CN102936631A - Gene detection kit for Hong Kong alpha-thalassemia - Google Patents

Abstract

The invention relates to the technical field of biology and medicament, and particularly relates to a gene detection kit for Hong Kong alpha-thalassemia. According to the invention, the gene sequence of HK alpha alpha fusion gene is further confirmed and compared with alpha-globin sequence for analysis, and primer design is carried out in a conserved sequence area of the fusion gene. The technical scheme of the invention is to provide a gene detection kit for Hong Kong alpha-thalassemia, comprising a PCR (polymerase chain reaction) solution, wherein the PCR solution contains primer HK alpha alpha-F and HK alpha alpha-R, the primer is designed aiming at the conserved sequence area of the HK alpha alpha fusion gene, and the nucleotide sequence of the conserved sequence of the HK alpha alpha fusion gene is shown in SEQ ID NO:1. The kit disclosed by the invention can be directly used for kits for HK alpha alpha detection and can specifically, quickly and stably diagnose HK alpha alpha gene type.

Description

The gene detecting kit of Hong Kong type α-thalassemia

Technical field

The present invention relates to biological and medical technical field, be specifically related to a kind of in clinical sample the test kit of rapid detection Hong Kong type α-thalassemia (HK α α).

Background technology

α-thalassemia (Thalassemia, poor hereinafter to be referred as α-ground) is one group and maybe can not synthesizes because of the synthetic minimizing of α-globin chain that α-chain/non-α-chain proportional imbalance is the hereditary hemolytic hemoglobinopathy of feature.Ground is poor to be one of modal human monogenic inheritance hemopathy in the world, is listed in 6 kinds of common diseases of harm humans health by the World Health Organization, also is the inherited disease that the southern china each province is the most common, harm is maximum.In poor district occurred frequently, south China α-ground, the total incidence that 900,000 people's epidemiology survey draws is 2.46%, and wherein the sickness rate in Guangxi, Guangdong, Jiangxi, Sichuan and each province, Zhejiang (district) is respectively 14.95%, 4.11%, 2.60%, 1.92% and 1.20%.

Human α-globin gene cluster is positioned at karyomit(e) No. 16, and every karyomit(e) has 2 α-pearl protein-2 genes.Most of α-ground are poor to be because due to the disappearance of α-globin gene, minority is caused by point mutation.If only be α-genetically deficient or the defective on the item chromosome, then the composite part of α-chain is suppressed, and is called α ⁺Ground is poor; If have 2 α-genes on the item chromosome all to lack or defective, be called α ⁰Ground is poor.

Heavy α-ground is poor to be α ⁰The homozygotic state that ground is poor, its 4 α-globin genes all lack or defective, so that generate without α-chain fully, thereby contain synthetic all minimizings of Hh A, Hb A2 and the HbF of α-chain.The synthetic γ 4(Hb Bart ' of a large amount of γ chains namely occurs s) in fetus period in the patient.Hb Bart ' s is high to the avidity of oxygen, causes histanoxia and causes the fetus edema syndromes.

Osculant and α-ground are poor to be α ⁰And α ⁺The heterozygote state that ground is poor is caused by 3 α-globin genetically deficients or defective, and the patient only can synthesize a small amount of α-chain, and its unnecessary β chain i.e. synthetic Hb H(β 4).Hb H is higher to affinity for oxygen, is again a kind of unstable hemoglobin, and easy sex change precipitation and form inclusion body in red corpuscle causes erythrocyte membrane stiff and shortened red blood cell life span.

Poor (light-duty) is α on standard type α-ground ⁺The poor homozygote in ground or α ⁰The poor heterozygote state in ground, it only has 2 α-globin genetically deficients or defective, therefore there are a considerable amount of α-chains synthetic, pathophysiological change is slight.

Silent oscillation α-ground is poor to be α ⁺The poor heterozygote state in ground, it only has a α-genetically deficient or defective, and the synthetic of α-chain slightly reduces, and pathophysiological change is very slight.According to α gene mutation type classification, ground is poor mainly to comprise absence type α-ground poor (dna fragmentation disappearance), mutant ' alpha '-ground poor (point mutation).The modal disappearance type of China is-α ^3.7,-α ^4.2,-- ^SEA3 kinds.Along with further illustrating of α-thalassemia mechanism, some new genetically deficient types are found in succession, for example-- ^11.1,-α ^2.4,-α ^2.7,-- ^FIL,-- ^Thai, HK α α etc.

