CN102936631B - Gene detection kit for Hong Kong alpha-thalassemia - Google Patents

Abstract

The invention relates to the technical field of biology and medicament, and particularly relates to a gene detection kit for Hong Kong alpha-thalassemia. According to the invention, the gene sequence of HK alpha alpha fusion gene is further confirmed and compared with alpha-globin sequence for analysis, and primer design is carried out in a conserved sequence area of the fusion gene. The technical scheme of the invention is to provide a gene detection kit for Hong Kong alpha-thalassemia, comprising a PCR (polymerase chain reaction) solution, wherein the PCR solution contains primer HK alpha alpha-F and HK alpha alpha-R, the primer is designed aiming at the conserved sequence area of the HK alpha alpha fusion gene, and the nucleotide sequence of the conserved sequence of the HK alpha alpha fusion gene is shown in SEQ ID NO:1. The kit disclosed by the invention can be directly used for kits for HK alpha alpha detection and can specifically, quickly and stably diagnose HK alpha alpha gene type.

Description

The gene detecting kit of Hong Kong type α-thalassemia

Technical field

The present invention relates to biological and medical technical field, be specifically related to a kind of in clinical sample the test kit of rapid detection Hong Kong type α-thalassemia (HK α α).

Background technology

α-thalassemia (Thalassemia, poor hereinafter to be referred as α-ground), is one group and maybe can not synthesizes because α-globin chain synthesizes minimizing, the hereditary hemolytic hemoglobinopathy that α-chain/non-α-chain proportional imbalance is feature.Ground is poor is one of modal mankind's monogenic inheritance hemopathy in the world, is listed in 6 kinds of common diseases of harm humans health by the World Health Organization, and Ye Shi southern china each province is the most common, endanger maximum inherited disease.In poor district occurred frequently, south China α-ground, the total incidence that 900000 people's epidemiology survey draws is 2.46%, and wherein the sickness rate of Guangxi, Guangdong, Jiangxi, Sichuan and Provinces (regions), Zhejiang is respectively 14.95%, 4.11%, 2.60%, 1.92% and 1.20%.

Mankind's α-globin gene cluster is positioned at karyomit(e) No. 16, and every karyomit(e) has 2 α-pearl protein-2 genes.Most of α-ground is poor is that minority is caused by point mutation due to due to the disappearance of α-globin gene.If be only α-genetically deficient or the defect on item chromosome, the composite part of α-chain is suppressed, is called α ⁺ground is poor; If have 2 α-genes on item chromosome all to lack or defect, be called α ⁰ground is poor.

Heavy α-ground is poor is α ⁰the homozygotic state that ground is poor, its 4 α-globin genes all lack or defect, so that without α-chain, generate completely, thereby the synthetic of the Hh A that contains α-chain, Hb A2 and HbF all reduces.There is the synthetic γ 4(Hb Bart ' s of a large amount of γ chains in fetus period in patient).Hb Bart ' s is high to the avidity of oxygen, causes histanoxia and causes fetus edema syndromes.

Osculant and α-ground are poor is α ⁰and α ⁺the heterozygote state that ground is poor, is caused by 3 α-globin genetically deficients or defect, and patient only can synthesize a small amount of α-chain, and its unnecessary β chain i.e. synthetic Hb H(β 4).Hb H is higher to affinity for oxygen, is again a kind of unstable hemoglobin, and easy sex change precipitation and form inclusion body in red corpuscle causes erythrocyte membrane stiff and shortened red blood cell life span.

Poor (light-duty) is α on standard type α-ground ⁺the poor homozygote in ground or α ⁰the poor heterozygote state in ground, it only has 2 α-globin genetically deficients or defect, therefore there are a considerable amount of α-chains synthetic, pathophysiological change is slight.

Silent oscillation α-ground is poor is α ⁺the poor heterozygote state in ground, it only has a α-genetically deficient or defect, and the synthetic of α-chain slightly reduces, and pathophysiological change is very slight.According to α gene mutation type classification, ground is poor mainly comprises absence type α-ground poor (DNA fragmentation disappearance), mutant ' alpha '-ground poor (point mutation).The modal disappearance type of China is-α ^3.7,-α ^4.2,-- ^sEA3 kinds.Along with further illustrating of α-thalassemia mechanism, some new genetically deficient types are found in succession, for example-- ^11.1,-α ^2.4,-α ^2.7,-- ^fIL,-- ^thai, HK α α etc.

