CN102936624B

CN102936624B - Method for high density detection of copy number variation

Info

Publication number: CN102936624B
Application number: CN201210378857.8A
Authority: CN
Inventors: 陆炯; 陈轶群; 肖君华
Original assignee: SHANGHAI YIHE APPLICATION BIO-TECH Co Ltd
Current assignee: SHANGHAI YIHE APPLICATION BIO-TECH Co Ltd
Priority date: 2012-10-08
Filing date: 2012-10-08
Publication date: 2015-01-07
Anticipated expiration: 2032-10-08
Also published as: CN102936624A

Abstract

The present invention relates to a method for detecting copy number variation by using a fast high density multiple-competitive PCR method. The method comprises the following steps: (1) providing multiple-competitive PCR primers, wherein the primers comprise at least a pair of universal fluorescent primers, at least a pair of chimeric specific primers positioned on a segment requiring detection, and a pair of chimeric specific primers positioned on a reference segment; (2) adopting restriction endonuclease to digest a sample to obtain independent small sample template fragments having a similar structure, such that the detection fragments can be detected by high density PCR and are not sensitive to a high GC sequence; (3) adopting a PCR method to directly prepare an internal control template; (4) carrying out a multiple-competitive PCR reaction; and (5) carrying out data analysis. With the method, a medium flux copy number variation detection scheme for 5-28 genes/reactions can be rapidly and simply established within 1 day, the result is accurate, and applicability is wide. The present invention further provides a corresponding kit.

Description

A kind of method of high density detection of copy number variation

Technical field

The present invention relates to biological technical field, particularly relate to by fluorescent universal primer, digestion with restriction enzyme sample and the PCR legal system method for the multiple competitive PCR detection copy number variation of internal reference template, be applied to bio-science research and clinical molecular diagnosis.

Background technology

Copy number variation (copy number variations, CNVs) is the new form of the genome diversity of discovered in recent years, and it refers to compared with reference sequences, the structure variation phenomenon of the DNA fragmentation of 1kb ~ 3Mb in genome.CNVs is extensively stored in genome, relevant to the generation of some heredopathias, has material impact to the variation such as mankind's disease resistance and susceptibility phenotype.This just require to set up a kind of fast, accurately and the CNVs somatotype detection technique of low cost.

Along with the development of biotechnology, different research groups develops many detection methods in succession, mainly comprises the detection technique based on hybridizing and based on PCR.The former can detect CNVs in full-length genome level, and the technology of representative has microarray icp gene to hybridize (SolinasToldo, Lampel et al Genes Chromosomes Cancer.1997Dec; 20 (4): 399-407), full-length genome SNP chip (Irving, Bloodworth et al.Cancer Res.2005Apr15; 65 (8): 3053-8), representative oligonucleotide microarray technique (Lucito, Healy et al.Genome Res.2003Oct; 13 (10): 2291-305.Epub 2003 Sep 15.) etc., its advantage is that flux is high and easily be automated, but the shortcoming that ubiquity resolving power is low, cost is high and the cycle is long.The latter mainly detects for concrete target site, and representational technology has real-time fluorescence quantitative PCR, multiplex ligation-dependent probe amplification (MLPA) (Schouten, McElgunn et al.Nucleic Acids Res.2002 Jun 15; 30 (12): e57) and multiple can amplification probe hybridization (MAPH) (Armour, Sismani et al.Nucleic Acids Res.2000Jan 15; 28 (2): 605-9.) etc.Real time fluorescent quantitative technology has the advantages such as simple to operate, reproducible, experimental period is short, but it is less to detect flux; Compared with real-time fluorescence quantitative PCR, the detection flux of MLPA and MAPH has had large increase, but the change of PCR microenvironment can cause different loci not increase by Complete Synchronization, and the platform effect of PCR also can affect detected result.It is exactly sample to be tested and check sample is separate detection that detection technique based on PCR exists a common defect, and the difference of both PCR efficiency can cause the deviation of detected result like this.