At present, HK α α ground is poor also not to have effective radical cure method, mainly to put prevention first.Therefore the carrier that the poor aberrant gene in ground is found in the detection of carrying out HK α α ahead of time is to instructing pre-marital and antenatal diagnosis has great importance.But the product that direct-detection HK α α is not yet arranged at present.

At present the poor screening method in α-ground is mainly contained routine blood test mensuration, erythrocyte fragility detection, hemoglobin electrophoresis etc., these methods can only be carried out the poor examination in preliminary ground to the patient, can't patient's genotype be made a definite diagnosis, easily to poor failing to pinpoint a disease in diagnosis lightly.Development along with technology, gone out the method for the poor gene diagnosis in ground, mainly comprised following several: Southern hybridization, multiple Gap-PCR, multiple ligase enzyme rely on probe amplification technology (MLPA), PCR-oligonucleotide probe (ASO) method, real-time fluorescence quantitative PCR, dot hybridization, direct Sequencing technology etc.Range gene diagnostic techniques characteristics are as follows:

1, Southern blot hybridization-Restriction Enzyme Zymography: once be the main method of the poor gene diagnosis in α-ground, but because complex operation, required time is longer, generally is only suitable for research and uses, and is unsuitable for clinical applying.

2, rely on probe ligation amplification technology (MLPA): MLPA grew up in 2002, the method can be carried out detection to all detection of missing gene type and unknown genotype, have efficiently, special, detecting nearly in same reaction tubes, 45 different IPs acid sequence copy numbers change; Be usually used in the detection of α missing gene, but because testing cost is high, complex operation, consuming time longer, testing process reaches 16 hours, and needs special plant and instrument, and general is used for research, is not easy to applying of Molecular screening method.

3, sequencing technologies: sequencing technologies is considered to the gold standard of clinical detection directly to the analysis of dna sequence dna always; Sequencing technologies is faced with processing (nucleic acid extraction) the amplification standardized attestation problem of sample at present, signal detection, special the makeing mistakes and Error Correcting Problem of order-checking platform, and the information biology aspect problem that may occur, clinical verification program and standardization issue etc., never effectively solve, therefore also fail in clinical, to apply.

4, reverse dot blot hybridization (Reverse Dot Blot, RDB) method: this method have highly sensitive, specificity good and the accuracy advantages of higher, has been widely used at present β-ground poor clinical antenatal diagnosis and gene diagnosis.Cardinal principle: a large amount of oligonucleotide are fixed on the solid support as probe, by base complementrity, and hybridize through pcr amplification, with biotin labeled sample target molecule, provide hybridization signal through chemical colour reaction, by the Computer Analysis acquired information.This method is sensitive, but consuming time longer, generally is used for point mutation detection.

5, Gap-PCR and improved technology thereof: because it is easy to operate, this technology is widely used in the poor molecular diagnosis in disappearance ground, at the regional two ends design of disappearance pair of primers, the very long scope that does not belong to amplification of two primer extension products under normal circumstances, and specific amplification can appear when the disappearance zone occurring.Nineteen ninety Lebo etc. use round pcr and detect α-thalassemia 1, and Dode and Baysal etc. use round pcr and detect α-thalassemia 2.Can only examine the modal 3 kinds of scarce type-α of China with the test kit of Gap-PCR exploitation in the market ^3.7,-α ^4.2With-- ^SEA, and can not detect the non-common genotype such as HK α α.

6, real-time fluorescence quantitative PCR (Taqman probe method): real-time fluorescence quantitative PCR is the most popular detection platform of present clinical diagnosing system, refer in the PCR reaction system, add fluorophor, utilize the fluorescent signal accumulation, Real-Time Monitoring PCR process and continuous analysing amplified relevant fluorescent signal, the method for by typical curve unknown template being carried out at last quantitative analysis.In thalassemia detects, report all be confined to a kind of genotypic detection, workload is large because probe need to carry out fluorescent mark, testing cost is high.

7, PCR-oligonucleotide probe (ASO) method: this technology can detect the poor gene (α in ground of known mutations quickly and easily ^TAnd β ^T), have very high susceptibility and accuracy, but once hybridization can only detect a kind of sudden change, but also need isotope probe, be difficult to apply.

Although it is a lot of to detect ground poor method and product, the product of direct-detection HK α α is not yet arranged at present.

