CN102787107B - Carboxylesterase D-1CarE5 from thermophilic Alicyclobacillus tengchongensis strain, and gene thereof - Google Patents

Carboxylesterase D-1CarE5 from thermophilic Alicyclobacillus tengchongensis strain, and gene thereof Download PDF

Info

Publication number
CN102787107B
CN102787107B CN 201210250855 CN201210250855A CN102787107B CN 102787107 B CN102787107 B CN 102787107B CN 201210250855 CN201210250855 CN 201210250855 CN 201210250855 A CN201210250855 A CN 201210250855A CN 102787107 B CN102787107 B CN 102787107B
Authority
CN
China
Prior art keywords
1care5
carboxylesterase
gene
procaine esterase
enzyme
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN 201210250855
Other languages
Chinese (zh)
Other versions
CN102787107A (en
Inventor
黄遵锡
谢振荣
周峻沛
李俊俊
唐湘华
杨云娟
许波
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yunnan Normal University
Original Assignee
Yunnan Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yunnan Normal University filed Critical Yunnan Normal University
Priority to CN 201210250855 priority Critical patent/CN102787107B/en
Publication of CN102787107A publication Critical patent/CN102787107A/en
Application granted granted Critical
Publication of CN102787107B publication Critical patent/CN102787107B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Enzymes And Modification Thereof (AREA)

Abstract

The invention relates to a carboxylesterase D-1CarE5 having an amino acid sequence represented by SEQ ID NO.1 and a gene thereof, and provides a coding gene D-1CarE5 of the carboxylesterase, a recombinant vector of the carboxylesterase gene D-1CarE5, and a recombinant strain of the carboxylesterase gene D-1CarE5. The carboxylesterase has the following properties: the carboxylesterase has an optimum temperature of 40DEG C and an optimum pH value of 7.38 when alpha-naphthyl acetate is used as a substrate; the carboxylesterase can be activated by metal ions comprising Mn<2+> and Zn<2+> when the final concentrations of the metal ions are 1mM, and can be strongly inhibited by Cu<2+>, Ag<+>, Hg<2+>, Pb<+> and the like; the carboxylesterase keeps basically stable at 35DEG C for 50min; the activity of the carboxylesterase after processed with buffer solutions having a concentration of 1/15mol/L and pH values of 5.91, 7.38 and 8.04 for 80min is above 40%, 90% and 45% respectively; and simultaneously the carboxylesterase can hydrolyze beta-naphthyl acetate. The carboxylesterase can be applied to pesticide residual or pesticide pollution treatment.

