentioned steps (2) and (3) 200 individual plants are detected, result shows F
2Separating appears in colony, and wherein 48 strains amplify maternal banding pattern, and 55 strains amplify the male parent banding pattern, and 97 strains amplify two strip-types.Fig. 3 is the part amplification, and in figure, 15 individual plants have 7 all to amplify 2 special bands, and 4 amplify the male parent banding pattern, and 4 amplify maternal banding pattern (in Fig. 3, swimming lane 1～15 is 15 F
2Individual plant, swimming lane 16,17 is respectively female parent and male parent, swimming lane 18 is 5000 ladder).
200 individual plants are transplanted to the land for growing field crops, normal management, subjective appreciation hot degree of pepper after fruit maturation, result shows, 48 individual plant fruits that amplify maternal banding pattern are all not peppery, all there is pungent in various degree in other 152 individual plant fruits, conform to the PCR detected result, show that method of the present invention can accurately distinguish pimento and capsicum.
(3) in conjunction with relevant Horticultural Characters, the elected pimento plant of 48 strains is selected, rear selfing 2-3 is for obtaining the pimento restorer, test cross checking fertility.
Can strengthen segregating population (as the segregating population of 1000 individual plants) in order to accelerate breeding process in actual breeding practice, utilize this functional label to select in seedling stage, eliminate pepper plant, plantation pimento plant, then the binding purposes proterties selects to reach breeding objective.
＜110〉Vegetables Inst., Guangdong Academy of Agricultural Sciences; Agriculture vegetable seed industry company limited of Guangdong section
＜120〉functional label and detection primer sets and the detection method of a kind of accurate differentiation capsicum and pimento
<130>
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 3752
<212> DNA
<213> Capsicum L.
<400> 1
tcattagaag gtcataccgc tccacgaaaa tgcaccttga aagatataac acggacaacg 60
aatcattatc cccatcatca ctattactcc cacttccctt gcactcttca ctgtcaccac 120
tgacactccg cttggcaaca ttttcactat aatcgacgta gtcgcttatc tcctttaact 180
ccgaatctga ttcggacacc gactcttcag ttttctttct ttttgacact ttttcaactg 240
tcgcagctct tctttttcta ctactaccag cggtatcgtc tttcttttta ggaatgataa 300
attttctacc cattttcaac acaatctaca cctaaagaac aaacatccca ttttcagttc 360
atagacgaca agtctatcaa cagaaataac ttaatgatca aatgaacacc accccccccc 420
cccccaaaaa aaaaaaatta acaaacaccc catcattaaa cagttcacta cacaaacata 480
caataattga atcaaatcaa acatgcaaaa tatcaaaaca caacaattgc taaaaatcaa 540
actagtgcac ctaatcaaac taattagcta ttaatatttc aattctcact attttaacaa 600
tcatgtttta aaagaatttc atacgtctga aaattgaaat atatctaggg cattctcatt 660
tcatagacca cgggtctacg gatagacctc gggtctacga acagaaatag gtcgctgttc 720
aaatcaaaat gccaaaataa ctcttcaaac aactattatc ccaccattca acacttcgtt 780
gctaaataaa ccacaactaa accaaaacac caaattcgaa gaaaaaattt ctacatcact 840
acgaattgat tagcaaaaaa aaaacgttta aatggatcta gaaatgatcg aaacttgatt 900
ttaactaacc ttgcaaagca gcaacaaccc cttagtagct ggagaagaag acgaaatgaa 960
aatggcattt ttggaagaag tagtttcaaa agcaggagtt gggaattgaa gaggagagag 1020
agggtgggtt tttttaaata ttggaataat tggagggtgt taggtgtatt atattaaatt 1080
tgtaaagttg taaaaatgat gaattggtcc cttggccgat gcgtgggccc cactttttca 1140
taaaaaataa atcaaaaaga aattaagtag gtatttgaca aattaatttt ggagggttcc 1200
ttctttgcca attattcccc actaagctac tcccattcac tcttatatta tagattatag 1260
tataaagtaa tacaaactat gaattgtttt tatattttat tttacaagtt atgaatagtg 1320
tttatatagg tctctatttc catacaatca cattttgtgg gcagtttttt tgggattgtc 1380
acgaaggcga ggtttgttca ttttgtggaa agagaattgg atttctacat ttttatcatc 1440
