CN102955036B - Nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL and preparation method thereof - Google Patents
Nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL and preparation method thereof Download PDFInfo
- Publication number
- CN102955036B CN102955036B CN201210489700.2A CN201210489700A CN102955036B CN 102955036 B CN102955036 B CN 102955036B CN 201210489700 A CN201210489700 A CN 201210489700A CN 102955036 B CN102955036 B CN 102955036B
- Authority
- CN
- China
- Prior art keywords
- antibody
- ngal
- nano material
- pad
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL, comprise the sample pad, nano material pad, nitrocellulose filter and the absorption pad that are located at and fixed head is connected successively, nitrocellulose filter is provided with detection line antibody and nature controlling line antibody, nano material pad is provided with golden contracted payment nm of gold shell compound.The invention also discloses the preparation method of the nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL, the present invention is applied to and detects human blood and/or urine NGAL, early diagnosis acute and chronic injury of kidney specificity is high, better resolved light signal can produced than spherical gold nano grain based under white background, the speed of its immunochromatography is accelerated, be conducive to the quick detection of test paper, strengthen detection signal and reach 1000 times.Result is easily observed, and sensitivity reaches 10pg/mL, with regard to energy sentence read result in 15 minutes, has good stability and repeatability.
Description
Technical field
The present invention relates to biological technology application, specifically a kind of nano material test strip and preparation method thereof.
Background technology
NGAL(NeutrophiLGeLatinaseAssociatedLipocaLin) molecular weight 22KD, also have report 25KD, be mainly present in neutral class cell, in its hetero-organization, storage is little.A variety of causes (wound, poisoning, infect, disease) when causing acute and Chronic Renal Impairment, renal tissue NGAL measures obviously to raise and is released into blood.Detecting blood and/or urinate NGAL and judge and assess acute and biomarker that is Chronic Renal Impairment, is the index of kidney substantial structure damage.Goldstandard cardiac muscle troponin I, the T of similar diagnosing acute myocardial infarction damage.Current clinical diagnosis is acute mainly detects serum creatinine (creatine), urea nitrogen, urine micro protein with Chronic Renal Impairment (insufficiency), is the indirect functional parameter of injury of kidney.After acute injury of kidney, within 2-3 days, serum creatinine side occurs.NGAL just obviously raised at blood with in urinating after acute injury of kidney 2-3 hour, detected the time that NGAL shifts to an earlier date and greatly improves the ability diagnosing kidney substantial damage, to reasonable diagnosis and treatment, reduced mortality ratio and provided objective basis.
In United States Hospital inpatient, acute injury of kidney renal dysfunction patient accounts for total 5-7%, and in hospital intensive ward (IC Μ) patient, ratio is up to 25%, and mortality ratio is up to 50-80%.Acute and Chronic Renal Impairment relates to openheart surgery, chemotherapy and radiation, severe hypertension, diabetes, septicemia, heart failure and all kinds Cardiorenal syndrome.23 in masschusetts, u.s.a hospital's acute injury of kidney (AKI) year cost conservative estimations 8,000,000,000 dollars of such disease.Therefore, apply the application's patent and detect NGAL by Social and economic benefhuge for performance.
Summary of the invention
For the deficiency that prior art exists, first technical matters that the present invention will solve is to provide the nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL, be specifically designed to the NGAL detected in human urine or blood, it has easy and simple to handle, highly sensitive, detects the 0.01-0.1ng/mL advantages such as comparatively classic method susceptibility improves 1000 times, result is stable.Another technical matters that the present invention solves is to provide the preparation method of the nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL.
For achieving the above object, the technical solution used in the present invention is the nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL, comprise the sample pad, nano material pad, nitrocellulose filter and the absorption pad that are located at and fixed head is connected successively, nitrocellulose filter is provided with detection line antibody and nature controlling line antibody, nano material pad is provided with golden contracted payment nm of gold shell compound.
Preferably, wherein golden contracted payment nm of gold shell compound is the compound be connected by 40-60nm, 10-20nm nm of gold contracted payment shell label by specific single stranded DNA.
Preferably, wherein the nucleotide sequence of specific single stranded DNA as SEQIDNO:1 or SEQIDNO:2 or SEQIDNO:3 or SEQIDNO:4.
Preferably, wherein include colour developing antibody mouse-anti human neutrophil genatinase associated lipocalin antibody BOT05 in golden contracted payment nm of gold shell compound, include anti-human NGAL monoclonal antibody in detection line antibody also referred to as seizure antibody BOT06, described nature controlling line antibody is sheep anti-mouse igg.
Preferably, wherein specific single stranded DNA length is 30-80bp, and specific single stranded DNA 3 ' end indicates biotin, and specific single stranded DNA 5 ' end is connected with sulfydryl (-SH).
Preferably, the antibody that wherein develops the color is that two strains can be matched mutually and formed sandwich anti-human NGAL monoclonal antibody with catching antibody.
Preferably, described nano material pad is the pad that dacron film is made.
Preferably, wherein sample pad is the pad that glass fibre membrane is made.