Description

Procaine esterase D-1CarE5 and the gene thereof in thermophilic alicyclic ring genus bacillus source
Technical field
The present invention relates to gene engineering technology field, specifically Procaine esterase D-1CarE5 and the gene thereof in a kind of thermophilic alicyclic ring genus bacillus source.
Background technology
Procaine esterase (Carboxylesterases, E C3.1.1.1) be that a class can generate carboxylic acid and pure nonspecific esterase by the catalytic hydrolysis carboxylicesters, belong to α/β hydrolase family member with lipase, its aminoacid sequence contains Ser-Asp-His triplet configuration, Ser, Asp, His has constituted carboxylesterase's catalytic active center (Nardini, M, et al. Current Opinion in Structural Biology. 1999,9 (6): 732-737.).
The carboxylesterase extensively is present in (Melloney J., et al., J in animal, plant, the microorganism Ournal of Molecular Catalysis B: Enzymatic. 2005,32:261-270.), wherein microbe-derived Procaine esterase is a kind of important industrial enzyme, there is significant application value synthesize at the hydrolysis of catalysis ester, ester, transesterify etc., have good regioselectivity and stereoselectivity (Ramos Tombo, et al. Agricultural and Biological Chemistry.1987,51:1833-1838.).These peculiar properties make Procaine esterase have broad application prospects in fields such as food, chemical industry, pharmacy, energy development and environment protection (Jaeger K.E., et al., Trends in Biotechnology. 1998,16 (9): 396-403.).
Procaine esterase is a kind of important degradation of pesticide enzyme, however natural strain enzyme-producing low, be difficult to mass production, the production cost height has limited it and has applied.Utilize molecular biology method to make up high-efficient biological reactor, can improve the expression amount of degradation of pesticide enzyme, realize its large-scale industrial production.This paper clones carboxylesterase's gene from thermophilic alicyclic acid genus bacillus D-1 genome D-1CarE5After expression vector pET28a (+) is connected, be transformed into the middle abduction delivering of e. coli bl21 (DE3) and the Procaine esterase zymologic property has been carried out preliminary study, for further studying Procaine esterase theoretical basis has been established in the degraded of agricultural chemicals.
Summary of the invention
The purpose of this invention is to provide a kind of Procaine esterase.
A further object of the present invention provides the gene of the above-mentioned Procaine esterase of coding.
Another object of the present invention provides the recombinant vectors that comprises said gene.
Another object of the present invention provides the recombinant bacterial strain that comprises said gene.
Procaine esterase D-1CarE5 of the present invention can derive from thermophilic alicyclic ring genus bacillus (thermophilic
Alicyclobacillus?tengchongensisstrain?CGMCC1504）。The aminoacid sequence of D-1CarE5 is shown in SEQ ID NO.1.
Procaine esterase D-1CarE5 of the present invention contains 513 amino acid altogether, and theoretical molecular is 58.65kDa.Be substrate with the α-Yi Suannaizhi: 40 ℃ of optimum temperutures; Optimal pH 7.38; The metal ions M n of final concentration 1 mM 2+And Zn 2+Enzyme there is activation, Cu 2+, Ag +, Hg 2+And Pb +Deng stronger restraining effect is arranged; Be incubated 50 min kept stables below 35 ℃ in temperature; Under 1/15 mol/L pH5.91, pH7.38 and pH8.04 damping fluid, handle 80 min, keep the activity more than 40%, 90% and 45% respectively; Under pH7.38 and 40 ℃, this enzyme is 108.65 ± 0.01 U/mg to the ratio vigor of 0.6 mol/L α-Yi Suannaizhi; Under pH7.0 and 60 ℃, this enzyme is 14.78 ± 0.01 U/mg to the ratio vigor of 0.6 mol/L β-naphthyl acetate.
The invention provides the gene of the above-mentioned Procaine esterase of coding D-1CarE5, this gene order such as SEQ ID NO.2.
The present invention has cloned the encoding gene of Procaine esterase D-1CarE5 by the method for PCR D-1CarE5, its total length 1542 bp, initiation codon is ATG, termination codon is TGA.This Procaine esterase gene compare through BLAST at GeneBank (http://www.ncbi.nlm.nih.gov) database D-1CarE5Among amino acid sequence coded and the GeneBank PaenibacillusSp. the potential carboxylesterase (YP_003012983.1) in JDR-2 source has the highest consistence, is 68%; With BifidobacteriumThe adolescentis ATCC 15703 potential lipase in source (YP_909165.1) have the highest consistence, are 45%, and Procaine esterase is described D-1CarE5It is a kind of new Procaine esterase.