ttctaggtgt gatgttgata ctactatttg cccaaatatt tgttttaaac atattaatat 1500
tatgtatcaa aatgtgtaca atataattta acacacgtgc agtatgcatg tatcgcgaaa 1560
ctagttaatt acatgcatca catgtaatag caatagtatt attgtacgac gtactaatat 1620
attagtatct attctagcta ctaatttcct cttaaccgtc tccatgctga aaacaacgcc 1680
acagtgcaac gagccttcta taaaagttga attatataaa aataaggtac agtttagaaa 1740
taaaactaac aaaaaggtaa cctatagttt gggggttggg tagaggttgt ttagccagta 1800
actctattat ttcatttcct tttgtctata taagtgtatc catatatgca agaaaatgtc 1860
aaccggccag cagcatatat ttatttgtta aattaattat ggcttttgca ttaccatcat 1920
cacttgtttc agtttgtaac aaatctttta tcaaaccttc ctctctcacc ccctctacac 1980
ttagatttca caagctatct ttcatcgatc aatctttaag taatatgtat atcccttgtg 2040
cattttttta ccctaaagta caacaaagac tagaagactc caaaaattct gatgagcttt 2100
cccatatagc ccacttgcta caaacatctc tatcacaaac tctagtctct tactatcctt 2160
atgctggaaa gttgaaggac aatgctactg ttgactgtaa cgatatggga gctgagttct 2220
tgagtgttcg aataaaatgt tccatgtctg aaattcttga tcatcctcat gcatctcttg 2280
cagagagcat agttttgccc aaggatttgc cttgggcgaa taattgtgaa ggtggtaatt 2340
tgcttgtagt tcaagtaagt aagtttgatt gtgggggaat agccatcagt gtatgctttt 2400
cgcacaagat tggtgatggt tgctctctgc ttaatttcct taatgattgg tctagcgtta 2460
ctcgtgatca tacgacaaca actttagttc catctcctag atttgtagga gattcagtct 2520
tctctacaca aaaatatggt tctctcatta cgccacaaat tttgtccgat ctcaaccagt 2580
gcgtacagaa aagactcatt tttcctacag ataagttaga tgcacttcga gctaaggtaa 2640
tactaccatc gtccattatt gtttgtctta cggtattttt gaaaagaata atatttaata 2700
gtcttcttga gacatatttc acttaacaag cctaggctat ttagtctatt tgtagaagct 2760
actcttaaac gcctcactta gttaatagca ctccacttat tggtgtcaaa aactactctt 2820
ggacatgtca tttacttaat aacactccac ttaattatcg aacagtaaag tggaaaatat 2880
aaaagaatgc agtaataaat acttgtagtt tttccgaaat gaaaagtact gaataattat 2940
tttaaaataa atttagtttg gttgacatta atttgggatt gaaggtggca gaagaatcag 3000
gagtaaaaaa tccaacaagg gctgaagttg ttagcgctct tcttttcaaa tgtgcaacaa 3060
aggcatcatc atcaatgcta ccatcaaagt tggttcactt cttaaacata cgtactatga 3120
tcaaacctcg tctaccacga aatgccattg gaaatctctc gtctattttc tccatagaag 3180
caactaacat gcaggacatg gagttgccaa cgttggttcg taatttaagg aaggaagttg 3240
aggtggcata caagaaagac caagtcgaac aaaatgaact gatcctagaa gtagtagaat 3300
caatgagaga agggaaactg ccatttgaaa atatggatgg ctataagaat gtgtatactt 3360
gcagcaatct ttgcaaatat ccatactaca ctgtagattt tggatgggga agacctgaaa 3420
gggtgtgtct aggaaatggt ccctccaaga atgccttctt cttgaaagat tacaaagctg 3480
ggcaaggcgt ggaggcgcgg gtgatgttgc acaagcaaca aatgtctgaa tttgaacgca 3540
atgaggaact cgttgagttc attgcctaat taattccaag ttttggagta attggatgtc 3600
atttccaagt cttttgtggt gtttgattga agagagaggg attttacgaa ataaaggaat 3660
acttttgaaa cttacgaaac aaaggtagga atacttttgt aattgttgtg tgtttcatca 3720
acataattac aacggaagtt tacggtcaac aa 3752
<210> 2
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 2
gccatcagtg tatgcttt 18
<210> 3
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 3
cataccgctc cacggaaaag ac 22
<210> 4
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 4
cgtaaacttc cgttgtaat 19
Claims (9)
1. functional label of accurately distinguishing capsicum and pimento, it is positioned at capsicum
Pun1The 27bp on gene (SEQ ID NO.1)～2587bp.
2. PCR primer sets of accurately distinguishing capsicum and pimento comprises following 3 primers:
F1：GCCATCAGTGTATGCTTT（SEQ ID NO.2）；
F2：CATACCGCTCCACGGAAAAGAC（SEQ ID NO.3）；
R：CGTAAACTTCCGTTGTAAT（SEQ ID NO.4）。
3. PCR test kit of accurately distinguishing capsicum and pimento, it contains the primer sets shown in claim 2.
4. test kit according to claim 3, is characterized in that, also contains 10 * PCR buffer in described test kit, dNTPs and Taq enzyme.