Existing α-thalassemia detects and shortcoming:

1, the poor test kit in detection absence type α ground of at present China's clinical application all is based on multiple Gap-PCR principle exploitation, can be in same PCR system to multiple disappearance poor genotype (-- ^SEA,-α ^3.7,-α ^4.2) detection, such as the α-thalassemia detection kit that Yaneng Biotechnology (Shenzhen) Co., Ltd., Shenzhen Yi Shengtang bio tech ltd and Guangzhou Da An genome company develop separately, it is poor that these products all can only detect 3 kinds of common absence type ground.

2, Chaozhou Kaipu Biochemistry Co., Ltd. utilizes PCR to be combined the α of exploitation with the reversal point hybrid method, β-thalassemic mutator gene combined detection kit, except detecting-- ^SEA,-α ^3.7,-α ^4.2Outside three kinds of absence type α-ground are poor, 2 kinds of mutator gene type (α have been increased ^CSα, α ^QSDetection α).HK α α is not in the scope of its detection.

3, in the existing α-thalassemia testing product patented technology, have no direct detection for HK α α.

4, the at present poor detection in HK α α ground all is according to clinical phenotypes, in conjunction with the genetic analysis realization of parent gene type, does not have a kind of quick, direct for detection of the poor method in HK α α ground by existing poor detection kit.

Summary of the invention

The present invention has further confirmed the gene order of HK α alpha fusion gene, compares with α-globin sequence, carries out design of primers in the conserved sequence region of fusion gene.Further by system and reaction interval optimization of orderings, finally determine concentration that each component in preferred combination of primers, the system is final and the optimization routines of pcr amplification, realize the amplification of HK α alpha specific.

Technical scheme of the present invention is for providing the gene detecting kit of a kind of Hong Kong type α-thalassemia, comprise the PCR reaction solution, described PCR reaction solution comprises primer HK α α-F and HK α α-R and other component proportion, the design of described primer for carrying out for the conserved sequence region of HK α alpha fusion gene, the nucleotides sequence of the conserved sequence of described HK α alpha fusion gene is classified as: SEQ ID NO:1.

Preferably, the nucleotides sequence of primer HK α α-F is classified as described in the gene detecting kit of above-mentioned Hong Kong type α-thalassemia: SEQ ID NO:2, the nucleotides sequence of described primer HK α α-R is classified as: SEQ ID NO:3.

Preferably, the primer HK α α-F described in the gene detecting kit of above-mentioned Hong Kong type α-thalassemia in the PCR reaction solution and HK α α-R concentration equate, are 0.1-1 μ M, MgCl ₂Concentration is 1.5mM-9mM, and the concentration of dNTP is 100nM-300nM, and the concentration of archaeal dna polymerase is the 1-7.5U/ reaction.

Preferably, each component concentration of PCR reaction solution described in the gene detecting kit of above-mentioned Hong Kong type α-thalassemia is:

Deionized water: 6 μ L;

5×Q buffer：5μL；

10×CoralLoad PCR Buffer：2.5μL；

2.5mM the equal-volume mixed solution (dNTP) of dATP, dCTP, dGTP, dTTP: 2 μ L;

10 μ M primer HK α α-F:0.5 μ L;

10 μ M primer HK α α-F:0.5 μ L;

5U/ μ L Hotstar Taq enzyme: 0.5 μ L.

The poor detection kit in α ground can only detect 5 kinds of common gene types, i.e. absence types at present-- ^SEA,-α ^3.7,-α ^4.2α with non-deletion type ^CSα, α ^QSα does not all comprise the detection to HK α α, but along with further the illustrating of the poor molecule mechanism in α-ground, some new genotype are found in succession, and the product on the market can not cover these sensing ranges.At present all need to be by genetic analysis to HK α α genotype detection, analyze the genotype of father and mother both sides' sample, detect by several different methods, detect loaded down with trivial details, can not be satisfied with clinical antenatal diagnosis over the ground poor examination fast, simply, demand cheaply.

The present invention further confirms the gene order of HK α alpha fusion gene, compares with α-globin sequence, carries out design of primers in the conserved sequence region of fusion gene.By further system and reaction interval optimization of orderings, final determine concentration that each component in preferred combination of primers, the system is final and the optimization routines of pcr amplification, realize the amplification of HK α alpha specific, set up a kind of quick, simple, can be directly used in the test kit that HK α α detects, can special, quick, stable HK α α genotype be diagnosed.