Another technical scheme of the present invention is the preparation method of the nano material test strip of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL, comprises the following steps:
(1) preparation of nm of gold shell solution;
(2) golden shell mark is prepared and confirms that golden contracted payment shell nanometer material (40-60nm and 10-20nm) size and purity are determined;
(3) preparation of golden contracted payment nm of gold shell compound, by the compound that signal antibody BOT05 and 10-20nm and 40-60nm gold contracted payment shell label is connected;
PH8.5-9.0 is regulated with 0.1MK2CO3; NGAL signal monoclonal antibody BOT05 is adjusted to 4:100(μ g/ml with nanoshell than row)+single stranded DNA 3' held the 30-80bpSSDNA and nanoshell signal antibody valency chain coupled reaction 6-8 hour that indicate biotin, 25 DEG C, its final concentration is 0.5-2.0 μM;
SSDNA and nanoshell signal antibody compound being added PEG8000 final concentration is that 0.2-1.0%, 2MNaCl/20mMphosphate regulate SSDNA nanoshell complex PH to 7.4;
Above-mentioned PH7.4 complex and streptavidin, horseradish peroxidase (final concentration 0.4 μM), under 25 DEG C of conditions, are hatched 4 hours, centrifugal, precipitation cleaning 3 times, preserve 4 DEG C for subsequent use;
(4) golden shell nanometer material pad preparation;
(5) nitrocellulose filter pre-service and for subsequent use;
(6) prepare and assemble golden shell nanometer material pad;
(7) detection line preparation;
(8) nature controlling line preparation;
(9) test strips assembling;
(10) detect.
Wherein, single stranded DNA length is 43bp in step (3), and described SSDNA and nanoshell signal antibody compound are added PEG8000 final concentration is 0.5.
Beneficial effect: the present invention uses the gold nanoshell of sizes hollow to replace the spherical nanoparticle that current colloidal gold strip is conventional.Be applied to human blood and/or urine NGAL detection, specificity is high, can produce better resolved light signal based under white background than spherical gold nano grain.And being lighter than onesize solid nanogold particle due to the weight of hollow gold shell, the speed of its immunochromatography is accelerated, and is conducive to the quick detection of test paper.Nano particle and DNA and protein covalent bond binding mechanism under application specified conditions, biotin labeled single stranded DNA connects the nano antibody of two kinds of sizes, and enhancing detection signal reaches 1000 times.Result is easily observed, and sensitivity reaches 10pg/mL, with regard to energy sentence read result in 15 minutes, has good stability and repeatability.Easy and simple to handle, without the need to special instruments and equipment, can be applicable to the early diagnosis of the acute injury of kidney that a variety of causes causes, chronic renal insufficiency dialysis and result for the treatment of are passed judgment on.Especially be suitable in vast basic hospital promotion and application.
Accompanying drawing explanation
Fig. 1 is the one-piece construction schematic diagram of preferred embodiment;
1, sample pad 2, nano material pad: functionalization 10nm gold shell, signal antibody BOT05, functionalization 50nm signal antibody BOT053, nitrocellulose filter 4, absorption pad 5, detection line antibody 6, nature controlling line antibody
Embodiment
Below in conjunction with the drawings and specific embodiments, illustrate the present invention further, the present embodiment is implemented under premised on technical solution of the present invention, should understand these embodiments and only be not used in for illustration of the present invention and limit the scope of the invention.
The material that this experiment is used:
Detection line antibody is anti-human NGAL monoclonal antibody BOT06 is seizure antibody, and nature controlling line antibody is sheep anti-mouse igg, and it is mouse-anti human neutrophil genatinase associated lipocalin antibody BOT05 that golden shell labelled antibody includes colour developing antibody, buys in GenscriptTheBiologyCRO Nanjing company.
Specific single stranded DNA used by gold contracted payment nm of gold shell compound is obtained by our company's design and synthesis.
Other materials is all bought on market.
Embodiment 1
As shown in Figure 1, the nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL, comprise the sample pad 1, nano material pad 2, nitrocellulose filter 3 and the absorption pad 4 that are located at and fixed head is connected successively, nitrocellulose filter 3 is provided with detection line antibody 5 and nature controlling line antibody 6, nano material pad 2 is provided with golden contracted payment nm of gold shell compound.Wherein, golden contracted payment nm of gold shell compound is the compound be connected by 40-60nm and 10-20nm nm of gold contracted payment shell label by specific single stranded DNA.Wherein, the nucleotide sequence of specific single stranded DNA is as SEQIDNO:1 or SEQIDNO:2 or SEQIDNO:3 or SEQIDNO:4.Wherein, golden contracted payment nm of gold shell compound is the compound be connected by 50nm and 10nm nm of gold contracted payment shell label by specific single stranded DNA.Wherein include colour developing antibody mouse-anti human neutrophil genatinase associated lipocalin antibody BT05 in golden contracted payment nm of gold shell compound, include anti-human NGAL monoclonal antibody in detection line antibody also referred to as seizure antibody BT06, described nature controlling line antibody is sheep anti-mouse igg.Described specific single stranded DNA length is 30-80bp, and specific single stranded DNA 3' end indicates biotin, and specific single stranded DNA 5 ' end is connected with sulfydryl (-SH).
Colour developing antibody is that two strains can be matched mutually and formed sandwich anti-human NGAL monoclonal antibody with catching antibody.Described nano material pad is the pad that dacron film is made.Described sample pad is the pad that glass fibre membrane is made.
