CN102965356B - Preparation method and application of recombinant carboxylesterase D-1CarE5 - Google Patents

Abstract

The invention relates to a preparation method of recombinant carboxylesterase D-1CarE5 and an application of the recombinant carboxylesterase D-1CarE5 in degradation of a pesticide namely malathion. According to the preparation method, an escherichia coli carboxylesterase D-1CarE5 engineering bacteria is subjected to induced expression for 16 hours through alpha-lactose to generate a large amount of soluble recombinant carboxylesterase D-1CarE5 protein, and the soluble recombinant carboxylesterase D-1CarE5 protein is purified by using a Ni<2+>-NTA gravity purification column. Beta-naphthyl acetate is used as a substrate to perform enzymatic activity determination on the property of the recombinant carboxylesterase D-1CarE5. The application method of the recombinant carboxylesterase D-1CarE5 comprises the following steps of: adding 1U (beta-naphthyl acetate is used as the substrate to detect enzymatic activity) of carboxylesterase D-1CarE5 into a disodium hydrogen phosphate-potassium dihydrogen phosphate buffer solution which contains the pesticide namely the malathion of which the concentration is 5.5mg/L, the pH is 7.0 and the concentration is 1/15mol/L; performing shock reaction on the mixture in a 3ml total reaction system at the temperature of 37 DEG C; and degrading the pesticide namely the malathion of which the concentration is 5.5mg/L. The degradation result shows that 50 percent of the malathion is degraded in 25 minutes and 89 percent of the malathion is degraded in 100 minutes, which proves that the recombinant carboxylesterase D-1CarE5 has a good effect in control of pesticide residues or pesticide contamination.

Description

Preparation method and the application of a kind of Procaine esterase D-1CarE5 that recombinates

Technical field

The present invention relates to recombinate preparation method and the application in the degraded of agricultural chemicals Malathion thereof of Procaine esterase D-1CarE5, belong to biological technical field.

Background technology

Procaine esterase (Carboxylesterases, E C3.1.1.1) be the nonspecific esterase that a class can catalytic hydrolysis carboxylicesters generates Carboxylic acid and alcohol, belong to α/β hydrolase family member with lipase, its aminoacid sequence contains Ser-Asp-His triplet configuration, Ser, Asp, His has formed carboxylesterase's catalytic active center (Nardini, M, et al. current Opinion in Structural Biology. 1999,9 (6): 732-737.).

Carboxylesterase is extensively present in (Melloney J., et al., J in animal, plant, microorganism ournal of Molecular Catalysis B: enzymatic. 2005,32:261-270.), wherein microbe-derived Procaine esterase is a kind of important industrial enzyme, in, transesterify synthetic in catalysis ester hydrolysis, ester etc., there is significant application value, there is good regioselectivity and stereoselectivity (Ramos Tombo, et al. agricultural and Biological Chemistry. 1987,51:1833-1838.).These peculiar properties make Procaine esterase in fields such as food, chemical industry, pharmacy, energy development and environment protection, have broad application prospects (Jaeger K.E., et al., trends in Biotechnology. 1998,16 (9): 396-403.).

In current agriculture production, 70% agricultural chemicals using is organophosphorus pesticide, and 70% organophosphorus pesticide is riskiest pesticide, and it is residual that the use of these agricultural chemicals is easy in agricultural-food, and then have influence on people's health.

Utilizing the residual great majority of Degradation of Pesticides By Microorganisms is the enzymolysis that rely on intracellular enzyme, but because wild strain enzymatic productivity is limited, fermentation period length, purifying complex, be difficult to a large amount of production, production cost is high, has limited it and has applied.

Summary of the invention

The object of this invention is to provide preparation method and the application in the degraded of agricultural chemicals Malathion thereof of a kind of Procaine esterase D-1CarE5 that recombinates.

The preparation method of restructuring Procaine esterase D-1CarE5 of the present invention is as follows:

1) intestinal bacteria Procaine esterase D-1CarE5 engineering bacteria is inoculated in LB nutrient solution with 0.1% inoculum size, 37 ℃ of quick oscillation 12 h, then the bacterium liquid of this activation is inoculated into fresh LB(containing 50 μ g/mL Kan and 0.5%(w/v with 1% inoculum size) alpha-lactose) in inducing culture liquid, shaking culture 16 h, centrifugal 5 min of 12000 rpm, collect thalline; With after appropriate pH7.0 Tris-HCl damping fluid suspension thalline, ultrasonic disruption thalline under mixture of ice and water, is drawn supernatant liquor and is carried out purifying target protein with Nickel-NTA Agarose with crude enzyme liquid concentrated in upper eye lid after centrifugal 10 min of 13,000 rpm;