The present invention also provides and has comprised above-mentioned Procaine esterase gene D-1CarE5Recombinant vectors, be preferably pET- D-1CarE5Procaine esterase gene of the present invention is inserted between the suitable restriction endonuclease sites of expression vector, its nucleotide sequence is connected with expression regulation sequence.As the most preferred embodiment of the present invention, Procaine esterase gene of the present invention is inserted on the plasmid pET-28a (+) BamThe H I and XhoBetween the I restriction enzyme site, obtain expression of recombinant e. coli plasmid pET- D-1CarE5
The present invention also provides and has comprised above-mentioned Procaine esterase gene D-1CarE5Recombinant bacterial strain, preferred described bacterial strain is intestinal bacteria, yeast, genus bacillus or lactobacillus, is preferably recombinant bacterial strain BL21 (DE3)/D-1CarE5
The present invention prepares the method for Procaine esterase D-1CarE5 and carries out according to the following steps:
1) with above-mentioned recombinant vectors transformed host cell, gets recombinant bacterial strain;
2) cultivate recombinant bacterial strain, induce the reorganization Procaine esterase to express;
3) reclaim the also expressed Procaine esterase D-1CarE5 of purifying.
Wherein, preferred described host cell is Bacillus coli cells, preferably with expression of recombinant e. coli plasmid transformation escherichia coli cell BL21 (DE3), obtains recombinant bacterial strain BL21 (DE3)/D-1CarE5
The invention provides a new Procaine esterase gene, the Procaine esterase of its coding is substrate with the α-Yi Suannaizhi: 40 ℃ of optimum temperutures; Optimal pH 7.38; The metal ions M n of final concentration 1 mM 2+And Zn 2+Enzyme there is activation, Cu 2+, Ag +, Hg 2+And Pb +Deng stronger restraining effect is arranged; Be incubated 50 min kept stables below 35 ℃ in temperature; Under 1/15 mol/L pH5.91, pH7.38 and pH8.04 damping fluid, handle 80 min, keep the activity more than 40%, 90% and 45% respectively; Simultaneously also can hydrolysis β-naphthyl acetate; Can be applicable to pesticide residue or pesticidal contamination improvement aspect.
Description of drawings
Fig. 1: the SDS-PAGE at the reorganization Procaine esterase D-1CarE5 of expression in escherichia coli analyzes, wherein, and M: low molecular weight protein Marker; 1: the reorganization Procaine esterase D-1CarE5 of purifying.
Fig. 2: the optimum temperuture of reorganization Procaine esterase D-1CarE5.
Fig. 3: the thermostability of reorganization Procaine esterase D-1CarE5.
Fig. 4: the optimal pH of reorganization Procaine esterase D-1CarE5.
Fig. 5: the pH stability of reorganization Procaine esterase D-1CarE5.
Fig. 6: different metal ion and chemical reagent are to the influence of reorganization Procaine esterase D-1CarE5 activity.
Fig. 7: reorganization Procaine esterase D-1CarE5 1/[S] with the relation of 1/V.
Embodiment
Experiment material and reagent
1, bacterial strain and carrier: thermophilic alicyclic acid genus bacillus (thermophilic AlicyclobacillusTengchongensisstrain CGMCC1504) is the laboratory screening bacterial strain; Intestinal bacteria Escherichia coliBL21(DE3) and expression vector pET-28a(+) can purchase the company in Novagen.
2, enzyme and other biochemical reagents: restriction enzyme, archaeal dna polymerase and dNTP are available from TaKaRa company; The T4 ligase enzyme is available from Promega company; Firm blue B is available from Sigma company; Other reagent is all available from traditional Chinese medicines group.
3, substratum:
LB substratum: peptone 1%, yeast powder 0.5%, sodium-chlor 1%, pH nature (being about 7.0).Solid medium adds 2.0%(w/v on this basis) agar.
Illustrate: make the experimental methods of molecular biology specify in following examples, all carry out with reference to listed concrete grammar in " molecular cloning experiment guide " (third edition) J. Sa nurse Brooker one book, perhaps carry out according to test kit and product description.
Embodiment 1: the Procaine esterase gene D-1CarE5The clone