Embodiment 2
(1) preparation of nm of gold shell solution:
With sodium citrate and tannic acid for bistable agent and reductive agent, prepare monodispersed, the torispherical silver nano-grain solution of size adjustable.Under the water-bath of 50-70 DEG C, by the 1%(AgNO of 1.5-2.0ml
3solution joins in 50-70ml deionized water, and is heated to constant temperature.This solution system is designated as A; Under the water-bath of 50-70 DEG C, joined in the deionized water of 20-40ml by the sodium citrate solution of the tan-ooze of 0.5% of 0.05-5.0ml and 1% of 1-3ml, and be heated to constant temperature, this solution is designated as B.With vigorous stirring, imported in A by B, and Keep agitation presents glassy yellow to solution, after this reaction solution is heated to boiling, and keep backflow, continue 10-30 minute, after room temperature cooling, constant volume is to 100ml.
With monodispersed silver nano-grain for sacrificing masterplate, prepared by displacement reaction but the gold nanoshell solution disperseed: get 20-40ml silver nano-grain solution, at 12000-15000g, centrifugal 15-30 minute at 4 DEG C, sucking-off supernatant, more again disperse with deionized water, and constant volume is to 100ml.The silver nano-grain solution of this 100ml is heated to boiling rapidly, under maintenance backflow and vigorous stirring, adds 2mMHAuCl
4(or NaAuCl
4/ KAuCl
4) 1-4ml, reactant liquor color is changed into blackish green gradually by yellow, the room temperature cooling when continuing to stir afterwards.
(2) the gold mark of colour developing antibody:
Use 0.05-0.20MK
2cO
3nm of gold shell solution is regulated to be 7.4-9.0 to pH.In 80-120ml nm of gold shell solution, dropwise add colour developing antibody (mouse-anti human neutrophil genatinase associated lipocalin antibody BOT05) 2.0-4.0mg, stir 3-10 minute), leave standstill 20-60 minute.Add 15-35ml again, close for 2-10%BSA and 20mMTris-HClpH7.5-9.0,2-8 DEG C and spend the night, obtain reactant liquor; Reactant liquor is in 2-8 DEG C, 3000-5000g, and centrifugal 20-40 minute, precipitation 100-150ml, 0.5-2%BSA and 20mMTris-HClpH8.0-9.0 are resuspended, repeated centrifugation twice, and centrifugal speed is followed successively by 4000-2000g and 3000-1000g and must precipitates.By 1000-1500 μ l re-suspension liquid, (composition is 20-40% trehalose, 0.5-2.0%BSA, 0.005-0.02%Tween-20,0.01-0.03%NaN
3, 10-30mMTris-HCl, pH8.0-9.0) and suspend precipitation, obtains golden labeling antibody;
(3) preparation of nano material pad and spray pad:
Film treating fluid is prepared: 0.15-0.35%TritonX-100,0.10-0.20mMNaCl, 0.01-0.1mM) TrispH7.5; Dacron film soaks (1-2h) in film treating fluid, vacuum drying; With 1.5-3.0 μ l/cm, by golden labeling antibody spray printing on nano material pad;
(4) detection line preparation:
Get 1 strain anti-human NGAL monoclonal antibody BOT06(can with mouse-anti human neutrophil genatinase associated lipocalin antibody BOT05 match formed sandwich) do detection line antibody, with damping fluid 5-20% trehalose, 3-8% methanol dilution is 0.5-2.0mg/mL; Draw with drawing film instrument on nitrocellulose filter by antibody, concentration is that 1 μ l/cm forms detection line, vacuum drying;
(5) nature controlling line preparation:
Sheep anti-mouse igg damping fluid 5-20% trehalose, 3-8% methanol dilution is 0.2-1.0mg/ml; Draw with drawing film instrument on nitrocellulose filter by antibody, concentration is that 0.5 μ l/cm forms nature controlling line, vacuum drying;
(6) test strips assembling:
Sample pad 1, nano material pad 2, nitrocellulose filter 3 and thieving paper 4 are pasted onto on the plastic plate of one side pressure sensitive adhesive in order, nitrocellulose filter 3 is provided with detection line antibody 5 and nature controlling line antibody 6; Plastic plate after cutting stickup, loads test card; Pack with the heat-sealing Fresco Bag with drying agent, room temperature preservation;
(7) detect:
Sample drop is added well, and observe during 10-20 minute, the standard of interpretation ELISA test strip result is: positive, all there is colour developing band at detection line place and nature controlling line place; Feminine gender, detection line place is without colour developing band, and there is colour developing band at nature controlling line place; Test strips lost efficacy, and nature controlling line place is without colour developing band.
Embodiment 3
(1) preparation of nm of gold shell solution:
With sodium citrate and tannic acid for bistable agent and reductive agent, prepare monodispersed, the torispherical silver nano-grain solution of size adjustable.Under the water-bath of 50-70 DEG C, by the 1%(AgNO of 1.5-2.0ml
3solution joins in 50-70ml deionized water, and is heated to constant temperature.This solution system is designated as A; Under the water-bath of 50-70 DEG C, joined in the deionized water of 20-40ml by the sodium citrate solution of the tan-ooze of 0.5% of 0.05-5.0ml and 1% of 1-3ml, and be heated to constant temperature, this solution is designated as B.With vigorous stirring, imported in A by B, and Keep agitation presents glassy yellow to solution, after this reaction solution is heated to boiling, and keep backflow, continue 10-30 minute, after room temperature cooling, constant volume is to 100ml.