At present, HK α α ground is poor does not also have effective radical cure method, mainly to put prevention first.Therefore the carrier that poor aberrant gene is found ahead of time in the detection of carrying out HK α α is to instructing before marriage and antenatal diagnosis has great importance.But the product that not yet has direct-detection HK α α at present.

At present the poor screening method in α-ground is mainly contained to routine blood test mensuration, erythrocyte fragility detection, hemoglobin electrophoresis etc., these methods can only be carried out the poor examination in preliminary ground to patient, cannot patient's genotype be made a definite diagnosis, easily to poor failing to pinpoint a disease in diagnosis lightly.Development along with technology, gone out the method for the poor gene diagnosis in ground, mainly comprised following several: Southern hybridization, multiple Gap-PCR, multiple ligase enzyme have relied on probe amplification technology (MLPA), PCR-oligonucleotide probe (ASO) method, real-time fluorescence quantitative PCR, dot hybridization, direct Sequencing technology etc.Range gene diagnostic techniques feature is as follows:

1, Southern blot hybridization-Restriction Enzyme Zymography: be once the main method of the poor gene diagnosis in α-ground, but due to complex operation, required time is longer, is generally only suitable for research and uses, be unsuitable for clinical applying.

2, rely on probe ligation amplification technology (MLPA): MLPA grows up for 2002, the method can be carried out detection to all detection of missing gene type and unknown genotype, have efficient, specially, in same reaction tubes, detect nearly 45 different IPs acid sequence copy numbers and change; Be usually used in the detection of α missing gene, but because testing cost is high, complex operation, consuming time longer, testing process reaches 16 hours, and needs special plant and instrument, general only for studying use, is not easy to applying of Molecular screening method.

3, sequencing technologies: sequencing technologies is the analysis to DNA sequence dna is directly considered to the gold standard of clinical detection always; Sequencing technologies is faced with processing (nucleic acid extraction) the amplification standardized attestation problem of sample at present, signal detection, special the makeing mistakes and Error Correcting Problem of order-checking platform, and the information biology aspect problem that may occur, clinical verification program and standardization issue etc., never effectively solve, therefore also fail to apply in clinical.

4, reverse dot blot hybridization (Reverse Dot Blot, RDB) method: this method have highly sensitive, specificity good and accuracy advantages of higher, has been widely used at present β-ground poor clinical antenatal diagnosis and gene diagnosis.Cardinal principle: be fixed on solid support a large amount of oligonucleotide as probe, by base complementrity, and hybridize through pcr amplification, with biotin labeled sample target molecule, provide hybridization signal through chemical colour reaction, by Computer Analysis acquired information.This method is sensitive, but consuming time longer, is generally used for point mutation detection.

5, Gap-PCR and improved technology thereof: because it is easy to operate, this technology is widely used in and lacks poor molecular diagnosis, at disappearance two ends, region design pair of primers, the very long scope that does not belong to amplification of two primer extension products under normal circumstances, and can there is specific amplification when there is disappearance region.The application such as nineteen ninety Lebo round pcr detects α-thalassemia 1, and the application such as Dode and Baysal round pcr detects α-thalassemia 2.With the test kit of Gap-PCR exploitation, can only examine the modal 3 kinds of scarce type-α of China in the market ^3.7,-α ^4.2with-- ^sEA, and can not detect the non-common genotype such as HK α α.

6, real-time fluorescence quantitative PCR (Taqman probe method): real-time fluorescence quantitative PCR is the most popular detection platform of current clinical diagnosing system, refer in PCR reaction system and add fluorophor, utilize fluorescent signal accumulation, Real-Time Monitoring PCR process and continuously analysing amplified relevant fluorescent signal, finally carry out the method for quantitative analysis to unknown template by typical curve.In thalassemia detects, report be all confined to a kind of genotypic detection, workload is large, because probe need to carry out fluorescent mark, testing cost is high.

7, PCR-oligonucleotide probe (ASO) method: this technology can detect the poor gene (α in ground of known mutations quickly and easily ^tand β ^t), there is very high susceptibility and accuracy, but once hybridization can only detect a kind of sudden change, but also need isotope probe, be difficult to apply.