Thermophilic alicyclic acid genus bacillus D-1 genomic dna: the CTAB cracking process, concrete steps are: with the fresh bacterium liquid centrifuging and taking thalline of liquid culture 12 h, add 800 μ L solution I (20 mM Tris, pH8.0,2 mM Na 2-EDTA, final concentration 20 mg/mL N,O-Diacetylmuramidases), 37 ℃ of insulation 30 min, add 100 μ L, the 10% SDS mixing that turns upside down, the Proteinase K that adds 10 μ L, 10 mg/mL again, 37 ℃ of insulation 30 min, add 150 μ L, 5 M NaCl and 150 μ L, the 10% CTAB solution mixing that turns upside down, 65 ℃ of insulation 20 min, add isopyknic phenol/chloroform/Virahol (volume ratio 25:24:1) and carry out extracting, at 4 ℃ of following centrifugal 10 min of 12000 rpm, get supernatant extrct foreigh protein removing again in chloroform/Virahol (volume ratio 24:1), 4 ℃ of centrifugal 10 min of 12000 rpm down, get supernatant again and add the pH5.2 3M NaAc of 2 times of volume dehydrated alcohols and 1/10 volume,-70 ℃ of precipitation 1h, 4 ℃ of following centrifugal 20 min of 13500 rpm abandon supernatant, use 70% washing with alcohol again twice, vacuum-drying adds an amount of TE dissolving, place-20 ℃ standby.
Analyze the Procaine esterase gene according to thermophilic alicyclic acid genus bacillus D-1 genome sequencing and gene annotation D-1CarE5And primer CarF and CarR are expressed in design:
Upstream primer CarF:5 ' CGC GGATCC(the line part is ATGCAAAGCATGCTGCGG 3 ' BamH I restriction enzyme site)
Downstream primer CarR:5 ' CCG CTCGAG(the line part is GAAAATGTACTGTTTTTGCTTAAAG 3 ' XhoThe I restriction enzyme site)
Upstream primer T7:5 ' TAATACGACTCACTATAGGG 3 '
Downstream primer T7ter:5 ' TGCTAGTTATTGCTCAGCGG 3 ' detects the sub-primer of positive colony for PCR.
Be that template is carried out pcr amplification with thermophilic alicyclic acid subtilis genomic dna.The PCR reaction parameter is: 94 ℃ of pre-sex change 5 min; 94 ℃ of sex change 30 sec then; 52 ℃ of annealing 30 sec; 72 ℃ are extended 1 min30 sec; 30 back 72 ℃ of insulation 5 min of circulation.PCR purified product warp BamThe H I and XhoThe I double digestion reclaims the purpose fragment, cuts the expression vector pET-28a (+) that handled with the same enzyme of process again and is connected structure plasmid pET -D-1CarE5, 4 ℃ are spent the night.Get 10 μ l and connect product pET -D-1CarE5Be transformed into 100 μ l Escherichia coliIn BL21 (DE3) competent cell, coat on the LB solid plate that contains Kan, 37 ℃ of incubators are cultivated 13 h, the single bacterium colony of several strains of picking on the reformer plate, (T7 T7ter) carries out colony PCR amplification screening positive clone, thereby obtains recombinant escherichia coli strain to use primer BL21 (DE3)/D-1CarE5
Embodiment 2: the preparation of Procaine esterase D-1CarE5 [a3]
Get and contain recombinant plasmid pET -D-1CarE5 Escherichia coliBL21 (DE3) bacterial strain and only contain pET -The empty plasmid of 28a (+) Escherichia coliBL21 (DE3) bacterial strain, the inoculum size with 0.1% are inoculated in LB(and contain 50 μ g/mL Kan) in the nutrient solution, 37 ℃ of quick oscillation 16 h.Then the bacterium liquid of this activation being inoculated into fresh LB(with 1% inoculum size and containing 50 μ g/mL Kan) in the nutrient solution, quick oscillation is cultivated about 2 –, 3 h(OD 600Reach 0.6 – 1.0) after, the IPTG that adds final concentration 0.7 mM induces, and continues about 20 h of shaking culture or 26 ℃ of about 8 h of shaking culture in 20 ℃.Centrifugal 5 min of 12000 rpm collect thalline.Behind an amount of pH7.0 Tris-HCl damping fluid suspension thalline, ultrasonic disruption thalline under the low temperature water-bath., behind centrifugal 10 min of 13,000 rpm, draw supernatant and use Nickel-NTA Agarose purifying target protein with crude enzyme liquid concentrated in the upper eye lid.SDS-PAGE result (Fig. 1) shows that the reorganization Procaine esterase has obtained expression in intestinal bacteria, be single band behind Nickel-NTA Agarose purifying.
The property testing of the reorganization Procaine esterase D-1CarE5 of [a4] purifying
1, the activation analysis of reorganization Procaine esterase D-1CarE5