With monodispersed silver nano-grain for sacrificing masterplate, prepared by displacement reaction but the gold nanoshell solution disperseed: get 20-40mL silver nano-grain solution, at 12000-15000g, centrifugal 15-30 minute at 4 DEG C, sucking-off supernatant, more again disperse with deionized water, and constant volume is to 100ml.The silver nano-grain solution of this 100ml is heated to boiling rapidly, under maintenance backflow and vigorous stirring, adds 2mMHAuCl
4(or NaAuCl
4/ KAuCl
4) 1-4ml, reactant liquor color is changed into blackish green gradually by yellow, the room temperature cooling when continuing to stir afterwards.
(2) the gold mark of colour developing antibody:
Use 0.05-0.20MK
2cO
3nm of gold shell solution is regulated to be 7.4-9.0 to pH.In 80-120ml nm of gold shell solution, dropwise add colour developing antibody (mouse-anti human neutrophil genatinase associated lipocalin antibody BOT05) 2.0-4.0mg, stir 3-10 minute, leave standstill 20-60 minute.Add 15-35ml again, close for 2-10%BSA and 20mMTris-HClpH7.5-9.0,2-8 DEG C and spend the night, obtain reactant liquor; Reactant liquor is in 2-8 DEG C, 3000-5000g, and centrifugal 20-40 minute, precipitation 100-150ml, 0.5-2%BSA and 20mMTris-HCLpH8.0-9.0 are resuspended, repeated centrifugation twice, and centrifugal speed is followed successively by 4000-2000g and 3000-1000g and must precipitates.By 1000-1500 μ l re-suspension liquid, (composition is 20-40% trehalose, 0.5-2.0%BSA, 0.005-0.02%Tween-20,0.01-0.03%NaN
3, 10-30mMTris-HCl, pH8.0-9.0) and suspend precipitation, obtains golden labeling antibody;
(3) preparation of signal antibody BOT05 and 5-15nm and 40-60nm gold contracted payment nm of gold shell compound:
Use 0.1MK
2cO
3regulate PH8.5-9.0;
NGAL signal monoclonal antibody BOT05 and nanoshell are adjusted to as 4:100(μ g/mL than row);
Single stranded DNA 3' end is indicated (43BP(30-80BP) of biotin) SSDNA and nanoshell gold labeling antibody valency chain coupled reaction 6-8 hour, 25 DEG C, its final concentration is 0.5-2.0 μM.
It is that 0.5% (0.2-1.0%), 2MNaCl/20mMphosphate regulate SSDNA nanoshell complex PH to 7.4 that SSDNA and nanoshell gold labeling antibody compound are added PEG8000 final concentration.
Above-mentioned PH7.4 complex and streptavidin, horseradish peroxidase (final concentration 0.4 μM), under 25 DEG C of conditions, are hatched 4 hours, centrifugal, precipitation cleaning 3 times, preserve 4 DEG C for subsequent use.
The composition of cleaning and conserving liquid punching and PH:PH7.4,0.1%BSA, 0.1%Tween20,10mMphosphatesodium.
(4) golden shell nanometer material pad preparation
Nano material signal antibody compound is shown in (3);
Glass film pre-service and for subsequent use:
Borate buffer: PH7.4,10mM boric acid, 0.5% sucrose, 1%BSA, 0.5Tween20,0.05% Sodium azide glass film (poLyecterfiter) are soaked in borate buffer 2 hours, change twice damping fluid therebetween, dry 2 hours at 50 DEG C.
Glass film is combined with functionalization signal antibody: pretreated glass film to be soaked in 0.05% sucrose Sodium azide liquid 1 hour, dries 2 hours for 50 DEG C.
Gold contracted payment shell antibody BOT05 is added on glass film: functionalization BOT05 mark connects the BOT05 of Avidin-horseradish peroxidase, drips profit glass film, and 37 DEG C of dryings 30 minutes, kept dry is for subsequent use.
(5) nitrocellulose filter pre-service and for subsequent use
PBS buffer solution ph 7.4,10mMPBS, 3%BSA, 0.5%Tween20;
Nitrocellulose filter is soaked in PBS damping fluid 4 hours, and 50 DEG C of dryings 2 hours are for subsequent use.
(6) prepare and assemble golden shell nanometer material
Assembling composition: sample pad, nano material pad, functionalization 10nm gold shell, signal antibody BOT05, functionalization 50nm signal antibody BOT05, nitrocellulose filter (catching antibody BOT06 and sheep anti-mouse igg antibody line) and absorption pad 6 kinds of compositions.
Complete film 37 DEG C of dryings after assembling, store for subsequent use.