Competitive PCR overcomes this defect, realizes quick, accurate, the economic detection of CNVs.In pcr amplification process, the amount of PCR primer can use formula Y=A(1+R) ⁿrepresent, its Y represents the amount of PCR primer, and A represents the amount of original template, and R represents the amplification efficiency of PCR, and n represents the cycle number of PCR, and when pcr amplification efficiency is identical, the amount of PCR primer is directly proportional to the amount of original template.Competitive PCR make use of this principle, two groups of templates are related in same PCR reaction system, one group is sample to be tested, another group is one section of nucleotide sequence of synthesis, as internal reference, only in target sequence length, (there is insertion or the disappearance of some bases) and there are some differences in two groups of templates, other reaction conditionss are consistent, therefore both amplification efficiencies are close to consistent, the ratio of two kinds of amplified production amounts reflects the ratio that original template (sample to be tested and internal reference do not exist copy number difference) is measured intuitively, the concentration of sample can be calculated according to the amount of the original template of internal reference.When detecting copy number variation, when two templates there is identical concentration or eliminated that concentration difference brings affect time, the difference of the ratio of PCR primer amount just reflection template copy numbers.PRT method (Paralogue Ratio Test) (Armour, Palla et al.Nucleic Acids Res.2007; 35 (3): e19.Epub 2006 Dec14) be a kind of a kind of method detecting CVNs based on competitive PCR, the advantage of this method is that site to be measured and internal reference coexist in genome sequence, but shortcoming is also clearly, can only detect for limited gene locus, and all to design a pair fluorescent primer for different detection site, increase experimental cost.

Compared with MLPA technology, conventional competitive PCR scheme can be disturbed, so the spacing between PCR is enough far away mutually because PCR spacing in same section is little.When general PCR spacing is 5,000 bases, do not affect each other, a PCR reaction namely in 5000 bases, can only be had to detect.So when needing the change of the copy number in this nucleic acid segment of meticulous detection, when whole detector segments all covers by highdensity detection site by needs, such as in 1000kb, place 3 detection site, conventional competitive PCR method cannot detect, and MLPA then can complete.Meanwhile, because internal reference template is generally structured on plasmid vector, general length is 2-4kb, and linearizing genome length is 20k, in testing process, the difference in length of this template, make actual PCR efficiency not quite identical, this species diversity many times cannot ignored, especially in the detection by quantitative of copy number variation, this species diversity cannot be avoided causing quantitative result inaccurate, and therefore many detector segments cannot detect with competitive PCR.For the detection fragment that GC is higher, this phenomena of deflection is more outstanding.Finally, the internal reference template due to routine needs full genome synthesize and be cloned on plasmid, and therefore preparation time was at 1 week to 1 month, and directly preparing by PCR method then can the preparation of internal reference in one day, enters follow-up experiment fast.

Summary of the invention

The technical problem to be solved in the present invention is the blank overcoming prior art, provides that a kind of new cost is low, flux is high, suitability good, scheme Time Created is short, realizes the CNVs detection method that high-density the same as MLPA cover.

On the relative merits basis of summing up various detection method in prior art, contriver researches and develops through autonomous innovation, be surprisingly found out that by following design, can successfully solve the problems of the technologies described above, and be successfully applied to the fields such as bio-science research and clinical molecular diagnosis.

Object of the present invention is achieved through the following technical solutions: in brief, by utilizing one or more digestion with restriction enzyme samples, large target section is digested to one by one independently small segment, simply prepare the internal reference template similar with digestion products by a primer scheme simultaneously, make To Template and the state of internal reference template from initial basically identical, thus it is faster to make the detection scheme based on the multiple competitive PCR of fluorescent universal primer build the time, scheme suitability is wider and make detector segments realize the covering of high-density detection site.

One of technical scheme of the present invention is to provide a kind of method that multiple competitive PCR detects copy number variation, comprises the following steps:

(1) provide multiple competitive PCR primer, by least one pair of universal fluorescent primer, at least one pair of is positioned at section to be measured and chimeric special primer that at least one pair of is positioned at reference to section forms;

Described universal fluorescent primer length scope is 10 ~ 25bp, 5 ' end fluorescent mark, TM value≤57 DEG C value, and has specificity to testing gene group;

Described chimeric special primer is for section to be measured with reference to section design, TM value >=62 DEG C, length range is 28 ~ 50bp, and 3 ' end is the specific primer sequences of 18 ~ 25bp, 5 ' end is described universal primer sequence, inserts the fixed Combination of two bases between described 3 ' end and 5 ' two sequences of holding; The difference of the TM value between all chimeric special primers is no more than 3 DEG C; When there being two pairs or more, described reference design of primers on identical or different reference section, and is mated without specificity with testing gene;

The difference in length that can detect is had between the different amplified production fragments that described multiple competitive PCR primer produces;

(2) the chimeric special primer of at least one pair of internal reference is provided, for section to be measured or with reference to section design, its amplified production than section to be measured in multiple competitive PCR product or with reference to the product length corresponding to section or short 1 ~ 6bp, and is made up of three parts: hold multiple PCR primer district with 3 ' terminal specific primer sequence identical 5 ' of the chimeric special primer described in (1); Identical with the sequence of the chimeric special primer downstream 18 ~ 25bp described in (1), and TM value >=62 DEG C, the difference of TM value is no more than the 3 ' terminal sequence of 3 DEG C between primer; It is the length adjustment sequence of-3 ~ 3bp between described 5 ' end multiple PCR primer district and described 3 ' terminal sequence, namely hold at 5 ' end and 3 ' and to insert any base of 1 ~ 3bp between two sequences respectively or delete 1 ~ 3bp base respectively by 3 ' end 5 ' and 3 ' between terminal sequence, make the amplified production of the chimeric special primer of described internal reference and internal reference than the product length corresponding to section to be measured in multiple competitive PCR product or reference section or short 1-6bp;

(3) carry out pcr amplification with the chimeric special primer of described internal reference to section to be measured or reference section template and prepare internal reference diluent, PCR primer DNA is quantitative, dilution, directly uses as internal reference template;

(4) with one to five kind of restriction enzyme, target section is digested;

(5) multiple competitive PCR reaction:

A () mixes containing section to be measured with reference to the sample to be tested of section and check sample and internal reference diluent and multiple competitive PCR reaction reagent, carry out PCR, in front 3 ~ 16 circulations, annealing temperature is higher than the annealing temperature of described universal fluorescent primer, for the amplification that described chimeric special primer guides, in rear 17 ~ 20 circulations, annealing temperature is lower than the annealing temperature of described universal fluorescent primer, for the amplification that described universal primer guides, and gap >=5 DEG C of two groups of annealing temperatures;

B () is different according to fluorescent mark pcr amplification product length, detect amplified production fragment, obtains the length information of section to be measured and reference section and internal reference amplified production fragment in sample to be tested and corresponding fluorescence intensity information;

(6) data analysis:

I. calculate each section to be measured and with reference to the sample peak height of section and/or the peak height of peak area (S) and corresponding internal reference and/or peak area (I), obtain the ratio (S/I) of each section to be measured and reference section;

Ii for standard with the ratio with reference to section, makes ratio by all sections to be measured with reference to the ratio of section with it, carries out data interconnects mark;

Iii. according to the step of i and ii, check sample is carried out data interconnects mark;

Iv. the inside markization value of sample to be tested and check sample is made ratio, obtain the ratio of sample to be tested and check sample, this ratio is multiplied by the copy number of check sample, obtains the copy number of sample to be tested

One of optimal way of technique scheme is, described universal fluorescent primer length scope is 18 ~ 20bp.

Two of the optimal way of technique scheme is, described chimeric special primer and be describedly respectively 38 ~ 45bp with reference to primer length scope.

Three of the optimal way of technique scheme is that the length range of the amplified production that described multiple PCR primer is corresponding is 120 ~ 2000bp, and the described difference in length detected is 8 ~ 50bp.

Four of the optimal way of technique scheme is that the DNA molecular number of described sample differs within the scope of 10 times with the DNA molecular number of described internal reference diluent.Preferably, described internal reference diluent is that the described internal reference PCR primer DNA of concentration 10ng/ μ L dilutes 1,000,000 times.

Five of the optimal way of technique scheme is that the consumption of described restriction enzyme is often kind of restriction endonuclease 0.5U/5ng STb gene amount/1 μ L reaction system.

Six of the optimal way of technique scheme is, described multiple competitive PCR primer containing a pair universal fluorescent primer or those skilled in the art four look fluorescence detecting systems by existing four look fluorescent labelling techniques and ABI sequenator (as 3130/3730) etc., can easily the embodiment of blue-fluorescence mark universal fluorescent primer of the present invention be extended to two couple of dichromatism, three looks or four color markers, three to or four pairs of universal fluorescent primers; In multiple PCR technique field, what as many as tens was right realizes independently amplified reaction respectively without the primer pair of homology in sequence in same PCR reaction system is also routine techniques.As another kind of embodiment, described multiple competitive PCR primer is made up of with reference to primer the chimeric special primer and a pair to six for identical or different testing gene a pair universal fluorescent primer, a pair to two ten.Identical with the above-mentioned description about multiple PCR technique field, prior art provide more than 20 to, 30 to so that more multipair primer in same PCR reaction system, realize the principle of independently amplified reaction, scheme and concrete operations respectively instruct; The specific embodiment of the present invention is under such technical background, and should not be regarded as the restriction to other embodiments, namely prior art intactly provides the necessary and sufficient conditions realizing other embodiments.

Two of technical scheme of the present invention is to provide a kind of test kit detecting copy number variation method based on above-mentioned multiple competitive PCR, comprises at least one pair of universal fluorescent primer, at least one pair of is positioned at the chimeric special primer of testing gene upstream and downstream and the reaction reagent of at least one pair of chimeric special primer with reference to primer, at least one pair of internal reference or the internal reference diluent after quantitatively diluting and at least one restriction enzyme and/or multiple competitive PCR.

beneficial effect

The invention provides that the cost lacked in prior art document is low, flux is high, suitability is good, scheme Time Created is short, realize the CNVs detection method that high-density the same as MLPA cover.

The present invention is surprisingly found out that and has the following advantages:

1, cost is low.For all detection site, apply universal fluorescent primer, and adopt same reference section, these measures all greatly reduce experimental cost.

2, internal reference preparation time is short, eliminates clone, and a series of preparation process of amplification etc., as long as a PCR just can have been prepared.

3, by one or more endonuclease digestion, make object fragment be digested to independently small segment, because these independent segments do not interfere with each other mutually, therefore can realize high-density in detection fragment and cover.

4, data are more accurate.Because the detection fragment of PCR primer internal reference and digestion with restriction enzyme is all small segment, make pcr amplification efficiency more consistent.In addition for the fragment of high GC, also because template is all small segment, the impact of this factor does not also exist.

Experimental period is short.Relative to MLPA technology (needing two days), in one day, just experimental result can be obtained.Can detect the multiple gene of a small amount of sample simultaneously, substantially reduce experimental period, improve conventional efficient.

Accompanying drawing explanation

Fig. 1 is the test-results of the multiplex PCR of a reference section and three target sections.

Fig. 2 is that the principle schematic of the test of the multiplex PCR of Fig. 1 (relates to two groups of primers: one group is that multiple upstream and downstream is fitted together to special primer in analytic process; Another group is fluorescent universal primer).

Fig. 3 is pattern detection result schematic diagram in embodiment 1.

Embodiment

Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.In addition should be understood that those skilled in the art can make various changes or modifications the present invention, and these equivalent form of values fall within the application's appended claims limited range equally after the content of having read the present invention's instruction.

Embodiment 1

Utilize method of the present invention to VIPR2 constant gene segment C (GeneBank sequence number NT_007741) and No. 10, No. 5 karyomit(e)s have carried out the detection of copy number with reference to section (GeneBank sequence number NT_030059, NT_006576), wherein selectional restriction restriction endonuclease BamHI and HindIII, and on VIPR2 constant gene segment C, continuous design 3 PCR detect.

Experimental procedure:

1, universal fluorescent primer, be positioned at the design of the chimeric special primer of testing gene upstream and downstream:

The design of universal fluorescent primer: principle of design ensures TM value≤57 DEG C of upstream and downstream primer, and gap is no more than 3 DEG C, for mouse and human genome special, primer interaction is little, and upstream is general draws 5 ' end Fam fluorescent mark.Universal primer sequence is upstream: 5 '-TTCATCCGTTCGTCCTAC-3 '; Downstream: 5 '-ACAGCGTCAATCTCGTTC-3 '.

The design of chimeric special primer: we have selected 1 target gene VIPR2 and 2 ginseng constant gene segment C, devise 5 pairs of special primers altogether, and be combined into special primer with universal primer, and insert ct two bases at 3 ' end of universal primer, require TM value >=62 DEG C, the length of amplified production is between 120 ~ 400bp.All primers all through the analysis of Blast and Oligo mask software, thus reduce non-specific amplification and primer dimer.

Sequence containing the VIPR2 of section to be measured is as follows, and restriction enzyme TaqI and BamHI carries out double digestion, and in sequence, restriction enzyme site italic underscore represents.The specific sequence district that multiplex PCR is fitted together to special primer represents with two line.

>VIPR2 sequence (5 '-3 ')

CAGGGCAGGGCCGGGTGGTCGGGCCCCAGCACACGGCTCGGGGAGCCTCCCACACTTGGTGATCCCGAGCCCTCAGTCTGCTGGTGGTGGTGC TCGAGAACTGTGGCTTACAGTGCGGGTGGGC GTGGAGGGCAAGGACTGGGGCCATTGCTCCTTGATACACTGTGGATGAAACCCTTTACTCAGTGAAGACCTAAGACTCCCCCAGGCCTGAAAGCTGGTCTTGGCAGGAAGAGGACACAGACGGGAAGACCTTGG GGCTGGCTTATCTGCTTCAGGATCTGACTGCAGCAGGTGAGACCCCAAATAAAGGCCCAGACCATGGCCACGGCTGGTGCGGCCCCTTGGGCTCCAGGTCCAGATGAGATGCAGCTGCTCAGCAGTGCCCAGGGCTGCCCTAGAGCCCTCTGGTCCGCAGAGCCCTTCTCCTCCCAGGGGCTCCCACACCCACATCTCTGCTGATTCCCTCACACATGTAGCCAAGTCTGTGGCTTCTGTGGAGGCTAATTTTTTTTC TCGAATTTAATTAATT TCGAAAACAATAAACAATAATGATTGCACACACAACACCCAGGGCAGACTTTGGCCCTGTGCAAGCAGGAAACACAACTAAAAATGTG GCCTGATGGGACGAAGCGTGAGCTCCGGGCAGGAGAAACTCTGTTCAGTTCAGCTCCCAGGCAGCCCTGCGCTCGCCGGTGGGCAGAGCCGGCCCAGGACCGTGCATGTCCACCCCGTGGCTGCCTGGGGCCTGTTCTGGTGCTTGCAGCCTCCAGAGCCGCCTGTGCTATGTGCTGTT CCCTAAACCAACCAAGTATTCAAAGTATTCAACGAGCAGAAACTGCAACAGGAAGAAAAATTATTCATTTTGGTTTTGTGCCATCCTTTTCTTTGCTTTCTCACTTTAAAATATTTTGACTTTCTAATCCCTTAGCAGTGAATATGCACTTATAATATTTGCAGAATCTCTGAAATGTTTAATTAAGAAGAAAAATAGTTCTTCAGACTAAACAGCAAAGCATCAGGGGATCACAGAGCCACTATGCTCACGCAGGCAGGGTTTACTTACAGGCC TCGATGAAGGACCAGTGGACCC CCTGGGATGCCTCACAGGGTGTGCCCAGGAGGAGACAGGAGATAAGGAGCTTGGGCATGACTCTGTGGGCTGACATTGCCACAGCAGGCGGCGGCTGTCACTGCCTCCCAGATCCACATCACTCTTTATAACCCAGGCTGGGGCTCAGAAAGGAGGTTCCCAGGGAATGCTTATTGAATAAAGGAAGGAGAGAATGAACGACGGAGCCT GTGACGCTGCTGGGGGCCTTGGTCTCTGCTCTTCACCAGCACCTCTGTCCTAATGTCTCCCAGGCACAGTTGCCGGCTAGGTGCAGACGAAGATGAAGACTCAGAGGTGGTGCCTCCAACACACCGG GGATCCCACCTGGACCTTGAAATCCCCCCCAGGCCACAGAAGCCCCTGAGACCCCTGG

>10 chromosome sequence (5 '-3 ')

TCTCAGCCTCCCAAGTAGCTGGAAATACAGGCATGTGCCACCATGCCCAGCTAATTTTGTATTTTTAGTAAAGATGGAGTTTCTTCATGTTGGCCAGGTTGGTCTCAAA ACCTGCCTTGGCCTCCCAAAGTGCTCGGATTACAGGCATGAGTCACTGCACCTGGCATATAGATACCATTTTAAATGAGACATTTAAATAAATTACAGACACCATCACACTTCATCCCT CCTATACGTAAGGGCATTTTCCTGTGAAACAATAATACCATTATCATACCTAAGAAAATTAATGTTAAGTCACCATTGTTACCTAATATGTGCAGTCCATAGTAACATTTCCCCAATTTTCCCAATGGTGTCTCTTGTAACTCTTTTTGT

>5 chromosome sequence (5 '-3 ')

AGTCACCCAGGACAAAGCTGAGGATTCTTTATTTTTTATAAGTTTCAAAAATTTAAAGTCTAGATGAAAACTTCTCTGAAACATCCTAGATTTCTTGAATAGATATGCTCACGTTATGCTAAGGTTTGTAATATATTGTGCTAAAGTAGATGCAAAATGAAGCAAACACTATAG CACTGCTGTACTAGGATTGTCTTATTCAATTTACTTAAGGTCTATGGTTATCTGATTCTACCGTTTAAGAAGCAGAAGCTAAGGAGACAACAAGTCAAACATACAGTTCTGGAAAATAAGTTATTAAACATATTTCTGATGTTCTATATGGGTACTGTCACCAGAGAAAGACTAGAAAAGGTTCTCTGGGATTTAGGTTTTACCACTGTGTATTAGATAGGCCATAATAATATATTGCATTATAACCTTCTTATCACTGTAGAAAGAACTGTCATCTTCAAAATAGGTTCTGCCTGACCTTTCCTC CTCTTGGCCTTACAGGGTTATCATTCTGAGCTAAAGATAGTCATCTGTACCTAAGCAGTGACATTCTATGTGGAAAGCCATAAGACAAGGCTGCTTCATTGCGGACCTCTCCACCAGCAGGGTGTGTTGTTC

Table one target section and the chimeric specific primer sequences with reference to section

2, internal reference fragment is prepared:

Get a sample for reference, divide plate to be substance PCR with internal reference primer, after completing PCR, survey OD value, mix according to the concentration equal proportion of each PCR primer 10ng/ μ L, be diluted to 1,000,000 times.

Table two (1) internal reference PCR reaction system

Component	Volume (μ L)	Final concentration
			ddH ₂O	Supply 10
10 × PCR Buffer(is containing 15mM Mg ²⁺）	1	1×
			25mM Mg ²⁺	0.6	3mM
The each 2.5mM of dNTP mix()	2	Each 500 μMs
			Primers(0.5μM)	2	Generally each 0.5 μM
HotStarTaq DNA Polymerase(5units/μL)	0.2	1unit/ reacts
			Templates(15ng/μL）	2	30g/ reacts

Table two (2) internal reference PCR Thermal cycling conditions

Step	Temperature (DEG C)	Time (min)
			1	95	15
2	94	0.5
			3	59	2
4	65	2
			5	Repeats steps 2-4，35 cycles
6	68	20

3, the reaction process of multiple competitive PCR

(1) sample DNA (sample to be tested and check sample) ultraviolet is quantitative, and it is for subsequent use to be diluted to 30ng/ μ L, the volumetric molar concentration such as sample DNA and internal reference is mixed.

(2) mix all chimeric special primers, and concentration is adjusted to 0.5 μM, universal primer dilution is 20 μMs, by universal primer and the mixing of chimeric special primer equal proportion.

(3) multi-PRC reaction system and response procedures

Table three (1) multi-PRC reaction system

Component	Volume (μ L)	Final concentration
			ddH ₂O	Supply 10
10 × PCR Buffer(is containing 15mM Mg ²⁺）	1	1×
			25mM Mg ²⁺	0.6	3mM
The each 2.5mM of dNTP mix()	2	Each 500 μMs
			Primers(20μM，0.5μM)	2	Generally each 0.2 μM
HotStarTaq DNA Polymerase(5units/μL)	0.2	1unit/ reacts
			Templates(15ng/μL）	2	31g/ reacts

Table three (2) multiplex PCR Thermal cycling conditions

Step	Temperature (DEG C)	Time (min)
			1	95	15
2	94	0.5
			3	59	2
4	65	2
			5	Repeats steps 2-4，9cycles
6	95	15
			7	94	0.5
8	52	1.5
			9	68	1.5
10	Repeats steps 6-9,20cycles
			6	68	20

(4) get 1 μ L PCR primer and dilute 16 times, therefrom get 1 μ L, add the Hi-Di of 8.6 μ L and the DNA molecular standard of 0.4 μ L.Said mixture 95 DEG C, sex change 5min, then rapid ice-water bath 2min, centrifugal rear ABI sequenator 3730 detects.

4, data analysis:

3730 sequenator detected result warps with software v3.2 software analysis obtains product size, the data such as peak height, peak area.Product size is drawn by DNA molecular standard, peak height or the peak area amount judging PCR primer.

Table three data analysis

Sample	10	5	VIPR2-1	VIPR2-2	VIPR2-3
						Sample for reference	1	1	1	1	1
Sudden change sample	1	0.992	1.453	1.554	1.533

No. 10, the PCR fragment on No. 5 karyomit(e)s is two references.During data interconnects mark, using No. 10 karyomit(e) PCR as standard, using sample for reference as standard during data external mark.

For sudden change sample, its VIPR2 gene copy number is 3; So the result display of VIPR2-1, VIPR2-2 and VIPR2-3 should 1.5, and No. 5 chromosomal copy numbers are 2, thus its display result the same with No. 10 karyomit(e) results be 1.

Claims

1. one kind is detected the test kit of copy number variation based on multiple competitive PCR, comprise at least one pair of universal fluorescent primer, at least one pair of is positioned at the chimeric special primer of testing gene upstream and downstream and the reaction reagent of at least one pair of chimeric special primer with reference to primer, a pair internal reference, at least one restriction enzyme and multiple competitive PCR, the detection method that described test kit adopts comprises the following steps:

Described chimeric special primer is for section to be measured with reference to section design, TM value >=62 DEG C, length range is 28 ~ 50bp, 3 ' end is the specific primer sequences of 18 ~ 25bp, 5 ' end is described universal primer sequence, inserts the fixed Combination of two bases between described 3 ' end and 5 ' two sequences of holding; The difference of the TM value between all chimeric special primers is no more than 3 DEG C; When there being two pairs or more, described reference design of primers on different reference sections, and is mated without specificity with testing gene;

(2) the chimeric special primer of a pair internal reference is provided, for section to be measured or with reference to section design, its amplified production than section to be measured in multiple competitive PCR product or with reference to the product length corresponding to section or short 1 ~ 6bp, and is made up of three parts: hold multiple PCR primer district with 3 ' terminal specific primer sequence identical 5 ' of the chimeric special primer described in (1); Identical with the sequence of the chimeric special primer downstream 18 ~ 25bp described in (1), and TM value >=62 DEG C, the difference of TM value is no more than the 3 ' terminal sequence of 3 DEG C between primer; It is the length adjustment sequence of-3 ~ 3bp between described 5 ' end multiple PCR primer district and described 3 ' terminal sequence, namely hold at 5 ' end and 3 ' and to insert any base of 1 ~ 3bp between two sequences respectively or delete 1 ~ 3bp base respectively by 3 ' end 5 ' and 3 ' between terminal sequence, make the amplified production of the chimeric special primer of described internal reference and internal reference than the product length corresponding to section to be measured in multiple competitive PCR product or reference section or short 1-6bp;

(4) with one to five kind of restriction enzyme, target section is digested;

(5) multiple competitive PCR reaction:

(6) data analysis:

Ii. with a ratio with reference to section for standard, make ratio by all sections to be measured with reference to the ratio of section with it, carry out data interconnects mark;

Iv. the inside markization value of sample to be tested and check sample is made ratio, obtain the ratio of sample to be tested and check sample, this ratio is multiplied by the copy number of check sample, obtains the copy number of sample to be tested.

2. multiple competitive PCR according to claim 1 detects the test kit of copy number variation, and it is characterized in that, described universal fluorescent primer length scope is 18 ~ 20bp.

3. multiple competitive PCR according to claim 1 detects the test kit of copy number variation, it is characterized in that, described chimeric special primer and described reference primer length scope are respectively 38 ~ 45bp.

4. multiple competitive PCR according to claim 1 detects the test kit of copy number variation, and it is characterized in that, the length range of the amplified production that described multiple PCR primer is corresponding is 120 ~ 2000bp, and the described difference in length detected is 8 ~ 50bp.

5. multiple competitive PCR according to claim 1 detects the test kit of copy number variation, it is characterized in that, in described multiple competitive PCR reaction, the DNA molecular number of described sample to be tested and described check sample differs within the scope of 10 times with the DNA molecular number of described internal reference diluent.

6. multiple competitive PCR according to claim 5 detects the test kit of copy number variation, it is characterized in that, described internal reference diluent is that the described internal reference PCR primer DNA of concentration 10ng/ μ L dilutes 1,000,000 times.

7. multiple competitive PCR according to claim 1 detects the test kit of copy number variation, and it is characterized in that, the consumption of described restriction enzyme is often kind of restriction endonuclease 0.5U/5ng STb gene amount/1 μ L reaction system.

8. multiple competitive PCR according to claim 1 detects the test kit of copy number variation, it is characterized in that, described multiple competitive PCR primer containing a pair universal fluorescent primer or two to, three to or four to the fluorescently-labeled universal fluorescent primer of difference.

9. multiple competitive PCR according to claim 8 detects the test kit of copy number variation, it is characterized in that, described multiple competitive PCR primer is made up of with reference to primer the chimeric special primer and a pair to six for identical or different testing gene a pair universal fluorescent primer, a pair to two ten.