2[a5] activity determination method of reorganization Procaine esterase D-1CarE5 of purifying adopts the naphthyl alcohol method: get three 10 ml test tubes, number respectively 1,2,3, No. 1 and No. 2 test tubes are experimental group, No. 3 is control group.Add 2.5 ml 1/15mol/L pH respectively in No. 1 and No. 2 test tubes and be Sodium phosphate dibasic-potassium phosphate buffer of 7.0, add 3 ml 1/15mol/L pH in No. 3 test tubes and be Sodium phosphate dibasic-potassium phosphate buffer of 7.0.In three test tubes, add 30 μ l substrate α-Yi Suannaizhi alcoholic solutions, place 37 ℃ of water-bath preheating 5 min, in No. 1 and No. 2 test tubes, add the suitably enzyme liquid of dilution of 0.5 ml then, after reacting 5 min, three test tubes are taken out, and every test tube adds 0.5 ml developer (2:5 mixes before 1% firm blue B salt brine solution and the 5% SDS use) solution under condition of ice bath, after fully shaking up, after leaving standstill 5 min-10 min, under spectrophotometer 595 nm, measure its absorbance.1 enzyme unit alive (U/mL) is defined as under the certain condition, and per minute decomposes the substrate α-Yi Suannaizhi and generates the needed enzyme amount of 1 μ moL naphthyl alcohol.Be that substrate measuring method and enzyme activity calculate same α-Yi Suannaizhi with β-naphthyl acetate.
2, the optimum temperuture of reorganization Procaine esterase D-1CarE5 and the mensuration of thermostability:
The mensuration of the optimum temperuture of enzyme: Procaine esterase D-1CarE5 under Sodium phosphate dibasic-potassium phosphate buffer condition of 1/15 mol/L pH7.0, is carried out enzymatic reaction respectively under 20 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 60 ℃.The mensuration of temperature stability: with Procaine esterase D-1CarE5 under Sodium phosphate dibasic-potassium phosphate buffer condition of 1/15 mol/L pH7.0, carry out enzymatic reaction after under 20 ℃, 35 ℃ and 45 ℃ of three temperature, being incubated 10 min, 20 min, 30 min, 40 min and 50 min respectively, with untreated enzyme liquid in contrast.Be substrate with the α-Yi Suannaizhi, react 5 min, measure the zymologic property of purification of carboxylic acids esterase D-1CarE5.The result shows: 40 ℃ of the optimum temperutures of D-1CarE5 (Fig. 2); The 50 min kept stables (Fig. 3) of insulation below 35 ℃.
3, the optimal pH of reorganization Procaine esterase D-1CarE5 and the mensuration of pH stability:
The mensuration of the optimal pH of enzyme: with Procaine esterase D-1CarE5 40 ℃ of optimum temperutures, enzymatic reaction under the different pH4.92,5.91,6.47,6.98,7.38 of 1/15 mol/L Sodium phosphate dibasic-potassium phosphate buffer, 8.04 and 8.67 conditions respectively.The mensuration of pH stability: Procaine esterase D-1CarE5 40 ℃ of optimum temperutures, is carried out enzymatic reaction after tolerating 20 min, 40 min, 60 min and 80 min under pH5.91, pH7.38 and the pH8.04 respectively, with untreated enzyme liquid in contrast.Be substrate with the α-Yi Suannaizhi, react 5 min, measure the zymologic property of purification of carboxylic acids esterase D-1CarE5.The result shows: optimal pH 7.38(Fig. 4 of D-1CarE5); Under 1/15 mol/L pH5.91, pH7.38 and pH8.04 damping fluid, handle 80 min, keep the activity (Fig. 5) more than 40%, 90% and 45% respectively.
4, different metal ion and chemical reagent are to the influence of reorganization Procaine esterase D-1CarE5 activity:
In enzymatic reaction system, add metal ion and the chemical reagent of final concentration 1 mM, study it to the influence of enzymic activity.Be substrate with the α-Yi Suannaizhi, under 40 ℃, pH7.38 condition, react 5 min, measure the enzyme activity of purification of carboxylic acids esterase D-1CarE5.Result (Fig. 6) shows, the metal ions M n of final concentration 1 mM 2+And Zn 2+Enzyme there is activation, Cu 2+, Ag +, Hg 2+And Pb +Deng stronger restraining effect is arranged.
5, the mensuration of the kinetic parameter of reorganization Procaine esterase D-1CarE5:
Under 40 ℃, pH7.38 condition, be substrate with 0.6 M α-Yi Suannaizhi, termination reaction and measure enzymic activity in the 1-30 of enzymatic reaction min calculates the ratio in enzymic activity and reaction times successively, if this ratio keeps stable within a certain period of time, then this time is the first order reaction time.Be substrate ([S]) with 0.005-0.5 M α-Yi Suannaizhi, measure enzyme under the time in 40 ℃, pH7.38 and first order reaction and live, calculate corresponding speed of response (ν), as Fig. 7, measure according to the Lineweaver-Burk method KmWith VmaxAfter measured, under 40 ℃, pH7.38 condition, the α-Yi Suannaizhi of reorganization Procaine esterase D-1CarE5 KmWith VmaxBe respectively 0.948 mol and 534.12U/mg.
6, the hydrolysis of the substrate β-naphthyl acetate of reorganization Procaine esterase D-1CarE5:
Under 60 ℃, pH7.0 condition, reorganization Procaine esterase D-1CarE5 is 14.78 ± 0.01 U/mg to the ratio vigor of 0.6 mol/L β-naphthyl acetate.
Sequence table
 