(7) golden shell nanometer material pad preparation and spray pad:
Film treating fluid is prepared: 0.15-0.35%TritonX-100,0.10-0.20mMNaCl, 0.01-0.1mM) TrispH7.5; Dacron film soaks (1-2h) in film treating fluid, vacuum drying; With 1.5-3.0 μ l/cm, by golden labeling antibody spray printing on golden shell nanometer material pad;
(8) detection line preparation:
Get 1 strain anti-human NGAL monoclonal antibody BOT06(can with mouse-anti human neutrophil genatinase associated lipocalin antibody BOT05 match formed sandwich) do detection line antibody, with damping fluid 5-20% trehalose, 3-8% methanol dilution is 0.5-2.0mg/ml; Draw with drawing film instrument on nitrocellulose filter by antibody, concentration is that 1 μ l/cm forms detection line, vacuum drying;
(9) nature controlling line preparation:
Sheep anti-mouse igg damping fluid 5-20% trehalose, 3-8% methanol dilution is 0.2-1.0mg/ml; Draw with drawing film instrument on nitrocellulose filter by antibody, concentration is that 0.5 μ l/cm forms nature controlling line, vacuum drying;
(10) test strips assembling:
Sample pad 1, nano material pad 2, nitrocellulose filter 3 and thieving paper 4 are pasted onto on the plastic plate of one side pressure sensitive adhesive in order, nitrocellulose filter 3 is provided with detection line antibody 5 and nature controlling line antibody 6; Plastic plate after cutting stickup, loads test card; Pack with the heat-sealing Fresco Bag with drying agent, room temperature preservation;
(11) detect:
Sample drop is added well, and observe during 10-20 minute, the standard of interpretation ELISA test strip result is: positive, all there is colour developing band at detection line place and nature controlling line place; Feminine gender, detection line place is without colour developing band, and there is colour developing band at nature controlling line place; Test strips lost efficacy, and nature controlling line place is without colour developing band.
Embodiment 4
10ng/ml, 50ng/ml, 100ng/ml and 200ng/mlNGAL standard items sample drop that 100 μ L prepare is added sample well, 15min observations, and in the reference material 5min of testing result: 40ng/ml there is band in detection line position; In the reference material 10min of 20ng/ml there is band in detection line position; In the reference material 15min of 10ng/ml there is band in detection line position; In the reference material 30min of 5ng/ml there is not position in detection line.
Embodiment 5
1, golden shell nanometer material pad preparation
The preparation of signal antibody BOT05 and 10nm and 50nm gold contracted payment nm of gold shell compound:
Use 0.1MK
2cO
3regulate PH8.5-9.0;
NGAL signal monoclonal antibody BOT05 and nanoshell are adjusted to as 4:100(μ g/ml than row);
Single stranded DNA 3' end is indicated 30-80BPSSDNA and the nanoshell gold labeling antibody valency chain coupled reaction 6-8 hour of biotin, 25 DEG C, its final concentration is 0.5-2.0 μM.
It is that 0.5% (0.2-1.0%), 2MNaCl/20mMphosphate regulate SSDNA nanoshell complex PH to 7.4 that SSDNA and nanoshell gold labeling antibody compound are added PEG8000 final concentration.
Above-mentioned PH7.4 complex and streptavidin, horseradish peroxidase (final concentration 0.4 μM), under 25 DEG C of conditions, are hatched 4 hours, centrifugal, precipitation cleaning 3 times, preserve 4 DEG C for subsequent use.
The composition of cleaning and conserving liquid punching and PH:PH7.4,0.1%BSA, 0.1%Tween20,10mMphosphatesodium.
Glass film pre-service and for subsequent use
Borate buffer: PH7.4,10mM boric acid, 0.5% sucrose, 1%BSA, 0.5Tween20,0.05% Sodium azide glass film are soaked in borate buffer 2 hours, change twice damping fluid therebetween, dry 2 hours at 50 DEG C.
Glass film is combined with functionalization signal antibody: pretreated glass film to be soaked in 0.05% sucrose Sodium azide liquid 1 hour, dries 2 hours for 50 DEG C.
Gold contracted payment shell antibody BOT05 is added on glass film: functionalization BOT05 mark connects the BOT05 of Avidin-horseradish peroxidase, drips profit glass film, and 37 DEG C of dryings 30 minutes, kept dry is for subsequent use.
2, nitrocellulose filter pre-service and for subsequent use
PBS buffer solution ph 7.4,10mMPBS, 3%BSA, 0.5%Tween20;
Nitrocellulose filter is soaked in PBS damping fluid 4 hours, and 50 DEG C of dryings 2 hours are for subsequent use.
3, prepare and assemble golden shell nanometer material
Assembling composition: sample pad, nano material pad, functionalization 10nm gold shell, signal antibody BOT05, functionalization 50nm signal antibody BOT05, nitrocellulose filter (catching antibody BOT06 and sheep anti-mouse igg antibody line) and absorption pad 6 kinds of compositions.Complete film 37 DEG C of dryings after assembling, store for subsequent use.
Embodiment 6
1, golden shell nanometer material pad preparation
The preparation of signal antibody BOT05 and 20nm and 40nm gold contracted payment nm of gold shell compound:
Use 0.1MK
2cO
3regulate PH8.5-9.0; NGAL signal monoclonal antibody BOT05 and nanoshell are adjusted to as 4:100(μ g/ml than row); Single stranded DNA 3' end is indicated 30-80BPSSDNA and the nanoshell gold labeling antibody valency chain coupled reaction 6-8 hour of biotin, 25 DEG C, its final concentration is 0.5-2.0 μM.
It is that 0.5% (0.2-1.0%), 2MNaCl/20mMphosphate regulate SSDNA nanoshell complex PH to 7.4 that SSDNA and nanoshell gold labeling antibody compound are added PEG8000 final concentration.