Although it is a lot of to detect poor method and product, not yet there is the product of direct-detection HK α α at present.

Existing α-thalassemia detects and shortcoming:

1, the poor test kit in the detection absence type α of at present China's clinical application ground is all based on multiple Gap-PCR principle exploitation, can be in same PCR system to multiple lack poor genotype (-- ^sEA,-α ^3.7,-α ^4.2) detection, the α-thalassemia detection kit that hall bio tech ltd as prebiotic in Yaneng Biotechnology (Shenzhen) Co., Ltd., Shenzhen and Guangzhou Da An genome company develop separately, it is poor that these products all can only detect 3 kinds of common absence types ground.

2, Chaozhou Kaipu Biochemistry Co., Ltd. utilizes PCR to be combined the α of exploitation with reversal point hybrid method, β-thalassemic mutator gene combined detection kit, except detecting-- ^sEA,-α ^3.7,-α ^4.2outside three kinds of absence type α-ground are poor, 2 kinds of mutator gene type (α have been increased ^cSα, α ^qSdetection α).HK α α is not in the scope of its detection.

3,, in existing α-thalassemia testing product patented technology, have no the direct detection for HK α α.

4, the at present HK α α poor detection in ground is all according to clinical phenotypes, by the poor detection kit in existing ground, in conjunction with the genetic analysis of parent gene type, realizes, do not have a kind of fast, directly for detection of HK α α poor method.

Summary of the invention

The present invention has further confirmed the gene order of HK α alpha fusion gene, compares with α-globin sequence, in the conserved sequence region of fusion gene, carries out design of primers.Further by the optimization of system and response procedures, finally determine concentration that each component in preferred combination of primers, system is final and the optimization routines of pcr amplification, realize the amplification of HK α alpha specific.

Technical scheme of the present invention is for providing the gene detecting kit of a kind of Hong Kong type α-thalassemia, comprise PCR reaction solution, described PCR reaction solution comprises primer HK α α-F and HK α α-R and other component proportion, the design of described primer for carrying out for the conserved sequence region of HK α alpha fusion gene, the nucleotides sequence of the conserved sequence of described HK α alpha fusion gene is classified as: SEQ ID NO:1.

Preferably, described in the gene detecting kit of above-mentioned Hong Kong type α-thalassemia, the nucleotides sequence of primer HK α α-F is classified as: SEQ ID NO:2, the nucleotides sequence of described primer HK α α-R is classified as: SEQ ID NO:3.

Preferably, the primer HK α α-F described in the gene detecting kit of above-mentioned Hong Kong type α-thalassemia in PCR reaction solution and HK α α-R concentration equate, are 0.1-1 μ M, MgCl ₂concentration is 1.5mM-9mM, and the concentration of dNTP is 100nM-300nM, and the concentration of archaeal dna polymerase is 1-7.5U/ reaction.

Preferably, each component concentration of PCR reaction solution described in the gene detecting kit of above-mentioned Hong Kong type α-thalassemia is:

Deionized water: 6 μ L;

5×Q buffer：5μL；

10×CoralLoad PCR Buffer：2.5μL；

The equal-volume mixed solution (dNTP) of 2.5mM dATP, dCTP, dGTP, dTTP: 2 μ L;

10 μ M primer HK α α-F:0.5 μ L;

10 μ M primer HK α α-F:0.5 μ L;

5U/ μ L Hotstar Taq enzyme: 0.5 μ L.

The poor detection kit in α ground can only detect 5 kinds of common gene types, i.e. absence types at present-- ^sEA,-α ^3.7,-α ^4.2α with non-deletion type ^cSα, α ^qSα, does not all comprise the detection to HK α α, but along with further the illustrating of the poor molecule mechanism in α-ground, some new genotype are found in succession, and the product on market can not cover these sensing ranges.At present all need to be by genetic analysis to HK α α genotype detection, analyze the genotype of father and mother both sides' sample, by several different methods, detect, detect loaded down with trivial details, can not be satisfied with clinical antenatal diagnosis over the ground poor examination fast, simply, demand cheaply.

The present invention further confirms the gene order of HK α alpha fusion gene, compares with α-globin sequence, in the conserved sequence region of fusion gene, carries out design of primers.By the optimization of further system and response procedures, final determine concentration that each component in preferred combination of primers, system is final and the optimization routines of pcr amplification, realize the amplification of HK α alpha specific, set up a kind of quick, simple, can be directly used in the test kit that HK α α detects, can special, quick, stable HK α α genotype be diagnosed.