SEQ?ID?NO.1：
MQSMLRVVKVENGFVRGLPAADPRITSFKGIPFAAPPVGENRWRAPQPAKDWDGVFDAYTFAPISMQSPIHHNESNIYGREWHVDPDTPMSEDCLYLNIWTPAHSPDEKLPVFVWYFGGGLQVGYTSEMEFDGERLARRGIVVVTVNYPLNVFGFLCHPEITAEAPEAPANFGHLDQQFATQWVKRNIAAFGGDPENITIGGQSAGGGSVLSQLTSPQNEGLVQRAIIQSGLFGRVYPGGRMPGYGRTLAEAEADGMQFFAFLGVSSLAEARQLDAFYIRDKALDYKGFWGTVVDDVFCMGDGFDLFVEGKHLQVSVLFGHTSDEFYSAPNVKDLDELKQMAVERFGDDAATYLALCEADAHDFEDVLKKATLHSLEFAIRTAVQASSNWKTQEPLYYYVFDAEIPGWDQPGAFHSVDLWFFFETLAKCWRPFVGKHYDLARQMCDYWANFIRSGDPNGKDMTGEDLPPWYPCTPDAPYAMVFDDEPKFVRQEPSPLMQFFVQEYFKQKQYIF
 
SEQ?ID?NO.2：
ATGCAAAGCATGCTGCGGGTCGTGAAGGTCGAGAACGGTTTCGTTCGGGGGCTCCCAGCAGCCGACCCTCGCATTACAAGCTTTAAGGGCATTCCCTTTGCAGCTCCGCCAGTCGGCGAAAATCGCTGGCGAGCTCCCCAGCCCGCAAAGGACTGGGACGGCGTATTCGACGCTTATACATTCGCACCGATTTCCATGCAATCACCCATACACCACAACGAAAGCAACATCTATGGTCGAGAGTGGCATGTCGATCCGGATACTCCCATGAGTGAGGATTGTCTCTATCTCAACATCTGGACGCCGGCACACAGCCCTGACGAAAAGCTTCCCGTGTTTGTTTGGTATTTCGGTGGCGGATTGCAGGTCGGTTACACATCTGAAATGGAGTTTGACGGCGAACGCCTCGCGCGCCGAGGAATCGTCGTGGTTACCGTCAACTATCCCCTCAACGTGTTTGGTTTTTTGTGTCATCCGGAGATTACCGCAGAAGCCCCCGAAGCTCCGGCTAATTTTGGACATCTCGATCAACAGTTTGCGACACAATGGGTCAAGCGCAATATCGCTGCATTCGGCGGCGATCCGGAGAACATCACGATTGGTGGCCAATCCGCTGGCGGTGGAAGTGTATTAAGCCAACTCACATCTCCCCAGAACGAAGGGCTCGTACAAAGGGCAATTATCCAAAGTGGACTGTTTGGCAGAGTTTATCCCGGCGGTCGTATGCCAGGTTATGGGAGAACACTGGCGGAAGCTGAAGCGGACGGAATGCAATTCTTTGCGTTTCTTGGCGTATCCTCCTTGGCCGAAGCCCGCCAGCTCGACGCTTTTTACATCCGTGACAAAGCGCTCGACTATAAGGGCTTCTGGGGGACTGTCGTGGATGACGTATTCTGCATGGGTGACGGATTTGATCTCTTTGTCGAGGGTAAACATTTACAGGTCTCCGTGCTTTTTGGTCACACGTCTGACGAATTTTACAGCGCCCCAAACGTCAAAGATTTAGATGAATTGAAGCAAATGGCCGTCGAACGTTTTGGTGATGATGCCGCAACATATCTTGCGCTTTGCGAAGCGGATGCACATGATTTCGAAGACGTTCTGAAAAAAGCCACACTCCATTCCTTGGAGTTTGCCATTCGCACCGCCGTGCAAGCCAGTAGCAACTGGAAGACGCAAGAACCATTGTACTATTACGTATTCGATGCAGAAATTCCGGGGTGGGATCAGCCAGGGGCCTTTCATTCGGTTGATCTGTGGTTTTTCTTCGAGACTCTGGCTAAGTGTTGGCGGCCGTTTGTCGGAAAACATTACGACTTGGCTCGCCAAATGTGCGATTACTGGGCCAACTTCATCCGTTCTGGAGATCCAAATGGGAAAGATATGACGGGTGAAGATTTGCCACCCTGGTATCCCTGCACACCCGATGCGCCATACGCCATGGTATTCGATGACGAGCCCAAATTTGTCCGACAAGAACCAAGTCCTCTTATGCAGTTCTTCGTGCAAGAGTACTTTAAGCAAAAACAGTACATTTTCTGA