Above-mentioned PH7.4 complex and streptavidin, horseradish peroxidase (final concentration 0.4 μM), under 25 DEG C of conditions, are hatched 4 hours, centrifugal, precipitation cleaning 3 times, preserve 4 DEG C for subsequent use.
The composition of cleaning and conserving liquid punching and PH:PH7.4,0.1%BSA, 0.1%Tween20,10mMphosphatesodium.
Glass film pre-service and for subsequent use
Borate buffer: PH7.4,10mM boric acid, 0.5% sucrose, 1%BSA, 0.5Tween20,0.05% Sodium azide glass film are soaked in borate buffer 2 hours, change twice damping fluid therebetween, dry 2 hours at 50 DEG C.
Glass film is combined with functionalization signal antibody: pretreated glass film to be soaked in 0.05% sucrose Sodium azide liquid 1 hour, dries 2 hours for 50 DEG C.
Gold contracted payment shell antibody BOT05 is added on glass film: functionalization BOT05 mark connects the BOT05 of Avidin-horseradish peroxidase, drips profit glass film, and 37 DEG C of dryings 30 minutes, kept dry is for subsequent use.
2, nitrocellulose filter pre-service and for subsequent use
PBS buffer solution ph 7.4,10mMPBS, 3%BSA, 0.5%Tween20;
Nitrocellulose filter is soaked in PBS damping fluid 4 hours, and 50 DEG C of dryings 2 hours are for subsequent use.
3, prepare and assemble golden shell nanometer material
Assembling composition: sample pad, nano material pad, functionalization 20nm gold shell, signal antibody BOT05, functionalization 40nm signal antibody BOT05, nitrocellulose filter (catching antibody BOT06 and sheep anti-mouse igg antibody line) and absorption pad 6 kinds of compositions.
Complete film 37 DEG C of dryings after assembling, store for subsequent use.
Embodiment 7
1, golden shell nanometer material pad preparation
The preparation of signal antibody BOT05 and 15nm and 45nm gold contracted payment nm of gold shell compound:
Use 0.1MK
2cO
3regulate PH8.5-9.0;
NGAL signal monoclonal antibody BOT05 and nanoshell are adjusted to as 4:100(μ g/ml than row);
Single stranded DNA 3' end is indicated 30-80BPSSDNA and the nanoshell gold labeling antibody valency chain coupled reaction 6-8 hour of biotin, 25 DEG C, its final concentration is 0.5-2.0 μM.
It is that 0.5% (0.2-1.0%), 2MNaCl/20mMphosphate regulate SSDNA nanoshell complex PH to 7.4 that SSDNA and nanoshell gold labeling antibody compound are added PEG8000 final concentration.
Above-mentioned PH7.4 complex and streptavidin, horseradish peroxidase (final concentration 0.4 μM), under 25 DEG C of conditions, are hatched 4 hours, centrifugal, precipitation cleaning 3 times, preserve 4 DEG C for subsequent use.
The composition of cleaning and conserving liquid punching and PH:PH7.4,0.1%BSA, 0.1%Tween20,10mMphosphatesodium.
Glass film pre-service and for subsequent use
Borate buffer: PH7.4,10mM boric acid, 0.5% sucrose, 1%BSA, 0.5Tween20,0.05% Sodium azide glass film (poLyecterfiter) are soaked in borate buffer 2 hours, change twice damping fluid therebetween, dry 2 hours at 50 DEG C.
Glass film is combined with functionalization signal antibody: pretreated glass film to be soaked in 0.05% sucrose Sodium azide liquid 1 hour, dries 2 hours for 50 DEG C.
Gold contracted payment shell antibody BOT05 is added on glass film: functionalization BOT05 mark connects the BOT05 of Avidin-horseradish peroxidase, drips profit glass film, and 37 DEG C of dryings 30 minutes, kept dry is for subsequent use.
2, nitrocellulose filter pre-service and for subsequent use
PBS buffer solution ph 7.4,10mMPBS, 3%BSA, 0.5%Tween20;
Nitrocellulose filter is soaked in PBS damping fluid 4 hours, and 50 DEG C of dryings 2 hours are for subsequent use.
3, prepare and assemble golden shell nanometer material
Assembling composition: sample pad, nano material pad, functionalization 15nm gold shell, signal antibody BOT05, functionalization 45nm signal antibody BOT05, nitrocellulose filter (catching antibody BOT06 and sheep anti-mouse igg antibody line) and absorption pad 6 kinds of compositions.Complete film 37 DEG C of dryings after assembling, store for subsequent use.
<110> The Second Affiliated Hospital of Nanjing Medical University, Nanjing Botian Kezhi Biotechnology Co., Ltd.