2) purifying:

The Nickel-NTA Agarose of 2 mL is installed in void column, use following damping fluid, pH is 7.0:

NTA-0:20mM Tris-HCl, 0.5M NaCl, 10%(w/v) glycerine;

NTA-20:20mM Tris-HCl, 20mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-40:20mM Tris-HCl, 40mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-60:20mM Tris-HCl, 60mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-80:20mM Tris-HCl, 80mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-100:20mM Tris-HCl, 100mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-200:20mM Tris-HCl, 200mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-300:20mM Tris-HCl, 300mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-500:20mM Tris-HCl, 500mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

Purification step is:

The water balance of (1) 20 mL;

The NTA-0 balance of (2) 20 mL;

(3) add sample 2 mL;

(4) collect and penetrate peak;

(5) NTA-20, NTA-40, NTA-60, NTA-80, NTA-100, NTA-200, NTA-300, the NTA-500 that uses respectively 2 mL be wash-out successively, and collects respectively elutriant;

(6) elutriant being take respectively to β-naphthyl acetate carries out enzyme activity determination (and then definite purification condition, for the purifying of large batch of target protein is prepared) as substrate;

(7) after the enzyme liquid after purifying is identified by enzyme activity determination and protein electrophorese ,-20 ℃ save backup;

Procaine esterase D-1CarE5 aminoacid sequence is as shown in SEQ ID NO.1, and gene order is as SEQ ID NO.2.Building Procaine esterase D-1CarE5 engineering bacteria carrier used is pET28a (+), and Host Strains is e. coli bl21 (DE3).Procaine esterase d-1CarE5can derive from thermophilic alicyclic ring genus bacillus (thermophilic alicyclobacillustengchongensisstrain CGMCC1504).

SDS-PAGE result (Fig. 1) shows, restructuring Procaine esterase D-1CarE5 has obtained expression in intestinal bacteria, after Nickel-NTA Agarose purifying, is single band.

Restructuring Procaine esterase D-1CarE5 of the present invention be take β-naphthyl acetate and is measured its zymologic property as substrate: optimum temperuture is 60 ℃, and optimal pH is 7.0, under 37 ℃ of temperature and pH7.0 condition, is incubated 50 min enzyme activity kept stables, metal ion Pb ²⁺and Mg ²⁺there is activation, Hg ²⁺, Zn ²⁺, Al ³⁺, Cu ²⁺and Ag ⁺deng having stronger restraining effect, enzymatic Determination of Kinetic Parameters kmwith vmaxvalue is respectively 2.64 mM and 1.7 U/mg.

Procaine esterase is a kind of important pesticide degradable enzyme, and it is to containing the organo phosphorous compounds of carboxylic acid ester bond, and as Malathion, Procaine esterase completes degraded by the reversible acylation of active site serine.This acylation discharges an alcohol moiety and a corresponding covalency acylase.The intermediate of this acidylate is because the nucleation of water discharges corresponding carboxylic moiety and activated enzyme, and it can carry out the DeR of a catalysis new round again.

Restructuring Procaine esterase D-1CarE5 of the present invention is as follows to the degraded of agricultural chemicals Malathion: in containing Sodium phosphate dibasic-potassium phosphate buffer that concentration is 5.5 mg/L agricultural chemicals Malathions, pH7.0,1/15mol/L, add 1 U(and take β-naphthyl acetate and survey enzymic activity as substrate) Procaine esterase D-1CarE5, total reaction system 3 ml, under 37 ℃ of conditions of temperature, concussion reaction, is to degrade in 5.5 mg/L agricultural chemicals Malathions to final concentration.

Degradation effect shows just to have 50% Malathion to be degraded in 25 min, has 89% Malathion to be degraded in 100 min, illustrates that Procaine esterase D-1CarE5 has good effect aspect the improvement of pesticide residue or pesticidal contamination.

The present invention derives from thermophilic alicyclic ring genus bacillus (thermophilic alicyclobacillustengchongensisstrain CGMCC1504) Procaine esterase D-1CarE5 carries out heterogenous expression in intestinal bacteria, through alpha-lactose, induce a step to cultivate and just can obtain great amount of soluble albumen, by Nickel-NTA Agarose single step purification, can obtain compared with pure protein, and there is good zymologic property.Agricultural chemicals Malathion Study on degradation is found to add 1 U Procaine esterase D-1CarE5 just to have 50% Malathion to be degraded in 25 min, this and Procaine esterase (the Wensheng Lan that reports insect source, Jian Chong, Hong Jiang, et al. Biotechnol Lett, 2005,27:1141-1146) high to the degradation efficiency of agricultural chemicals Malathion.Illustrate that this enzyme has potential application foreground aspect pesticide residue or pesticidal contamination improvement.

Accompanying drawing explanation

Fig. 1: the SDS-PAGE at the restructuring Procaine esterase D-1CarE5 of expression in escherichia coli analyzes, wherein, 1: low molecular weight protein Marker; 2,3,4,5: be followed successively by NTA-500, NTA-300, NTA-200, the restructuring Procaine esterase D-1CarE5 of NTA-100 purifying wash-out.

Fig. 2: the optimum temperuture of restructuring Procaine esterase D-1CarE5.

Fig. 3: the thermostability of restructuring Procaine esterase D-1CarE5.

Fig. 4: the optimal pH of restructuring Procaine esterase D-1CarE5.

Fig. 5: the pH stability of restructuring Procaine esterase D-1CarE5.

Fig. 6: different metal ion and the chemical reagent impact on restructuring Procaine esterase D-1CarE5 activity.

Fig. 7: restructuring Procaine esterase D-1CarE5 1/[S] with the relation of 1/V.

Fig. 8: the typical curve of agricultural chemicals Malathion.

Fig. 9: the degradation curve of restructuring Procaine esterase D-1CarE5 to agricultural chemicals Malathion.

Embodiment

Experiment material and reagent

1, Procaine esterase d-1CarE5can derive from thermophilic alicyclic ring genus bacillus (thermophilic alicyclobacillustengchongensisstrain CGMCC1504), Procaine esterase D-1CarE5 aminoacid sequence is as shown in SEQ ID NO.1, and gene order is as SEQ ID NO.2.Building Procaine esterase D-1CarE5 engineering bacteria carrier used is pET28a (+), and Host Strains is e. coli bl21 (DE3), is purchased from Novagen company.

2, biochemical reagents: restriction enzyme, archaeal dna polymerase and dNTP are purchased from TaKaRa company; T4 ligase enzyme is purchased from Promega company; Firm blue B and Malathion standard substance are all purchased from Sigma company; Other reagent is all purchased from traditional Chinese medicines group.

3, substratum:

LB substratum: peptone 1%, yeast powder 0.5%, sodium-chlor 1%, pH nature (being about 7.0).Inducing culture adds 0.5%(w/v on this basis) alpha-lactose.

The structure of restructuring Procaine esterase D-1CarE5 engineering bacteria:

Procaine esterase d-1CarE5can derive from thermophilic alicyclic ring genus bacillus (thermophilic alicyclobacillustengchongensisstrain CGMCC1504), Procaine esterase D-1CarE5 aminoacid sequence is as shown in SEQ ID NO.1, and nucleotide sequence is as SEQ ID NO.2.Building Procaine esterase D-1CarE5 engineering bacteria carrier used is pET28a (+), and Host Strains is e. coli bl21 (DE3).Concrete grammar is as follows:

Extract thermophilic alicyclic acid genus bacillus D-1 genomic dna: CTAB cracking process, concrete steps are: by the fresh bacterium liquid centrifuging and taking thalline of liquid culture 12 h, add 800 μ L solution I (20 mM Tris, pH8.0,2 mM Na ₂-EDTA, final concentration 20 mg/mL N,O-Diacetylmuramidases), 37 ℃ of insulation 30 min, adding 100 μ L 10% SDS turns upside down and mixes, the Proteinase K that adds again 10 μ L 10 mg/mL, 37 ℃ of insulation 30 min, adding 150 μ L 5 M NaCl and 150 μ L 10% CTAB solution turns upside down and mixes, 65 ℃ of insulation 20 min, be distributed into the every pipe of 600 μ L, add again 600 μ L phenol/chloroform/Virahols (volume ratio 25:24:1) to carry out extracting, centrifugal 10 min of 12000 rpm at 4 ℃, get supernatant 300 μ L extrct foreigh protein removing again in 300 μ L chloroform/Virahols (volume ratio 24:1), centrifugal 10 min of 12000 rpm at 4 ℃, get again supernatant and add the pH5.2 3 M NaAc of 2 times of volume dehydrated alcohols and 1/10 volume,-70 ℃ of precipitation 1h, centrifugal 20 min of 13500 rpm at 4 ℃, abandon supernatant, use again 70% washing with alcohol twice, vacuum-drying, add appropriate TE to dissolve, be placed in-20 ℃ standby.

According to thermophilic alicyclic acid genus bacillus D-1 genome sequencing and gene annotation, analyze carboxylesterase gene d-1CarE5and primer CarF and CarR are expressed in design:

Upstream primer CarF:5 ' CGC gGATCC(line part is ATGCAAAGCATGCTGCGG 3 ' bamh I restriction enzyme site)

Downstream primer CarR:5 ' CCG cTCGAG(line part is GAAAATGTACTGTTTTTGCTTAAAG 3 ' xhoi restriction enzyme site)

Upstream primer T7:5 ' TAATACGACTCACTATAGGG 3 '

Downstream primer T7ter:5 ' TGCTAGTTATTGCTCAGCGG 3 ' is the sub-primer of PCR detection positive colony.

The thermophilic alicyclic acid subtilis genomic dna of take carries out pcr amplification as template.PCR reaction parameter is: 94 ℃ of denaturation 5 min; Then 94 ℃ of sex change 30 sec; 52 ℃ of annealing 30 sec; 72 ℃ are extended 1 min30 sec; 30 rear 72 ℃ of insulation 5 min of circulation.PCR purified product warp bamh I and xhoi double digestion, reclaims object fragment, then with through same enzyme, cut the expression vector pET-28a (+) processing and be connected structure plasmid pET -D-1CarE5, 4 ℃ are spent the night.Get 10 μ l and connect product pET -D-1CarE5be transformed into 100 μ l escherichia coliin BL21 (DE3) competent cell, coat containing on the LB solid plate of Kan, 37 ℃ of incubators are cultivated 13 h, a few strain list of picking bacterium colony reformer plate, use primer (T7, T7ter) carry out colony PCR amplification screening positive clone, thereby obtain intestinal bacteria Procaine esterase D-1CarE5 engineering bacteria.

The preparation of restructuring Procaine esterase D-1CarE5:

Get intestinal bacteria Procaine esterase D-1CarE5 engineering strain, the inoculum size with 0.1% is inoculated in LB(containing 50 μ g/mL Kan) in nutrient solution, 37 ℃ of quick oscillation 12 h.Then the bacterium liquid of this activation is inoculated into fresh LB(containing 50 μ g/mL Kan and 0.5%(w/v with 1% inoculum size) alpha-lactose) in inducing culture liquid, shaking culture 16 h.Centrifugal 5 min of 12000 rpm, collect thalline.With after appropriate pH7.0 Tris-HCl damping fluid suspension thalline, ultrasonic disruption thalline under low temperature water-bath.With crude enzyme liquid concentrated in upper eye lid, after centrifugal 10 min of 13,000 rpm, draw supernatant for purifying target protein.Specifically, adopt Nickel-NTA Agarose to carry out purifying target protein the supernatant liquor of collecting after broken wall.Before purifying, according to dress post specification sheets, the Nickel-NTA Agarose of 2 mL is installed in void column, and prepares following damping fluid (pH is 7.0):

NTA-0:20mM Tris-HCl, 0.5M NaCl, 10%(w/v) glycerine;

NTA-20:20mM Tris-HCl, 20mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-40:20mM Tris-HCl, 40mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-60:20mM Tris-HCl, 60mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-80:20mM Tris-HCl, 80mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-100:20mM Tris-HCl, 100mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-200:20mM Tris-HCl, 200mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-300:20mM Tris-HCl, 300mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

NTA-500:20mM Tris-HCl, 500mM imidazoles, 0.5M NaCl, 10%(w/v) glycerine;

Purification step is:

The water balance of (1) 20 mL;

The NTA-0 balance of (2) 20 mL;

(3) add sample 2 mL;

(4) collect and penetrate peak;

(5) NTA-20, NTA-40, NTA-60, NTA-80, NTA-100, NTA-200, NTA-300, the NTA-500 that uses respectively 2 mL be wash-out successively, and collects respectively elutriant;

(6) elutriant being take respectively to β-naphthyl acetate carries out enzyme activity determination as substrate, and then definite purification condition, for the purifying of large batch of target protein is prepared;

(7) after the enzyme liquid after purifying is identified by enzyme activity determination and protein electrophorese ,-20 ℃ save backup.

SDS-PAGE result (Fig. 1) shows, restructuring Procaine esterase D-1CarE5 has obtained expression in intestinal bacteria, after Nickel-NTA Agarose purifying, is single band.

The property testing of the restructuring Procaine esterase D-1CarE5 of purifying

1, the activation analysis of restructuring Procaine esterase D-1CarE5

The activity determination method of the restructuring Procaine esterase D-1CarE5 of purifying adopts 2-Naphthol method: getting three 10 ml test tubes, number respectively 1,2,3, No. 1 and No. 2 test tubes are experimental group, is for No. 3 control group.In No. 1 and No. 2 test tubes, add Sodium phosphate dibasic-potassium phosphate buffer that 2.5 ml 1/15mol/L pH are 7.0 respectively, in No. 3 test tubes, add Sodium phosphate dibasic-potassium phosphate buffer that 3 ml 1/15mol/L pH are 7.0.In three test tubes, add 30 μ l substrate β-naphthyl acetate alcoholic solutions, be placed in 37 ℃ of water-bath preheating 5 min, then in No. 1 and No. 2 test tubes, add the suitably enzyme liquid of dilution of 0.5 ml, react after 5 min, in every test tube, add immediately 0.5 ml developer (1% firm blue B salt brine solution and 5% SDS are used front 2:5 to mix) solution termination reaction, after fully shaking up, after standing 5 min-10 min, under spectrophotometer 550 nm, measure its absorbance.1 Ge Meihuo unit (U/mL) is defined as under certain condition, and per minute decomposes substrate β-naphthyl acetate and generates the needed enzyme amount of 1 μ moL 2-Naphthol.

2, the optimum temperuture of restructuring Procaine esterase D-1CarE5 and the mensuration of thermostability:

The mensuration of the optimum temperuture of enzyme: Procaine esterase D-1CarE5, under Sodium phosphate dibasic-potassium phosphate buffer condition of 1/15 mol/L pH7.0, is carried out respectively to enzymatic reaction at 12 ℃, 20 ℃, 25 ℃, 30 ℃, 37 ℃, 45 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃, 75 ℃ and 80 ℃.The mensuration of temperature stability: by Procaine esterase D-1CarE5 under Sodium phosphate dibasic-potassium phosphate buffer condition of 1/15 mol/L pH7.0, be incubated respectively 10 min, 20 min, 30 min, 40 min and 50 min at 37 ℃, 60 ℃ and 70 ℃ of three temperature after, carry out enzymatic reaction, with untreated enzyme liquid in contrast.Take β-naphthyl acetate as substrate, react 5 min, measure the zymologic property of purification of carboxylic acids esterase D-1CarE5.Result shows: 60 ℃ of the optimum temperutures (Fig. 2) of D-1CarE5.Enzyme temperature-stable Journal of Sex Research: remnant enzyme activity is more than 80% in 37 ℃ of insulation 50 min; At 60 ℃, be incubated 50 min remnant enzyme activities less than 40%; Tolerance 10min remnant enzyme activity 33%(Fig. 3 at 70 ℃).

3, the optimal pH of restructuring Procaine esterase D-1CarE5 and the mensuration of pH stability:

The mensuration of the optimal pH of enzyme: by Procaine esterase D-1CarE5 60 ℃ of optimum temperutures, enzymatic reaction under the different pH4.8,5.4,6.0,6.5,7.0,7.3 of 1/15 mol/L Sodium phosphate dibasic-potassium phosphate buffer, 7.5 and 8.0 conditions respectively.The mensuration of pH stability: Procaine esterase D-1CarE5,40 ℃ of optimum temperutures, is carried out to enzymatic reaction after tolerating respectively 10 min, 20 min, 30 min, 40 min and 50 min, with untreated enzyme liquid in contrast under pH5.4, pH7.0 and pH7.5.Take β-naphthyl acetate as substrate, react 5 min, measure the zymologic property of purification of carboxylic acids esterase D-1CarE5.Result shows: optimal pH 7.0(Fig. 4 of D-1CarE5); Enzyme stability research tolerates 50 min remnant enzyme activities at more than 80% (Fig. 5) at pH7.0, illustrates that this enzyme is more stable in neutral environment.

4, different metal ion and the chemical reagent impact on restructuring Procaine esterase D-1CarE5 activity:

The metal ion and the chemical reagent that in enzymatic reaction system, add final concentration 1 mM, study its impact on enzymic activity.Take β-naphthyl acetate as substrate, under 60 ℃, pH7.0 condition, react 5 min, measure the enzyme activity of purification of carboxylic acids esterase D-1CarE5.Result (Fig. 6) shows, the metal ion Pb of final concentration 1 mM ²⁺and Mg ²⁺enzyme is had to activation, Hg ²⁺, Zn ²⁺, Al ³⁺, Cu ²⁺and Ag ⁺deng there being stronger restraining effect.

5, the mensuration of the kinetic parameter of restructuring Procaine esterase D-1CarE5:

Under 60 ℃, pH7.0 condition, the 0.6 M β-naphthyl acetate of take is substrate, and termination reaction measure enzymic activity in the 1-30 of enzymatic reaction min, calculates the ratio in enzymic activity and reaction times successively, if this ratio keeps stable within a certain period of time, this time is the first order reaction time.With 0.1-0.95 mM β-naphthyl acetate, be substrate ([S]), in 60 ℃, pH7.0 and first order reaction, under the time, measure enzyme and live, calculate corresponding speed of response (ν), as Fig. 7, according to Lineweaver-Burk method, measure kmwith vmax.After measured, under 60 ℃, pH7.0 condition, restructuring Procaine esterase D-1CarE5 is to β-naphthyl acetate kmwith vmaxbe respectively 2.64 mM and 1.7U/mg.

The degraded application of the restructuring Procaine esterase D-1CarE5 of purifying to agricultural chemicals Malathion:

Getting purification of Recombinant Procaine esterase D-1CarE5 1mL(take β-naphthyl acetate and records Mei Huo unit as 1U as substrate) join and contain concentration in Sodium phosphate dibasic-potassium phosphate buffer of 1/15 mol/L pH7.0 of 5.5 mg/L agricultural chemicals Malathions, total reaction system is 3 mL, 37 ℃ of concussion reactions, the not enzyme-added liquid of control group, replaces enzyme liquid with 1 mL pH7.0 Sodium phosphate dibasic-potassium phosphate buffer.Every 20 min take out 0.5 mL reaction solution and mix concussion with equal-volume normal hexane, and centrifugal 2 min of 12000 rpm get upper strata extract and add 0.2 g anhydrous sodium sulphate to dewater, and centrifugal 30 sec of 12000 rpm, get extract quantitative analysis in gas-chromatography.

Stratographic analysis instrument is Agilent GC7890-MS5975 type gas-chromatography (U.S.), detector is FID, pillar is mm * 0.25, Agilent DB-17(30 m * 0.32 μ m), operational condition: sample size 1 μ l, does not shunt 250 ℃ of injector temperatures, He pressure 16.363 psi, post flow 1 mL/min, 230 ℃ of ion sources, 150 ℃, MS level Four bar; Post case temperature programming: 205 ℃ (keeping 2.5 min), with the speed rising to 220 ℃ of 10 ℃/min, keep 2 min, total times 6 min.

Prepare respectively the agricultural chemicals Malathion standard substance of different concns gradient, according to above chromatogram analysis method analysis, peak area under integral and calculating different concns, each concentration repeats 3 times, calculate peak area mean value, the agricultural chemicals Malathion concentration of take is X-coordinate, and chromatographic peak peak area is that ordinate zou is done Malathion typical curve (Fig. 8).And its detection of measurement and calculation is limited to 0.1 mg/L, the method rate of recovery is 84%-92%.

Procaine esterase D-1CarE5 shows under these conditions, in 25 min, just have 50% Malathion to be degraded to the degradation results of agricultural chemicals Malathion (Fig. 9), have 89% Malathion to be degraded in 100 min.

SEQ ID NO.1：

Met Gln Ser Met Leu Arg Val Val Lys Val Glu Asn Gly Phe Val Arg Gly Leu Pro Ala

1 5 10 15 20

Ala Asp Pro Arg Ile Thr Ser Phe Lys Gly Ile Pro Phe Ala Ala Pro Pro Val Gly Glu Asn

25 30 35 40

Arg Trp Arg Ala Pro Gln Pro Ala Lys Asp Trp Asp Gly Val Phe Asp Ala Tyr Thr Phe

45 50 55 60

Ala Pro Ile Ser Met Gln Ser Pro Ile His His Asn Glu Ser Asn Ile Tyr Gly Arg Glu Trp

65 70 75 80

His Val Asp Pro Asp Thr Pro Met Ser Glu Asp Cys Leu Tyr Leu Asn Ile Trp Thr Pro

85 90 95 100

Ala His Ser Pro Asp Glu Lys Leu Pro Val Phe Val Trp Tyr Phe Gly Gly Gly Leu Gln

105 110 115 120

Val Gly Tyr Thr Ser Glu Met Glu Phe Asp Gly Glu Arg Leu Ala Arg Arg Gly Ile Val

125 130 135 140

Val Val Thr Val Asn Tyr Pro Leu Asn Val Phe Gly Phe Leu Cys His Pro Glu Ile Thr

145 150 155 160

Ala Glu Ala Pro Glu Ala Pro Ala Asn Phe Gly His Leu Asp Gln Gln Phe Ala Thr Gln

165 170 175 180

Trp Val Lys Arg Asn Ile Ala Ala Phe Gly Gly Asp Pro Glu Asn Ile Thr Ile Gly Gly Gln

185 190 195 200

Ser Ala Gly Gly Gly Ser Val Leu Ser Gln Leu Thr Ser Pro Gln Asn Glu Gly Leu Val

205 210 215 220

Gln Arg Ala Ile Ile Gln Ser Gly Leu Phe Gly Arg Val Tyr Pro Gly Gly Arg Met Pro

225 230 235 240

Gly Tyr Gly Arg Thr Leu Ala Glu Ala Glu Ala Asp Gly Met Gln Phe Phe Ala Phe Leu

245 250 255 260

Gly Val Ser Ser Leu Ala Glu Ala Arg Gln Leu Asp Ala Phe Tyr Ile Arg Asp Lys Ala

265 270 275 280

Leu Asp Tyr Lys Gly Phe Trp Gly Thr Val Val Asp Asp Val Phe Cys Met Gly Asp Gly 285 290 295 300

Phe Asp Leu Phe Val Glu Gly Lys His Leu Gln Val Ser Val Leu Phe Gly His Thr Ser

305 310 315 320

Asp Glu Phe Tyr Ser Ala Pro Asn Val Lys Asp Leu Asp Glu Leu Lys Gln Met Ala Val

325 330 335 340

Glu Arg Phe Gly Asp Asp Ala Ala Thr Tyr Leu Ala Leu Cys Glu Ala Asp Ala His Asp

345 350 355 360

Phe Glu Asp Val Leu Lys Lys Ala Thr Leu His Ser Leu Glu Phe Ala Ile Arg Thr Ala

365 370 375 380

Val Gln Ala Ser Ser Asn Trp Lys Thr Gln Glu Pro Leu Tyr Tyr Tyr Val Phe Asp Ala

385 390 395 400

Glu Ile Pro Gly Trp Asp Gln Pro Gly Ala Phe His Ser Val Asp Leu Trp Phe Phe Phe 405 410 415 420

Glu Thr Leu Ala Lys Cys Trp Arg Pro Phe Val Gly Lys His Tyr Asp Leu Ala Arg Gln 425 430 435 440

Met Cys Asp Tyr Trp Ala Asn Phe Ile Arg Ser Gly Asp Pro Asn Gly Lys Asp Met Thr

445 450 455 460

Gly Glu Asp Leu Pro Pro Trp Tyr Pro Cys Thr Pro Asp Ala Pro Tyr Ala Met Val Phe

465 470 475 480

Asp Asp Glu Pro Lys Phe Val Arg Gln Glu Pro Ser Pro Leu Met Gln Phe Phe Val Gln

485 490 495 500

Glu Tyr Phe Lys Gln Lys Gln Tyr Ile Phe

505 510

SEQ ID NO.2：

1 atgcaaagca tgctgcgggt cgtgaaggtc gagaacggtt tcgttcgggg gctcccagca

61 gccgaccctc gcattacaag ctttaagggc attccctttg cagctccgcc agtcggcgaa

121 aatcgctggc gagctcccca gcccgcaaag gactgggacg gcgtattcga cgcttataca

181 ttcgcaccga tttccatgca atcacccata caccacaacg aaagcaacat ctatggtcga

241 gagtggcatg tcgatccgga tactcccatg agtgaggatt gtctctatct caacatctgg

301 acgccggcac acagccctga cgaaaagctt cccgtgtttg tttggtattt cggtggcgga

361 ttgcaggtcg gttacacatc tgaaatggag tttgacggcg aacgcctcgc gcgccgagga

421 atcgtcgtgg ttaccgtcaa ctatcccctc aacgtgtttg gttttttgtg tcatccggag

481 attaccgcag aagcccccga agctccggct aattttggac atctcgatca acagtttgcg

541 acacaatggg tcaagcgcaa tatcgctgca ttcggcggcg atccggagaa catcacgatt

601 ggtggccaat ccgctggcgg tggaagtgta ttaagccaac tcacatctcc ccagaacgaa

661 gggctcgtac aaagggcaat tatccaaagt ggactgtttg gcagagttta tcccggcggt

721 cgtatgccag gttatgggag aacactggcg gaagctgaag cggacggaat gcaattcttt

781 gcgtttcttg gcgtatcctc cttggccgaa gcccgccagc tcgacgcttt ttacatccgt

841 gacaaagcgc tcgactataa gggcttctgg gggactgtcg tggatgacgt attctgcatg

901 ggtgacggat ttgatctctt tgtcgagggt aaacatttac aggtctccgt gctttttggt

961 cacacgtctg acgaatttta cagcgcccca aacgtcaaag atttagatga attgaagcaa

1021 atggccgtcg aacgttttgg tgatgatgcc gcaacatatc ttgcgctttg cgaagcggat

1081 gcacatgatt tcgaagacgt tctgaaaaaa gccacactcc attccttgga gtttgccatt

1141 cgcaccgccg tgcaagccag tagcaactgg aagacgcaag aaccattgta ctattacgta

1201 ttcgatgcag aaattccggg gtgggatcag ccaggggcct ttcattcggt tgatctgtgg

1261 tttttcttcg agactctggc taagtgttgg cggccgtttg tcggaaaaca ttacgacttg

1321 gctcgccaaa tgtgcgatta ctgggccaac ttcatccgtt ctggagatcc aaatgggaaa

1381 gatatgacgg gtgaagattt gccaccctgg tatccctgca cacccgatgc gccatacgcc

1441 atggtattcg atgacgagcc caaatttgtc cgacaagaac caagtcctct tatgcagttc

1501 ttcgtgcaag agtactttaa gcaaaaacag tacattttct ga

Claims (3)

1. a recombinate preparation method of Procaine esterase D-1CarE5, is characterized in that being carried out as follows:

1) getting intestinal bacteria Procaine esterase D-1CarE5 engineering strain is inoculated in LB nutrient solution with 0.1% inoculum size, 37 ℃ of quick oscillation 12 h, then the bacterium liquid of this activation is inoculated in fresh LB inducing culture liquid with 1% inoculum size, it is containing 50 μ g/mL Kan and 0.5% w/v alpha-lactose, shaking culture 16 h, centrifugal 5 min of 12000 rpm, collect thalline; With after appropriate pH7.0 Tris-HCl damping fluid suspension thalline, ultrasonic disruption thalline under mixture of ice and water, is drawn supernatant liquor and is carried out purifying target protein with Nickel-NTA Agarose with crude enzyme liquid concentrated in upper eye lid after centrifugal 10 min of 13000 rpm;

2) purifying:

The Nickel-NTA Agarose of 2 mL is installed in void column, use following damping fluid, pH is 7.0:

NTA-0:20mM Tris-HCl, 0.5M NaCl, 10%w/v glycerine;

NTA-20:20mM Tris-HCl, 20mM imidazoles, 0.5M NaCl, 10%w/v glycerine;

NTA-40:20mM Tris-HCl, 40mM imidazoles, 0.5M NaCl, 10%w/v glycerine;

NTA-60:20mM Tris-HCl, 60mM imidazoles, 0.5M NaCl, 10%w/v glycerine;

NTA-80:20mM Tris-HCl, 80mM imidazoles, 0.5M NaCl, 10%w/v glycerine;

NTA-100:20mM Tris-HCl, 100mM imidazoles, 0.5M NaCl, 10%w/v glycerine;

NTA-200:20mM Tris-HCl, 200mM imidazoles, 0.5M NaCl, 10%w/v glycerine;

NTA-300:20mM Tris-HCl, 300mM imidazoles, 0.5M NaCl, 10%w/v glycerine;

NTA-500:20mM Tris-HCl, 500mM imidazoles, 0.5M NaCl, 10%w/v glycerine;

Purification step is:

(a) water balance of 20 mL;

(b) the NTA-0 balance of 20 mL;

(c) add sample 2 mL;

(d) collect and penetrate peak;

(e) NTA-20, NTA-40, NTA-60, NTA-80, NTA-100, NTA-200, NTA-300, the NTA-500 that uses respectively 2 mL be wash-out successively, and collects respectively elutriant;

(f) elutriant being take respectively to β-naphthyl acetate carries out enzyme activity determination as substrate;

(g) after the enzyme liquid after purifying is identified by enzyme activity determination and protein electrophorese ,-20 ℃ save backup;

Procaine esterase D-1CarE5 aminoacid sequence is as shown in SEQ ID NO.1, and gene order is as SEQ ID NO.2, and building Procaine esterase D-1CarE5 engineering bacteria carrier used is pET28a (+), and Host Strains is e. coli bl21 (DE3).

2. the application of Procaine esterase D-1CarE5 in agricultural chemicals Malathion degraded of recombinating, the aminoacid sequence of described restructuring Procaine esterase D-1CarE5 is as shown in SEQ ID NO.1.

3. the application of restructuring Procaine esterase D-1CarE5 according to claim 2 in the degraded of agricultural chemicals Malathion, it is characterized in that carrying out by the following method: the Procaine esterase D-1CarE5 that adds 1 U in containing Sodium phosphate dibasic-potassium phosphate buffer that concentration is 5.5 mg/L agricultural chemicals Malathions, pH7.0,1/15mol/L, Gai Meihuo unit take β-naphthyl acetate and records as substrate, total reaction system 3 ml, under 37 ℃ of conditions of temperature, concussion reaction, is to degrade in 5.5 mg/L agricultural chemicals Malathions to final concentration.

Images