Claims (4)

1. a Procaine esterase D-1CarE5 is characterized in that its aminoacid sequence is shown in SEQ ID NO.1.
2. the Procaine esterase gene of the described Procaine esterase D-1CarE5 of the claim 1 of encoding D-1CarE5, it is characterized in that its nucleotide sequence is shown in SEQ ID NO.2.
3. one kind comprises the described Procaine esterase gene of claim 2 D-1CarE5Recombinant vectors.
4. one kind comprises the described Procaine esterase gene of claim 2 D-1CarE5Recombinant bacterial strain.
CN 201210250855 2012-07-19 2012-07-19 Carboxylesterase D-1CarE5 from thermophilic Alicyclobacillus tengchongensis strain, and gene thereof Expired - Fee Related CN102787107B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 201210250855 CN102787107B (en) 2012-07-19 2012-07-19 Carboxylesterase D-1CarE5 from thermophilic Alicyclobacillus tengchongensis strain, and gene thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 201210250855 CN102787107B (en) 2012-07-19 2012-07-19 Carboxylesterase D-1CarE5 from thermophilic Alicyclobacillus tengchongensis strain, and gene thereof

Publications (2)

Publication Number Publication Date
CN102787107A CN102787107A (en) 2012-11-21
CN102787107B true CN102787107B (en) 2013-09-04

Family

ID=47152698

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 201210250855 Expired - Fee Related CN102787107B (en) 2012-07-19 2012-07-19 Carboxylesterase D-1CarE5 from thermophilic Alicyclobacillus tengchongensis strain, and gene thereof

Country Status (1)

Country Link
CN (1) CN102787107B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105039283B (en) * 2015-08-20 2018-07-06 云南师范大学 A kind of partial neutral salt tolerance endoglucanase GluE1 and preparation method thereof
CN109852597B (en) * 2019-03-21 2022-11-18 云南师范大学 Beta-galactosidase galRBM20_1 and preparation method and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1793329A (en) * 2005-11-09 2006-06-28 云南师范大学 Prolan enzyme bacterial and preparation process
CN101603037A (en) * 2009-07-23 2009-12-16 安徽师范大学 A kind of thermostable carboxylesterase gene, proteins encoded and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1793329A (en) * 2005-11-09 2006-06-28 云南师范大学 Prolan enzyme bacterial and preparation process
CN101603037A (en) * 2009-07-23 2009-12-16 安徽师范大学 A kind of thermostable carboxylesterase gene, proteins encoded and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
carboxylesterase type B[Paenibacillus lactis 154];GenBank;《NCBI ZP_09003155.1》;20111027;全文 *
GenBank.carboxylesterase type B[Paenibacillus lactis 154].《NCBI ZP_09003155.1》.2011,全文.
柏映国.脂环酸芽孢杆菌（Alicyclobacillus sp.A4）部分糖基水解酶研究及其基因组序列初步分析.《中国博士学位论文全文数据库基础科学辑》.2010,全文. *

Also Published As

Publication number Publication date
CN102787107A (en) 2012-11-21

Similar Documents

Publication Publication Date Title
Abdel-Fattah et al. Identification and over-expression of a thermostable lipase from Geobacillus thermoleovorans Toshki in Escherichia coli
CN102965355B (en) Carboxylesterase and application thereof in degradation of pesticides malathion and carbaryl
Sharma et al. Characterization of a thermostable lipase showing loss of secondary structure at ambient temperature
CN102965361A (en) Pullulanase XWPu2 and gene thereof
CA2031286C (en) Methods for the biological inactivation of nucleic acids
CN102787107B (en) Carboxylesterase D-1CarE5 from thermophilic Alicyclobacillus tengchongensis strain, and gene thereof
Zha et al. Molecular identification of lipase LipA from Pseudomonas protegens Pf-5 and characterization of two whole-cell biocatalysts Pf-5 and Top10lipA
CN106635941B (en) A kind of thermophilic esterase and its functional verification from Aquifex aeolicus bacterial strain
CN103436506A (en) Alkaline thermal-stable esterase K91 Est8 and gene thereof
CN104894081B (en) A kind of alkalinity thermostabilization SGNH families esterase EstD1 and its gene
Zhan et al. Complete genome sequence of Echinicola rosea JL3085, a xylan and pectin decomposer
CN102965356B (en) Preparation method and application of recombinant carboxylesterase D-1CarE5
CN111378583B (en) Trichoderma reesei and application thereof
Widhiastuty et al. Cloning, homological analysis and expression of Lipase gene from hot spring isolate
CN106434512B (en) A kind of thermophilic esterase and its expression from Aquifex aeolicus bacterial strain
Chao et al. Molecular cloning of the carboxylesterase gene and biochemical characterization of the encoded protein from Pseudomonas citronellolis ATCC 13674
CN112522125A (en) Hyaluronidase engineering bacterium and construction method and application thereof
CN108251447B (en) Plasmid capable of efficiently expressing lipase, construction method and application thereof
AU2021100409A4 (en) Recombinant low-temperature catalase, recombinant vector and engineered strain thereof
Amara et al. Non-mucoid P. aeruginosa aiming to a safe production of protease and lipase
Masri et al. Novel chitinolytic bacteria from the shrimp shell processing waste
Shaini et al. Optimization of Staphylococcus saprophyticus lipase isolated from windrow compost
CN112410318B (en) Novel phospholipase A2Gene, preparation method and application thereof
CN112522233B (en) Aspergillus oryzae phospholipase C and encoding gene and application thereof
CN110938554B (en) Aspergillus niger mutant strain capable of stably producing lipase at high yield

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20130904

Termination date: 20180719

CF01 Termination of patent right due to non-payment of annual fee