Accompanying drawing explanation

Fig. 1 is that this test kit of the present invention is to 10 routine HK α α pattern detection results, 1-10:HK α α; CK: negative control; M:DL2000Markers;

The gene of alpha thalassemia detection kit of Tu2Wei Yaneng Biotechnology (Shenzhen) Co., Ltd. is to HK α α pattern detection result, 1-10:HK α α; M: the sub-energy poor Markers in α-ground;

Fig. 3 is that test kit of the present invention is to HK α α detected result, 1:HK α α; CK: negative control; M:DL2000Markers.

Embodiment

By describing technology contents of the present invention, structural attitude in detail, being realized object and effect, below in conjunction with embodiment and coordinate accompanying drawing to be explained in detail.

HK α α contains α 2 genes, a fusion gene being formed by X1 and X2 and a fusion gene (α who is formed by α 2 and α 1 ^3.7disappearance fusion gene), when it with-- ^sEAin the time of merging, can produce a certain amount of Hb Bart ' s.It is reported that propositus is that standard type α-ground is poor at clinical and hematological manifestation.

The sample that first the present invention adopts the α-thalassemia detection kit of Yaneng Biotechnology (Shenzhen) Co., Ltd. to carry HK α α gene to 3 examples carries out augmentation detection, and it is common that this diagnostic kit can detect Chinese population simultaneously-- ^sEA,-α ^3.7,-α ^4.2three kinds of poor genes in absence type α-ground, by specification carries out.Result shows that amplified production is three bands, and length is respectively 2051bp, 1826bp, 1306bp.Meanwhile, the document that the Wang of reference etc. delivers for 2005 designs respectively primer, on the basis of Lanti4.2F and L3.7R primer extension product, carry out nest-type PRC carry out respectively anti4.2 and-α ^3.7single expansion, result all have anti4.2 and-α ^3.7specific band.Further confirmed that this 3 routine sample carries HK α α gene, the fusion gene forming in the restructuring of homology region on the item chromosome of this sample, contains α 2 genes, a fusion gene being formed by X1 and X2 and a fusion gene being formed by α 2 and α 1.

Long segment amplified production to HK α α sample carries out Sanger order-checking, obtains the gene order of one section of 4.5Kb, compares with α-globin sequence, in the conserved sequence region of fusion gene, carries out design of primers.By the optimization of further system and response procedures, finally determine concentration that each component in preferred combination of primers, system is final and the optimization routines of pcr amplification, realize the amplification of HK α alpha specific, and it is carried out to sequence verification.

By above-mentioned experiment, set up a kind of fast for the experimental technique of HK α α gene test, and the detection based on above-mentioned, the specificity of the method is good; Can meet clinical fast, easily for the demand of the poor detection in ground.

Embodiment mono-test kit of the present invention forms

1, the design of primer and screening:

According to α-globin homologous relationship, in the relative conserved sequence region of the fusion gene being formed with α 1 by α 2, carry out design of primers; The nucleotide sequence of described conserved sequence is:

SEQ ID NO：1：

CTCAGGGAGTCCCAGCATCGCCACCCTCCTTTGAAATCTCCCTGGTTGAACCCAGTTAACATACGCTCTCCATCAAAACA

AAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAATGCAAGTGCAGGTGCCAGAACATTTCTCTCATTCTCACCC

CTTCCTGCCAGAGGGTAGGTGGCTGGAGTGAGGGTGCTGGCCCTACTCACACTTCCTGTGTCATGGTGACCCTCTGAGAG

CAGCCCAGTCAGTGGGGAAGGAGGAAGGGGCTGGGATGCTCACAGCCGGCAGCCCACACCTGGGGAGACTCTTCAGCAGA

GCACCTTGCGGCCTTACTCCTGCACGTCTCCTGCAGTTTGTAAGGTGCATTCAGAACTCACTGTGTGCCCAGCCCTGAGC

TCCCAGCTAATTGCCCCACCCAGGGCCTCTGGGACCTCCTGGTGCTTCTGCTTCCTGTGCTGCCAGCAACTTCTGGAAAC

GTCCCTGTCCCCGGTGCTGAAGTCCTGGAATCCATGCTGGGAAGTTGCACAGCCCATCTGGCTCTCAGCCAGCCTAGGAA

CACGAGCAGCACTTCCAGCCCAGCCCCTGCCCCACAGCAAGCCTCCCCCTCCACACTCACAGTACTGAATTGAGCTTTGG

GTAGGGTGGAGAGGACCCTGTCACCGCTTTTCTTCTGGACATGGACCTCTCTGAATTGTTGGGGAGTTCCCTCCCCCTCT

CCACCACCCACTCTTCCTGTGCCTCACAGCCCAGAGCATTGTTATTTCAACAGAAACACTTTA

The screening of primer and the optimization of system are carried out random combine according to the Tm value difference of primer, utilize orthogonal test and grads PCR, look for suitable annealing temperature; Due to high homology and the high GC content of α-globin gene, the too low specificity to amplification of the annealing temperature of primer is bad, but annealing temperature is too high, amplification efficiency is had to impact.

Through a large amount of Practical adjustments primer sequence of the present invention, preferred combination of primers sequence is as follows:

HKαα-F（SEQ ID NO：2）：ATCCGATACGTTGCACCGGCCC

HKαα-R（SEQ ID NO：3）：CTGGCTAGAAGTGCTGCTCG

2, other concentration of component of primer concentration and reaction system are determined

The concentration range of primer storage liquid is at 0.1-1 μ M, MgCl ₂final concentration is selected 1.5mM-9mM, isocyatic four kinds of deoxidation Triphosadens (dATP, dGTP, dCTP, dTTP) mixed solution dNTP final concentration is selected 100nM-300nM, archaeal dna polymerase final concentration is selected 1-7.5IU/ reaction, utilize orthogonal test method, by great many of experiments, contrast, finally determine that optimum PCR reaction solution formula is in Table 1.

Table 1PCR reaction solution formula

Table 1

In the PCR of table 1 reaction solution formula, DNA application of sample amount is 4 μ L, and total reaction volume is 25 μ L.

3, HK α alpha reaction condition determines

This reagent adopts conventional PCR system.HK α alpha reaction condition is divided following steps optimization:

90-98 ℃ of 5min(warm start activates Taq enzymic activity)

Through great many of experiments, contrast is optimized, and final definite optimum reaction condition is:

Annealing temperature and annealing time are larger on pcr amplification efficiency and specific amplification impact, and above-mentioned condition optimizing result shows the annealing temperature non-specific amplification band that has on the low side, causes false positive results; Temperature drift amplification efficiency is on the low side, and sensitivity declines.

Test kit of the present invention can accomplish to other genotype that by controlling annealing temperature and annealing time, without non-specific amplification, specificity is good, and amplification efficiency is high, and sensitivity can reach 2ng/ μ L.

4, the use of test kit of the present invention

Testing process for HK α α in turn includes the following steps:

(1) extract detected sample DNA: from peripheral blood leucocyte, fine hair or amniocyte, extract genomic dna, concentration is at 10～500ng.

(2) pcr amplification: the genomic dna extracting of take carries out pcr amplification as template, obtains amplified production.

(3) electrophoresis detection is identified PCR product: get the product 3.0 μ L in pcr amplification; Point sample is in 1.5% additional 0.005% nucleic acid dye of agarose gel; Under 5V/cm voltage, electrophoresis is approximately 50 minutes, takes out observations the preservation of taking pictures in gel imaging system.

(4) result interpretation: HK α α amplified production length 884bp, normal genotype and other genotype are without amplification.

(5) the PCR product of test positive is carried out to direct Sequencing checking, order-checking is amplification primers with primer.

The result of use of embodiment bis-test kits of the present invention

The present invention directly adopts Gap-PCR technology to detect type α-ground, Hong Kong poor (HK α α), use test kit of the present invention, can direct-detection go out the poor genetic flaw in HK α α ground, antenatal diagnosis utilize nest-type PRC simple to operate in conjunction with genetic analysis, save time, cost-saving.

The present invention further illustrates the structure of HK α α gene, by α 2 genes, a fusion gene being formed by X1 and X2 and a fusion gene being formed by α 2 and α 1, formed, for carrying out more comprehensively poor examination, create conditions, for pre-marital, antenatal detection and the pregnancy period fetus α-thalassemia diagnosis the foundation of science is provided.