Nano material test strip of a <120> hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL and preparation method thereof
<130>20121123
<160>1
<170>PatentInversion3.3
<210>1
<211>48
<212>DNA
<213> artificial sequence
<400>1
ttttttttttggctttcagttatatggatgatgtggtatttttttttt48
<210>2
<211>43
<212>DNA
<213> artificial sequence
<400>2
ttttttttttagctacgagttgaatcctgcgacgttttttttt43
<210>3
<211>33
<212>DNA
<213> artificial sequence
<400>3
ttttttttttggcttatgtgttttttttttttt33
210>4
<211>63
<212>DNA
<213> artificial sequence
<400>4
ttttttttttggcttatatttgagtatggtgacgtgatattcagttatatggatgttttt60
ttt63
Claims (5)
1. the nano material test strip of a hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL, it is characterized in that: comprise the sample pad (1) being located at and fixed head is connected successively, nano material pad (2), nitrocellulose filter (3) and absorption pad (4), nitrocellulose filter (3) is provided with detection line antibody (5) and nature controlling line antibody (6), nano material pad (2) is provided with golden contracted payment nm of gold shell compound; Described golden contracted payment nm of gold shell compound is the compound be connected by 50nm and 10nm nm of gold contracted payment shell mark by specific single stranded DNA, the nucleotide sequence of described specific single stranded DNA is as SEQIDNO:1 or SEQIDNO:2 or SEQIDNO:3 or SEQIDNO:4, described specific single stranded DNA length is 30-80bp, specific single stranded DNA 3 ' end indicates biotin, and specific single stranded DNA 5 ' end is connected with sulfydryl-SH.
2. the nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL according to claim 1, it is characterized in that: in described golden contracted payment nm of gold shell compound, include colour developing antibody mouse-anti human neutrophil genatinase associated lipocalin antibody, include anti-human NGAL monoclonal antibody in detection line antibody (5) also referred to as seizure antibody, described nature controlling line antibody (6) is sheep anti-mouse igg; Wherein, the antibody that develops the color is that two strains can be matched mutually and formed sandwich anti-human NGAL monoclonal antibody with catching antibody.
3. the nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL according to claim 1, it is characterized in that: the pad that described nano material pad (2) is made for dacron film, the pad that described sample pad (1) is made for glass fibre membrane.
4. a preparation method for the nano material test strip of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL as claimed in claim 1, is characterized in that: comprise the following steps:
(1) preparation of nm of gold shell solution;
(2) golden shell mark is prepared and confirms that golden contracted payment shell nanometer material size and purity are determined;
(3) preparation of golden contracted payment nm of gold shell compound, by the compound that signal antibody and 10nm and 50nm gold contracted payment shell label are connected;
Use 0.1MK
2cO
3regulate pH8.5-9.0; NGAL signal monoclonal antibody and nanoshell ratio are adjusted to 4:100(μ g/ml); Single stranded DNA 3' end is indicated 30-80bpSSDNA and the nanoshell signal antibody valency chain coupled reaction 6-8 hour of biotin, 25 DEG C, its final concentration is 0.5-2.0 μM;
SSDNA and nanoshell signal antibody compound being added PEG8000 final concentration is that 0.2-1.0%, 2MNaCl/20mMphosphate regulate SSDNA nanoshell complex pH to 7.4;
By above-mentioned pH7.4 complex and streptavidin, horseradish peroxidase, final concentration 0.4 μM, under 25 DEG C of conditions, hatches 4 hours, centrifugal, precipitation cleaning 3 times, preserve 4 DEG C for subsequent use;
(4) golden shell nanometer material pad preparation;
(5) nitrocellulose filter pre-service and for subsequent use;
(6) prepare and assemble golden shell nanometer material pad;
(7) detection line preparation;
(8) nature controlling line preparation;
(9) test strips assembling.
5. the preparation method of the nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL according to claim 4, it is characterized in that: single stranded DNA length is 43bp in described step (3), described SSDNA and nanoshell signal antibody compound are added PEG8000 final concentration is 0.5%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210489700.2A CN102955036B (en) | 2012-11-27 | 2012-11-27 | Nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210489700.2A CN102955036B (en) | 2012-11-27 | 2012-11-27 | Nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102955036A CN102955036A (en) | 2013-03-06 |
| CN102955036B true CN102955036B (en) | 2015-11-18 |
Family
ID=47764114
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210489700.2A Active CN102955036B (en) | 2012-11-27 | 2012-11-27 | Nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102955036B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108152514A (en) * | 2018-03-19 | 2018-06-12 | 南京博天科智生物技术有限公司 | A kind of neutrophil leucocyte gelatinase correlation apolipoprotein NGAL efficient nano Test papers |
| CN108490190A (en) * | 2018-03-19 | 2018-09-04 | 南京博天科智生物技术有限公司 | A kind of preparation method of NGAL efficient nanos Test paper |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103267854B (en) * | 2013-05-03 | 2015-08-05 | 西安交通大学 | A kind of method strengthening detection paper signal |
| CN103728451B (en) * | 2014-01-23 | 2015-06-24 | 湖南大学 | Colloidal gold immunoassay kit for detecting ochracin A and preparation method of kit |