5. a method of accurately distinguishing capsicum and pimento, comprise the steps:
1) extract the plant genomic dna;
2) take the plant genomic dna as template, utilize 3 functional label primers to carry out pcr amplification, 3 primers are respectively:
F1：GCCATCAGTGTATGCTTT（SEQ ID NO.2），
F2：CATACCGCTCCACGGAAAAGAC（SEQ ID NO.3），
R：CGTAAACTTCCGTTGTAAT（SEQ ID NO.4）；
3) the PCR product is carried out agarose gel electrophoresis and separate, observe amplification: if the PCR product only has the single band of long 1363bp, this plant is capsicum; If only have the single band of long 1171bp, this plant is pimento; And if have simultaneously this two band, this plant is the heterozygous plant of capsicum and pimento.
6. method according to claim 5, is characterized in that, step 1) is to adopt the CTAB method to extract the genomic dna of plant leaf.
7. method according to claim 5, it is characterized in that, step 2) in, the PCR system is 20 μ L, comprise 2 μ L 10 * PCR buffer, 1.5 μ L concentration is the dNTPs of 2.5 mM, concentration is each 1 μ L of primers F 1, primers F 2 and primer R of 10 μ M, and 1 μ L concentration is the template DNA of 40 ng/ μ L, Taq enzyme 1 U adds the water constant volume to 20 μ L.
8. method according to claim 5, is characterized in that step 2) in the PCR response procedures be: 94 ℃ of denaturation 5 min; 94 ℃ of sex change 30 s, 57 ℃ of annealing 1 min, 72 ℃ are extended 90 s, 5 circulations; 94 ℃ of sex change 30 s, 62 ℃ of annealing 1 min, 72 ℃ are extended 90 s, 5 circulations; 94 ℃ of sex change 30 s, 60 ℃ of annealing 1 min, 72 ℃ are extended 90 s, 25 circulations; 72 ℃ are extended 10 min.
9. method according to claim 5, is characterized in that, the described electrophoretic separation of step 3) sepharose concentration used is 1%, and voltage is 4-5V/cm, and the time is 1 h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013101022253A CN103173444A (en) | 2013-03-27 | 2013-03-27 | Functional marker for accurately distinguishing chilli from pimento as well as detection primer group and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013101022253A CN103173444A (en) | 2013-03-27 | 2013-03-27 | Functional marker for accurately distinguishing chilli from pimento as well as detection primer group and detection method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103173444A true CN103173444A (en) | 2013-06-26 |
Family
ID=48633635
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013101022253A Pending CN103173444A (en) | 2013-03-27 | 2013-03-27 | Functional marker for accurately distinguishing chilli from pimento as well as detection primer group and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103173444A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103898090A (en) * | 2013-08-21 | 2014-07-02 | 中国热带农业科学院热带作物品种资源研究所 | Improved method for extracting genome DNA (Deoxyribose Nucleic Acid) from leaves of capsicum chinense jacquin |
| CN107151709A (en) * | 2017-07-13 | 2017-09-12 | 中国农业科学院蔬菜花卉研究所 | The SNP marker related to capsicum pungent and its application |
| WO2018017772A1 (en) * | 2016-07-19 | 2018-01-25 | Conagen Inc. | Method for the microbial production of specific natural capsaicinoids |
| CN108165653A (en) * | 2018-02-12 | 2018-06-15 | 江西省农业科学院蔬菜花卉研究所 | For identifying the InDel molecular labelings of capsicum maturity and its application |
| US10655150B2 (en) | 2016-01-07 | 2020-05-19 | Conagen Inc. | Methods of making capsinoids by biosynthetic processes |
| CN114885830A (en) * | 2022-04-08 | 2022-08-12 | 昆明理工大学 | Method for cultivating pepper polygene polymerization germplasm based on combination of molecular marker-assisted selection and ploidy breeding |
-
2013
- 2013-03-27 CN CN2013101022253A patent/CN103173444A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| LINDSAY E. WYATT ET AL: ""Development and application of a suite of non-pungency markers for the Pun1 gene in pepper (Capsicum spp.)", 《MOL BREEDING》 * |
| STEWART ET AL: "The Pun1 gene for pungency in pepper encodes a putative acyltransferase", 《THE PLANT JOURNAL》 * |
| 康瑜等: "辣椒转基因研究进展", 《辣椒杂志》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103898090A (en) * | 2013-08-21 | 2014-07-02 | 中国热带农业科学院热带作物品种资源研究所 | Improved method for extracting genome DNA (Deoxyribose Nucleic Acid) from leaves of capsicum chinense jacquin |
| CN103898090B (en) * | 2013-08-21 | 2016-06-29 | 中国热带农业科学院热带作物品种资源研究所 | The Capsicum chinense leaves genomic DNA extracting method of improvement |