Description of drawings

Fig. 1 is that this test kit of the present invention is to 10 routine HK α α pattern detection results, 1-10:HK α α; CK: negative control; M:DL2000Markers;

Fig. 2 is that the gene of alpha thalassemia detection kit of Yaneng Biotechnology (Shenzhen) Co., Ltd. is to HK α α pattern detection result, 1-10:HK α α; M: the inferior energy poor Markers in α-ground;

Fig. 3 is that test kit of the present invention is to HK α α detected result, 1:HK α α; CK: negative control; M:DL2000Markers.

Embodiment

By describing technology contents of the present invention, structural attitude in detail, being realized purpose and effect, below in conjunction with embodiment and cooperate accompanying drawing to give in detail explanation.

HK α α contains α 2 genes, fusion gene and a fusion gene (α who is formed by α 2 and α 1 who is formed by X1 and X2 ^3.7The disappearance fusion gene), when it with-- ^SEAIn the time of merging, can produce a certain amount of Hb Bart ' s.It is reported that the propositus is that standard type α-ground is poor at clinical and hematological manifestation.

The sample that the present invention at first adopts the α-thalassemia detection kit of Yaneng Biotechnology (Shenzhen) Co., Ltd. that 3 examples are carried HK α α gene carries out augmentation detection, and it is common that this diagnostic kit can detect Chinese population simultaneously-- ^SEA,-α ^3.7,-α ^4.2Three kinds of poor genes in absence type α-ground, by specification carries out.The result shows that amplified production is three bands, and length is respectively 2051bp, 1826bp, 1306bp.Simultaneously, the document that the Wang of reference etc. delivered in 2005 designs respectively primer, carry out on the basis of Lanti4.2F and L3.7R primer extension product nest-type PRC carry out respectively anti4.2 and-α ^3.7Single the expansion, the result all have anti4.2 and-α ^3.7Specific band.Confirmed that further this 3 routine sample carries HK α α gene, the fusion gene that namely forms in the restructuring of homology zone on the item chromosome of this sample contains α 2 genes, fusion gene and a fusion gene that is formed by α 2 and α 1 that is formed by X1 and X2.

Long segment amplified production to HK α α sample carries out the Sanger order-checking, obtains the gene order of one section 4.5Kb, compares with α-globin sequence, carries out design of primers in the conserved sequence region of fusion gene.By further system and reaction interval optimization of orderings, finally determine concentration that each component in preferred combination of primers, the system is final and the optimization routines of pcr amplification, realize the amplification of HK α alpha specific, and it is carried out sequence verification.

Set up a kind of experimental technique that is used for fast HK α α gene test by above-mentioned experiment, and based on above-mentioned detection, the specificity of the method is good; Can satisfy the clinical demand that is used for fast, easily the poor detection in ground.

Embodiment one test kit of the present invention forms

1, the design of primer and screening:

According to α-globin homologous relationship, carry out design of primers in the relative conserved sequence region of the fusion gene that is formed by α 2 and α 1; The nucleotide sequence of described conserved sequence is:

SEQ ID NO：1：

CTCAGGGAGTCCCAGCATCGCCACCCTCCTTTGAAATCTCCCTGGTTGAACCCAGTTAACATACGCTCTCCATCAAAACA

AAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAATGCAAGTGCAGGTGCCAGAACATTTCTCTCATTCTCACCC

CTTCCTGCCAGAGGGTAGGTGGCTGGAGTGAGGGTGCTGGCCCTACTCACACTTCCTGTGTCATGGTGACCCTCTGAGAG

CAGCCCAGTCAGTGGGGAAGGAGGAAGGGGCTGGGATGCTCACAGCCGGCAGCCCACACCTGGGGAGACTCTTCAGCAGA

GCACCTTGCGGCCTTACTCCTGCACGTCTCCTGCAGTTTGTAAGGTGCATTCAGAACTCACTGTGTGCCCAGCCCTGAGC

TCCCAGCTAATTGCCCCACCCAGGGCCTCTGGGACCTCCTGGTGCTTCTGCTTCCTGTGCTGCCAGCAACTTCTGGAAAC

GTCCCTGTCCCCGGTGCTGAAGTCCTGGAATCCATGCTGGGAAGTTGCACAGCCCATCTGGCTCTCAGCCAGCCTAGGAA

CACGAGCAGCACTTCCAGCCCAGCCCCTGCCCCACAGCAAGCCTCCCCCTCCACACTCACAGTACTGAATTGAGCTTTGG

GTAGGGTGGAGAGGACCCTGTCACCGCTTTTCTTCTGGACATGGACCTCTCTGAATTGTTGGGGAGTTCCCTCCCCCTCT

CCACCACCCACTCTTCCTGTGCCTCACAGCCCAGAGCATTGTTATTTCAACAGAAACACTTTA

The screening of primer and the optimization of system are carried out random combine according to the Tm value difference of primer, utilize orthogonal test and grads PCR, look for suitable annealing temperature; Because high homology and the high GC content of α-globin gene, the too low specificity to amplification of the annealing temperature of primer is bad, but annealing temperature is too high influential to amplification efficiency.

Through a large amount of Practical adjustments primer sequence of the present invention, preferred combination of primers sequence is as follows:

HKαα-F（SEQ ID NO：2）：ATCCGATACGTTGCACCGGCCC

HKαα-R（SEQ ID NO：3）：CTGGCTAGAAGTGCTGCTCG

2, other concentration of component of primer concentration and reaction system are determined

The concentration range of primer storage liquid is at 0.1-1 μ M, MgCl ₂Final concentration is selected 1.5mM-9mM, isocyatic four kinds of deoxidation Triphosadens (dATP, dGTP, dCTP, dTTP) mixed solution dNTP final concentration is selected 100nM-300nM, the archaeal dna polymerase final concentration is selected the 1-7.5IU/ reaction, utilize orthogonal test method, by the great many of experiments contrast, final definite optimum PCR reaction solution prescription sees Table 1.

Table 1PCR reaction solution prescription

Table 1

In the PCR of table 1 reaction solution prescription, DNA application of sample amount is 4 μ L, and total reaction volume is 25 μ L.

3, HK α alpha reaction condition determines

This reagent adopts conventional PCR system.HK α alpha reaction condition is divided following steps optimization:

90-98 ℃ of 5min(warm start activates the Taq enzymic activity)

Contrast is optimized through great many of experiments, and the final optimum reaction condition of determining is:

Annealing temperature and annealing time are larger on pcr amplification efficient and specific amplification impact, and above-mentioned condition optimizing result shows the annealing temperature non-specific amplification band that has on the low side, causes false positive results; The temperature drift amplification efficiency is on the low side, and sensitivity descends.

Test kit of the present invention can accomplish to other genotype that by control annealing temperature and annealing time without non-specific amplification, specificity is good, and amplification efficiency is high, and sensitivity can reach 2ng/ μ L.

4, the use of test kit of the present invention

The testing process that is used for HK α α in turn includes the following steps:

(1) extract detected sample DNA: extract genomic dna from peripheral blood leucocyte, fine hair or amniocyte, concentration is at 10～500ng.

(2) pcr amplification: carry out pcr amplification take the genomic dna that extracts as template, obtain amplified production.

(3) electrophoresis detection is identified the PCR product: get the product 3.0 μ L in the pcr amplification; Point sample adds 0.005% nucleic acid dye in 1.5% agarose gel; Electrophoresis is approximately 50 minutes under 5V/cm voltage, takes out observations and the preservation of taking pictures in gel imaging system.

(4) as a result interpretation: HK α α amplified production length 884bp, normal genotype and other genotype are without amplification.

(5) the PCR product of test positive carried out the direct Sequencing checking, order-checking is amplification primers with primer.

The result of use of embodiment two test kits of the present invention

The present invention directly adopts the Gap-PCR technology that type α-ground, Hong Kong poor (HK α α) detected, use test kit of the present invention, can go out the poor genetic flaw in HK α α ground by direct-detection, antenatal diagnosis utilize nest-type PRC simple to operate in conjunction with genetic analysis, save time, save cost.

The present invention further illustrates the structure of HK α α gene, formed by α 2 genes, fusion gene and a fusion gene that is formed by α 2 and α 1 that is formed by X1 and X2, create conditions for carrying out more comprehensively the poor examination in ground, for pre-marital, antenatal detection and the pregnancy period fetus α-thalassemia diagnosis the foundation of science is provided.

1, test kit of the present invention is to the check situation of clinical sample:

Utilize test kit of the present invention that type α-ground, 10 routine Hong Kong poor (HK α α) and 40 example other genotype and normal samples are detected, consistent with the detected result of " the α-thalassemia detection kit " that adopt Yaneng Biotechnology (Shenzhen) Co., Ltd., and further carry out the Sanger sequencing analysis to detecting sample, detected result sees Table 2: test kit of the present invention is to the check situation of clinical sample; The statistical study comparing result sees Table 3: test kit detected result of the present invention and sequencing result contrast; Table 4: test kit detected result of the present invention and inferior can the poor detection kit in α-ground the contrast.

Table 2: test kit of the present invention is to the check situation of clinical sample

Table 3: test kit detected result of the present invention and sequencing result contrast

Table 4: test kit detected result of the present invention and inferior can the poor detection kit in α-ground the contrast

Use test kit of the present invention that clinical 50 routine samples are detected, 10 examples are that type ground, Hong Kong is poor as a result, consistent with the detected result that adopts inferior energy biotechnology (Shenzhen) α-thalassemia test kit, as shown in Figure 1 and Figure 2, be the sample of 2.0kb, 1.8kb, 1.3kb three bands, positive coincidence rate and negative match-rate are 100%.Compare with sequencing result, positive coincidence rate and negative match-rate are 100%, rate of accuracy reached 100%.

Above-mentioned positive sample is carried out repeated test experience, choose 10 routine samples, different lot number products, different people (2 people) operation was done 2 times in one day, did altogether 2 days, each each sample of test repeats 3 times and detects, estimate repeatability, detected result sees Table 5: the repetition stability experiment of test kit of the present invention, annotate: the detected result of each repeated test experience is all such as table 5.

Table 5: the repetition stability experiment of test kit of the present invention

The clinical sample numbering	Detected result of the present invention
		1	HKαα
2	HKαα
		3	HKαα
4	HKαα
		5	HKαα
6	HKαα
		7	HKαα
8	HKαα
		9	HKαα
10	HK αα

2, the performance index of test kit of the present invention:

2.1, sensitivity: it is 2ng/ μ L that this test kit can be stablized the concentration minimum detectability that detects the human blood genomic dna;

2.2, accuracy: the accuracy that this test kit detects HK α α reaches 99% or more (in the 50 routine samples that carry out, the equal test positive result of 10 routine positive sample, 40 routine other genotype and normal sample standard deviation detect negative result);

2.3, specificity: this test kit detects HK α alpha specific and reaches 99% or more (in the 50 routine samples, 40 routine other genotype samples, detected result is all negative);

2.4, repeatability: the repeatability of this test kit is (choose 10 routine samples, different lot number products, different people (2 people) operation was done 2 times in one day, did altogether 2 days, tested each sample at every turn and repeated 3 times and detect, the result is consistent) more than 99%;

2.5, stability: this product is used before the deadline can satisfy above each index fully.

The clinical application of example three test kits of the present invention

1, purposes

Rare genotype HK α α in the α-thalassemia is detected, realize the qualitative detection to HK α α, for the poor genetic screening in ground provides reliable foundation.Father and mother one side is-α when doing genetic analysis ^3.7/ α α, the opposing party be-- ^SEA/ α α, the child who bears has 2.0kb, 1.8kb, three electrophoretic bands of 1.3kb with the detection kit detection of the α-thalassemia of Yaneng Biotechnology (Shenzhen) Co., Ltd., can be HK α α and detect.

2, inspection principle

This test kit is based on PCR in conjunction with the know-why of agarose gel electrophoresis, carries out specific amplification at the relative conservative region of fusion gene, realizes the genotypic qualitative detection of HK α α.

3, chief component such as table 6.

Table 6

4, applicable instrument

Pcr gene amplification instrument: ABI 9700, unexpected rival 9600, C1000Touch ^TMThermalCycler (Bio-RAD); Electrophoresis apparatus: Powerpac Basic(Bio-RAD); Gel imaging analysis system: UV-3C(Zhuhai unexpected rival).

5, condition of storage and validity period

Condition of storage: the test kit lucifuge is stored in below-18 ℃, avoids multigelation.

Validity period: 6 months.

6, sample requirement

1) this test kit sample source is anticoagulated whole blood, and used antithrombotics is Sodium Citrate or EDTA, can not use anticoagulant heparin.

2) sample collection: venous blood samples 1～5mL enters to contain in the pipe of antithrombotics, the good sample information of mark.

3) blood sample is preserved: anticoagulated whole blood is placed in room temperature and is no more than 24 hours, and 2～8 ℃ of preservations are no more than one month, preserve below-18 ℃ and be no more than 2 years, but-70 ℃ of prolonged preservation should be avoided multigelation during freezing preservation.

4) blood sample transportation: need during the anticoagulated whole blood transportation to add the ice bag sealing with curling stone or bubble chamber, should guarantee that ice bag does not thaw, and the time limit in transit should not be above 72 hours.

7, the method for inspection

1) extraction of DNA:

This test kit is not specified requirement to human gene group DNA's extracting method, and general available laboratory ordinary method (phenol-chloroform extraction process) or test kit extract the human gene group DNA, and the whole blood DNA of recommendation QIAGEN company extracts test kit.If adopt the whole blood DNA of QIAGEN to extract test kit, directly the by specification application of sample; If extract DNA with phenol-chloroform or other method, then to measure DNA concentration, concentrate in case of necessity or dilute, after being adjusted to 2 ~ 200ng/ μ L, DNA concentration just can carry out test experience.

2) pcr amplification

Take out the PCR reaction solution of test kit, cover at tube wall or pipe and carry out mark, of short duration centrifugal in 5000rpm, then add respectively the sample to be tested DNA 4 μ L that extracted, reaction totally is 25 μ L, and the positive and negative contrast is set, and increases in the of short duration centrifugal PCR of the being placed on detector.

Amplification program is as follows:

3) electrophoresis detection: get the direct point sample electrophoresis of 3 μ L amplified productions (having added the electrophoresis dyestuff), 1.5% agarose gel adds 0.005% nucleic acid dye; Electrophoresis is 50 minutes under the 5V/cm voltage, and electrophoresis takes out observations and the preservation of taking pictures in gel imaging system after finishing.

4) setting of experiment establishment condition

(1) the each detection of this product requirement all should arrange a positive quality control, and with the monitoring amplification condition, the result should be electrophoresis and the 884bp band only occurs.If without band, then illustrative experiment failure, the failure of prompting pcr amplification should be done detection again.

(2) the each detection of this product requirement all should arrange a negative Quality Control, and so that pollution is monitored, the result of negative Quality Control should be electrophoresis does not have band.If negative Quality Control has one or more band, then point out this experiment that pollution is arranged, answer after the decontamination and again detect.

(3) as a result interpretation: HK α α size is 884bp, and band amplification only occurs, the result as shown in Figure 3, swimming lane 1 is HK α α, swimming lane 2 negative contrasts, swimming lane M is DL2000Markers.

8, the explanation of assay

1) pcr amplification does not have product

(1) confirms that DNA extraction and PCR process are without misoperation.

(2) the sample DNA concentration of extracting is excessively low, should increase the DNA consumption during PCR.

2) amplified production concentration is too high: suggestion reduces the applied sample amount when running the glue detection or chooses larger point sample sky and run glue.

9, the limitation of the method for inspection

This test kit can only detect HK α α, as replenishing of the poor diagnosis in α-ground.

10, product performance index

1), sensitivity: this test kit can stablize detect people's Whole Blood Genomic DNA concentration at 2ng/ μ L;

2), accuracy: the accuracy that this test kit detects HK α α reaches 99% or more (in the 50 routine samples that carry out, the equal test positive result of 10 routine positive sample, 40 routine other genotype and normal sample standard deviation detect negative result);

3), specificity: the specificity that this test kit detects HK α α reaches 99% or more (in 50 samples, 40 routine other genotype samples, detected result is all negative);

4), repeatability: the repeatability of this test kit is (choose 10 routine samples, different lot number products, different people (2 people) operation was done 2 times in one day, did altogether 2 days, tested each sample at every turn and repeated 3 times and detect, the result is consistent) more than 99%;

5), stability: this product is used before the deadline can satisfy above each index fully.

11, precaution

1) this product only is used for vitro detection.

2) in transportation, have the PCR reaction solution and be attached to tube wall/cover, therefore please first centrifugal before use, with the volume that guarantees the PCR reaction system and prevent potential pollution.

3) the contained indicator of PCR Mix has aberration to belong to normal phenomenon before amplification, does not affect amplification.

4) storage temperature necessarily can not be lower than below-30 ℃.

Detection kit of the present invention, for screening more comprehensively the poor condition of having created in α-ground, the loss of the α-thalassemia that reduction normal blood examination method causes reduces or avoids the birth of heavy α-thalassemia infant.Test kit is easy to use, accuracy is high, and poor district occurred frequently produces good Social benefit and economic benefit over the ground.

The above only is embodiments of the invention; be not so limit claim of the present invention; every equivalent structure or equivalent flow process conversion that utilizes specification sheets of the present invention and accompanying drawing content to do; or directly or indirectly be used in other relevant technical fields, all in like manner be included in the scope of patent protection of the present invention.

Sequence table

SEQUENCE LISTING

＜110〉Yaneng Biotechnology (Shenzhen) Co., Ltd.

＜120〉gene detecting kit of Hong Kong type α-thalassemia

<160>3

<170>PatentIn version 3.3

<210>1

<211>783

<212>DNA

＜213〉artificial sequence

<400>1

ctcagggagt cccagcatcg ccaccctcct ttgaaatctc cctggttgaa cccagttaac 60

atacgctctc catcaaaaca aaacgaaaca aaacaaacta gcaaaatagg ctgtccccaa 120

tgcaagtgca ggtgccagaa catttctctc attctcaccc cttcctgcca gagggtaggt 180

ggctggagtg agggtgctgg ccctactcac acttcctgtg tcatggtgac cctctgagag 240

cagcccagtc agtggggaag gaggaagggg ctgggatgct cacagccggc agcccacacc 300

tggggagact cttcagcaga gcaccttgcg gccttactcc tgcacgtctc ctgcagtttg 360

taaggtgcat tcagaactca ctgtgtgccc agccctgagc tcccagctaa ttgccccacc 420

cagggcctct gggacctcct ggtgcttctg cttcctgtgc tgccagcaac ttctggaaac 480

gtccctgtcc ccggtgctga agtcctggaa tccatgctgg gaagttgcac agcccatctg 540

gctctcagcc agcctaggaa cacgagcagc acttccagcc cagcccctgc cccacagcaa 600

gcctccccct ccacactcac agtactgaat tgagctttgg gtagggtgga gaggaccctg 660

tcaccgcttt tcttctggac atggacctct ctgaattgtt ggggagttcc ctccccctct 720

ccaccaccca ctcttcctgt gcctcacagc ccagagcatt gttatttcaa cagaaacact 780

tta 783

<210>2

Sequence table

<211>22

<212>DNA

＜213〉artificial sequence

<400>2

atccgatacg ttgcaccggc cc 22

<210>3

<211>20

<212>DNA

＜213〉artificial sequence

<400>3

ctggctagaa gtgctgctcg 20

Claims (4)

1. the gene detecting kit of Hong Kong type α-thalassemia, it is characterized in that, comprise the PCR reaction solution, described PCR reaction solution comprises primer HK α α-F and HK α α-R, described primer is for carrying out the primer of design of primers for the conserved sequence region of HK α alpha fusion gene, the nucleotides sequence of the conserved sequence of described HK α alpha fusion gene is classified as: SEQ ID NO:1.

2. the gene detecting kit of Hong Kong according to claim 1 type α-thalassemia is characterized in that, the nucleotides sequence of described primer HK α α-F is classified as: SEQ ID NO:2, the nucleotides sequence of described primer HK α α-R is classified as: SEQ ID NO:3.

3. the gene detecting kit of detection according to claim 2 Hong Kong type α-thalassemia is characterized in that, the primer HK α α-F in the described PCR reaction solution and HK α α-R concentration equate, is 0.1-1 μ M, MgCl ₂Concentration is 1.5mM-9mM, and the concentration of dNTP is 100nM-300nM, and the concentration of archaeal dna polymerase is the 1-7.5U/ reaction.

4. the gene detecting kit of Hong Kong according to claim 1 type α-thalassemia is characterized in that, described each component concentration of PCR reaction solution is:

Deionized water: 6 μ L;

5×Q buffer：5μL；

10×CoralLoad PCR Buffer：2.5μL；

2.5mM the equal-volume mixed solution of dATP, dCTP, dGTP, dTTP: 2 μ L;

10 μ M primer HK α α-F:0.5 μ L;

10 μ M primer HK α α-R:0.5 μ L;

5U/ μ L Hotstar Taq enzyme: 0.5 μ L.

Images