1, the check situation of test kit of the present invention to clinical sample:

Utilize test kit of the present invention to detect 10 type α-ground, routine Hong Kong poor (HK α α) and 40 other genotype of example and normal sample, the detected result of " α-thalassemia detection kit " of Yaneng Biotechnology (Shenzhen) Co., Ltd. is consistent with adopting, and further to detecting sample, carry out Sanger sequencing analysis, detected result is in Table 2: the check situation of test kit of the present invention to clinical sample; Statistical study comparing result is in Table 3: test kit detected result of the present invention and sequencing result contrast; Table 4: test kit detected result of the present invention and sub-can the poor detection kit in α-ground contrast.

Table 2: the check situation of test kit of the present invention to clinical sample

Table 3: test kit detected result of the present invention and sequencing result contrast

Table 4: test kit detected result of the present invention and sub-can the poor detection kit in α-ground contrast

Use test kit of the present invention to detect clinical 50 routine samples, 10 examples are that type ground, Hong Kong is poor as a result, the detected result of sub-energy biotechnology (Shenzhen) α-thalassemia test kit is consistent with adopting, as shown in Figure 1 and Figure 2, the sample that is 2.0kb, 1.8kb, 1.3kb tri-bands, positive coincidence rate and negative match-rate are 100%.Compare with sequencing result, positive coincidence rate and negative match-rate are 100%, rate of accuracy reached 100%.

Above-mentioned positive sample is carried out to repeated test experience, choose 10 routine samples, different lot number products, different people (2 people) operation, does 2 times for one day, does altogether 2 days, each each sample of test repeats 3 times and detects, evaluate repeatability, detected result is in Table 5: the repetition stability experiment of test kit of the present invention, note: the detected result of each repeated test experience is all as table 5.

Table 5: the repetition stability experiment of test kit of the present invention

Clinical sample numbering	Detected result of the present invention
		1	HKαα
2	HKαα
		3	HKαα
4	HKαα
		5	HKαα
6	HKαα
		7	HKαα
8	HKαα
		9	HKαα
10	HK αα

2, the performance index of test kit of the present invention:

2.1, sensitivity: it is 2ng/ μ L that this test kit can be stablized the concentration minimum detectability that detects human blood genomic dna;

2.2, accuracy: the accuracy that this test kit detects HK α α reaches more than 99% (in the 50 routine samples that carry out, the equal test positive result of 10 routine positive sample, 40 other genotype of example and normally sample standard deviation detect negative result);

2.3, specificity: this test kit detects HK α alpha specific and reaches more than 99% (in 50 routine samples, 40 routine other genotype samples, detected result is all negative);

2.4, repeatability: the repeatability of this test kit is more than 99% (choose 10 routine samples, different lot number products, different people (2 people) operation, does 2 times for one day, does altogether 2 days, tests each sample at every turn and repeats 3 times and detect, result is consistent);

2.5, stability: this product is used before the deadline can meet above each index completely.

The clinical application of example three test kits of the present invention

1, purposes

Rare genotype HK α α in α-thalassemia is detected, realize the qualitative detection to HK α α, for the poor genetic screening in ground provides reliable foundation.When doing genetic analysis, father and mother one side is-α ^3.7/ α α, the opposing party be-- ^sEA/ α α, the child who bears has 2.0kb, 1.8kb, tri-electrophoretic bands of 1.3kb with the detection kit detection of the α-thalassemia of Yaneng Biotechnology (Shenzhen) Co., Ltd., can be HK α α and detect.

2, inspection principle

This test kit be PCR-based in conjunction with the know-why of agarose gel electrophoresis, at the relative conservative region of fusion gene, carry out specific amplification, realize the genotypic qualitative detection of HK α α.

3, chief component is as table 6.

Table 6

4, applicable instrument

Pcr gene amplification instrument: ABI 9700, unexpected rival 9600, C1000Touch ^tMthermalCycler (Bio-RAD); Electrophoresis apparatus: Powerpac Basic(Bio-RAD); Gel imaging analysis system: UV-3C(Zhuhai unexpected rival).

5, condition of storage and validity period

Condition of storage: test kit lucifuge is stored in below-18 ℃, avoids multigelation.

Validity period: 6 months.

6, sample requirement

1) this test kit sample source is anticoagulated whole blood, and antithrombotics used is Sodium Citrate or EDTA, can not use anticoagulant heparin.

2) sample collection: venous blood samples 1～5mL enters to contain in the pipe of antithrombotics, the good sample information of mark.

3) blood sample is preserved: anticoagulated whole blood is placed and is no more than 24 hours in room temperature, and 2～8 ℃ of preservations are no more than one month, and-18 ℃ of following preservations are no more than 2 years, can preserve for a long time for-70 ℃, during freezing preservation, should avoid multigelation.

4) blood sample transportation: need add ice bag sealing with curling stone or bubble chamber during anticoagulated whole blood transportation, should guarantee that ice bag does not thaw, and the time limit in transit should not be over 72 hours.

7, the method for inspection

1) extraction of DNA:

This test kit is not specified requirement to human gene group DNA's extracting method, and general available laboratory ordinary method (phenol-chloroform extraction process) or test kit extract human gene group DNA, and the whole blood DNA of recommendation QIAGEN company extracts test kit.If adopt the whole blood DNA of QIAGEN to extract test kit, directly by specification application of sample; If extract DNA by phenol-chloroform or other method, to measure DNA concentration, concentrate if desired or dilute, after being adjusted to 2 ~ 200ng/ μ L, DNA concentration just can carry out test experience.

2) pcr amplification

Take out the PCR reaction solution of test kit, at tube wall or pipe, cover and carry out mark, of short duration centrifugal in 5000rpm, then add respectively the sample to be tested DNA 4 μ L that extracted, reaction is totally 25 μ L, and positive and negative contrast is set, and in the of short duration centrifugal PCR of being placed on detector, increases.

Amplification program is as follows:

3) electrophoresis detection: get the direct point sample electrophoresis of 3 μ L amplified production (having added electrophoresis dyestuff), 1.5% additional 0.005% nucleic acid dye of agarose gel; Under 5V/cm voltage, electrophoresis is 50 minutes, after electrophoresis finishes, takes out observations the preservation of taking pictures in gel imaging system.

4) setting of experiment establishment condition

(1) the each detection of this product requirement all should arrange a positive quality control, and to monitor amplification condition, result should be electrophoresis and only occurs 884bp band.If without band, illustrative experiment failure, the failure of prompting pcr amplification, should detect again.

(2) the each detection of this product requirement all should arrange a negative Quality Control, and to monitor polluting, the result of negative Quality Control should be electrophoresis does not have band.If negative Quality Control has one or more band, point out this experiment to have pollution, answer after decontamination and again detect.

(3) result interpretation: HK α α size is 884bp, and only there is a band amplification, as shown in Figure 3, swimming lane 1 is HK α α to result, the negative contrast of swimming lane 2, and swimming lane M is DL2000Markers.

8, the explanation of assay

1) pcr amplification does not have product

(1) confirm that DNA extraction and PCR process are without misoperation.

(2) the sample DNA concentration of extracting is too low, during PCR, should increase DNA consumption.

2) amplified production concentration is too high: suggestion reduces the applied sample amount while running glue detection or chooses larger point sample sky and run glue.

9, the limitation of the method for inspection

This test kit can only detect HK α α, as supplementing of the poor diagnosis in α-ground.

10, product performance index

1), sensitivity: this test kit can stablize detect people's Whole Blood Genomic DNA concentration at 2ng/ μ L;

2), accuracy: the accuracy that this test kit detects HK α α reaches more than 99% (in the 50 routine samples that carry out, the equal test positive result of 10 routine positive sample, 40 other genotype of example and normally sample standard deviation detect negative result);

3), specificity: the specificity that this test kit detects HK α α reaches more than 99% (in 50 samples, 40 routine other genotype samples, detected result is all negative);

4), repeatability: the repeatability of this test kit is more than 99% (choose 10 routine samples, different lot number products, different people (2 people) operation, does 2 times for one day, does altogether 2 days, tests each sample at every turn and repeats 3 times and detect, result is consistent);

5), stability: this product is used before the deadline can meet above each index completely.

11, precaution

1) this product is only for vitro detection.

2) in transportation, have PCR reaction solution and be attached to tube wall/cover, therefore please first centrifugal before use, to guarantee the volume of PCR reaction system and to prevent potential pollution.

3) the contained indicator of PCR Mix has aberration to belong to normal phenomenon before amplification, does not affect amplification.

4) storage temperature necessarily can not be lower than below-30 ℃.

Detection kit of the present invention, for screening more comprehensively the poor condition of having created in α-ground, the loss of the α-thalassemia that reduction normal blood examination method causes, reduces or avoids the birth of heavy α-thalassemia infant.Test kit is easy to use, accuracy is high, and poor district occurred frequently produces good Social benefit and economic benefit over the ground.

The foregoing is only embodiments of the invention; not thereby limit the scope of the claims of the present invention; every equivalent structure or conversion of equivalent flow process that utilizes specification sheets of the present invention and accompanying drawing content to do; or be directly or indirectly used in other relevant technical fields, be all in like manner included in scope of patent protection of the present invention.

Sequence table

SEQUENCE LISTING

<110> Yaneng Biotechnology (Shenzhen) Co., Ltd.

The gene detecting kit of <120> Hong Kong type α-thalassemia

<160>3

<170>PatentIn version 3.3

<210>1

<211>783

<212>DNA

<213> artificial sequence

<400>1

ctcagggagt cccagcatcg ccaccctcct ttgaaatctc cctggttgaa cccagttaac 60

atacgctctc catcaaaaca aaacgaaaca aaacaaacta gcaaaatagg ctgtccccaa 120

tgcaagtgca ggtgccagaa catttctctc attctcaccc cttcctgcca gagggtaggt 180

ggctggagtg agggtgctgg ccctactcac acttcctgtg tcatggtgac cctctgagag 240

cagcccagtc agtggggaag gaggaagggg ctgggatgct cacagccggc agcccacacc 300

tggggagact cttcagcaga gcaccttgcg gccttactcc tgcacgtctc ctgcagtttg 360

taaggtgcat tcagaactca ctgtgtgccc agccctgagc tcccagctaa ttgccccacc 420

cagggcctct gggacctcct ggtgcttctg cttcctgtgc tgccagcaac ttctggaaac 480

gtccctgtcc ccggtgctga agtcctggaa tccatgctgg gaagttgcac agcccatctg 540

gctctcagcc agcctaggaa cacgagcagc acttccagcc cagcccctgc cccacagcaa 600

gcctccccct ccacactcac agtactgaat tgagctttgg gtagggtgga gaggaccctg 660

tcaccgcttt tcttctggac atggacctct ctgaattgtt ggggagttcc ctccccctct 720

ccaccaccca ctcttcctgt gcctcacagc ccagagcatt gttatttcaa cagaaacact 780

tta 783

<210>2

Sequence table

<211>22

<212>DNA

<213> artificial sequence

<400>2

atccgatacg ttgcaccggc cc 22

<210>3

<211>20

<212>DNA

<213> artificial sequence

<400>3

ctggctagaa gtgctgctcg 20

Claims (3)

1. the gene detecting kit of Hong Kong type α-thalassemia, it is characterized in that, comprise PCR reaction solution, described PCR reaction solution comprises primer HK α α-F and HK α α-R, the nucleotides sequence of described primer HK α α-F is classified as: SEQ ID NO:2, the nucleotides sequence of described primer HK α α-R is classified as: SEQ ID NO:3.

2. the gene detecting kit of Hong Kong according to claim 1 type α-thalassemia, is characterized in that, the primer HK α α-F in described PCR reaction solution and HK α α-R concentration equate, is 0.1-1 μ M, MgCl ₂concentration is 1.5mM-9mM, and the concentration of dNTP is 100nM-300nM, and the concentration of archaeal dna polymerase is 1-7.5U/ reaction.

3. the gene detecting kit of Hong Kong according to claim 1 type α-thalassemia, is characterized in that, described each component concentration of PCR reaction solution is:

Deionized water: 6 μ L;

5×Q buffer：5μL；

10×CoralLoad PCR Buffer：2.5μL；

2.5mM the equal-volume mixed solution of dATP, dCTP, dGTP, dTTP: 2 μ L;

10 μ M primer HK α α-F:0.5 μ L;

10 μ M primer HK α α-R:0.5 μ L;

5U/ μ L Hotstar Taq enzyme: 0.5 μ L.

Images