| US10655150B2 (en) | 2016-01-07 | 2020-05-19 | Conagen Inc. | Methods of making capsinoids by biosynthetic processes |
| WO2018017772A1 (en) * | 2016-07-19 | 2018-01-25 | Conagen Inc. | Method for the microbial production of specific natural capsaicinoids |
| US11459591B2 (en) | 2016-07-19 | 2022-10-04 | Conagen Inc. | Method for the microbial production of specific natural capsaicinoids |
| US11946083B2 (en) | 2016-07-19 | 2024-04-02 | Conagen Inc. | Method for the microbial production of specific natural capsaicinoids |
| CN107151709A (en) * | 2017-07-13 | 2017-09-12 | 中国农业科学院蔬菜花卉研究所 | The SNP marker related to capsicum pungent and its application |
| CN108165653A (en) * | 2018-02-12 | 2018-06-15 | 江西省农业科学院蔬菜花卉研究所 | For identifying the InDel molecular labelings of capsicum maturity and its application |
| CN108165653B (en) * | 2018-02-12 | 2020-11-06 | 江西省农业科学院蔬菜花卉研究所 | InDel molecular marker for identifying pepper maturity and application thereof |
| CN114885830A (en) * | 2022-04-08 | 2022-08-12 | 昆明理工大学 | Method for cultivating pepper polygene polymerization germplasm based on combination of molecular marker-assisted selection and ploidy breeding |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103173444A (en) | Functional marker for accurately distinguishing chilli from pimento as well as detection primer group and detection method thereof | |
| CN105296475B (en) | Chain molecular labeling and its application with capsicum anti cucumber mosaic virus ospc gene qcmv 21 | |
| Sousa et al. | Genetic mapping of the resistance allele'Co-52'to'Colletotrichum lindemuthianum'in the common bean MSU 7-1 line | |
| CN106912372A (en) | The method for cultivating perennial rice sterile line using hero wild rice vegetative propagation characteristic long | |
| Sa et al. | Genetic diversity and population structure in cultivated and weedy types of Perilla in East Asia and other countries as revealed by SSR markers | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| CN106811462B (en) | Indel marker linked with tomato gray leaf spot resistance gene Sm as well as amplification primer and application thereof | |
| CN104152446A (en) | SSR molecular markers cosegregated from cucumber powdery mildew-resistant major QTL | |
| Rosnina et al. | Morphological and molecular characterization of yellow oyster mushroom, Pleurotus citrinopileatus, hybrids obtained by interspecies mating | |
| CN104774945A (en) | Molecular breeding method for new rice variety carrying gene Pi65(t) with resistance to rice blast | |
| CN103993073B (en) | The rapid identification method of green No. 1 cross-fertilize seed of broccoli kind platform | |
| CN104313155A (en) | Floral character associated molecular marker screening method of amenone form chrysanthemum and application of method | |
| CN110305980B (en) | Breeding method and application of anti-clubroot high-oleic-acid rape | |
| CN104498484B (en) | The dominant disease-resistant gene pm1 of Pumpkin powdery mildew linkage molecule mark and its application | |
| CN108486278A (en) | Primer pair and application for identifying peaceful wheat No. 9 and its derived varieties scab resistance | |
| CN102599047A (en) | Method by adopting molecular marker-assisted backcross to improve gibberellic disease expansion resistance of wheat | |
| CN110358861B (en) | Molecular marker R13I14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN108977573B (en) | Method for identifying purity of seven-star radish hybrid by using SSR molecular marker | |
| CN108690883B (en) | Molecular marker RMD7 for assisting in identifying soybean powdery mildew resistance of soybean to be detected | |
| Caetano-Anollés et al. | DNA amplification fingerprinting and marker screening for pseudo-testcross mapping of flowering dogwood (Cornus florida L.) | |
| CN104560961B (en) | The dominant disease-resistant gene ZYMV 1 of cucurbita pepo ZYMV linkage molecule mark and its application | |
| Izadpanah et al. | Molecular and morphological variation in some Iranian saffron (Crocus sativus L.) accessions | |
| Ikase et al. | Apple breeding and genetic resources in Latvia | |
| CN105331689A (en) | Breeding method and molecular marker of wheat-elytrigia elongata powdery-mildew-resisting translocation line | |
| CN113637791B (en) | Molecular marker for simultaneously identifying restorability and authenticity of pepper male sterile three-line hybrid and identification method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130626 |