| CN103728452B (en) * | 2014-01-23 | 2015-06-24 | 湖南大学 | Colloidal gold immunoassay kit for detecting aflatoxin B1 and preparation method of kit |
| CN104372089A (en) * | 2014-11-11 | 2015-02-25 | 南京博纳天元生物科技有限公司 | Detection card for rapidly detecting micro ribonucleic acid (miRNA) as well as preparation method and application of detection card |
| CN108918857B (en) * | 2018-05-11 | 2020-08-07 | 南京博天科智生物技术有限公司 | Nano gold cage compound and application thereof in preparation of kit for detecting cMyBP-C in human urine or blood |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101059519A (en) * | 2007-05-23 | 2007-10-24 | 南京博天科智生物技术有限公司 | Cardiac troponin I nano gold test paper and its preparation method |
| CN102298055A (en) * | 2011-07-21 | 2011-12-28 | 南京博天科智生物技术有限公司 | Human blood H-FABP nano-gold labeled test paper and preparation method thereof |
| CN102323422A (en) * | 2011-05-30 | 2012-01-18 | 中国科学院上海微系统与信息技术研究所 | Immunochromatographic test strip for semi-quantitatively and simultaneously detecting cTnI and Myo and preparation method thereof |
| CN102759623A (en) * | 2012-07-06 | 2012-10-31 | 南京基蛋生物科技有限公司 | Colloidal gold test strip for detecting NGAL (Neutrophil Gelatinase Associated Lipocalin) and preparation method thereof |
-
2012
- 2012-11-27 CN CN201210489700.2A patent/CN102955036B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101059519A (en) * | 2007-05-23 | 2007-10-24 | 南京博天科智生物技术有限公司 | Cardiac troponin I nano gold test paper and its preparation method |
| CN102323422A (en) * | 2011-05-30 | 2012-01-18 | 中国科学院上海微系统与信息技术研究所 | Immunochromatographic test strip for semi-quantitatively and simultaneously detecting cTnI and Myo and preparation method thereof |
| CN102298055A (en) * | 2011-07-21 | 2011-12-28 | 南京博天科智生物技术有限公司 | Human blood H-FABP nano-gold labeled test paper and preparation method thereof |
| CN102759623A (en) * | 2012-07-06 | 2012-10-31 | 南京基蛋生物科技有限公司 | Colloidal gold test strip for detecting NGAL (Neutrophil Gelatinase Associated Lipocalin) and preparation method thereof |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108152514A (en) * | 2018-03-19 | 2018-06-12 | 南京博天科智生物技术有限公司 | A kind of neutrophil leucocyte gelatinase correlation apolipoprotein NGAL efficient nano Test papers |
| CN108490190A (en) * | 2018-03-19 | 2018-09-04 | 南京博天科智生物技术有限公司 | A kind of preparation method of NGAL efficient nanos Test paper |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102955036A (en) | 2013-03-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102955036B (en) | Nano material test strip of a kind of hypersensitivity neutrophil leucocyte gelatinase relative carrier lipoprotein NGAL and preparation method thereof | |
| CN103901216B (en) | People H-FABP colloidal gold test and preparation method thereof | |
| Trau et al. | Nanoencapsulated microcrystalline particles for superamplified biochemical assays | |
| CN204228719U (en) | Cardiac muscle troponin I-myoglobins-creatine kinase isozyme joint inspection test strips | |
| CN102841208B (en) | Colloidal gold test paper for quickly detecting troponin I and preparation method for colloidal gold test paper | |
| CN105445449A (en) | Apparatus for rapidly and semi-quantitatively detecting uric acid in saliva, and making method thereof | |
| US20160209410A1 (en) | Test piece for immunochromatography, developing fluid used therefor, and immunochromatography using the same | |
| CN106257271B (en) | A kind of composite material and preparation method based on Surface enhanced Raman scattering technology | |
| CN104777298B (en) | A kind of detection means | |
| CN108469524A (en) | A kind of optical electro-chemistry immunosensor and its preparation method and application of detection CA125 | |
| CN106066399A (en) | The preparation method of the colloidal gold strip of detection early diabetic nephropathy | |
| JP7184054B2 (en) | Measurement sample diluent, kit and measurement method | |
| JPWO2019138898A1 (en) | Immunochromatographic test piece and measurement kit and measurement method | |
| JP2013174612A (en) | Agglutination assay | |
| CN115097129B (en) | Detection reagent combination for placenta growth factor and soluble fms-like tyrosine kinase-1 | |
| JP4976068B2 (en) | Simple immunoassay specimen suspension and assay method | |
| CN201464478U (en) | Improved detection device | |
| CN102087285B (en) | Immunochromatographic test strip for rapidly detecting acute pancreatitis and preparation method thereof | |
| JP5310154B2 (en) | Method for producing chromatographic strips | |
| CN101957369A (en) | The enhancing mark conjugate that is used for immunoassays | |
| Xiao et al. | Fluorescent sensing of free bilirubin at nanomolar level using a Langmuir–Blodgett film of glucuronic acid–functionalized gold nanoclusters | |
| CN203337666U (en) | Test strip for detecting nanometer material | |
| CN204028082U (en) | The colloid gold test paper of a kind of Quantitative detection NGAL and TIMP-2 | |
| CN108490190A (en) | A kind of preparation method of NGAL efficient nanos Test paper | |
| CN108918857B (en) | Nano gold cage compound and application thereof in preparation of kit for detecting cMyBP-C in human urine or blood |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Lu Xiang Inventor after: Zhang Jinan Inventor after: Yang Junwei Inventor after: Guo Zhirui Inventor after: Wang Dibin Inventor before: Zhang Jinan Inventor before: Lu Xiang Inventor before: Yang Junwei Inventor before: Guo Zhirui Inventor before: Wang Dibin |
|
| COR | Change of bibliographic data | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |