CN102978280A

CN102978280A - Method for detecting copy number variation based on PCR-LDR technology

Info

Publication number: CN102978280A
Application number: CN2012104321036A
Authority: CN
Inventors: 陆炯; 肖君华; 陈轶群
Original assignee: SHANGHAI YIHE APPLICATION BIO-TECH Co Ltd
Current assignee: SHANGHAI YIHE APPLICATION BIO-TECH Co Ltd
Priority date: 2012-11-01
Filing date: 2012-11-01
Publication date: 2013-03-20

Abstract

The invention relates to a method for detecting the copy number variation based on multiple competitive PCR of universal fluorescence primers. The method comprises the following steps: 1, providing multiple competitive PCR primers composed of at least one pair of primers in a section to be detected and at least one pair of primers in a reference section; 2, providing a competitive internal control template, wherein there is only one base replacement between the sequence of the internal control template and an actual sequence; 3, carrying out a multiple competitive PCR reaction; 4, carrying out an LDR reaction; and 5, carrying out data analysis. The invention also provides a kit based on the detection method. The kit is suitable for detecting the copy number variation of 5-25 genes/reactions, and is a copy number variation detection scheme having the advantages of rapidness, medium flux and economy.

Description

The method of the detection copy number variation of a kind of PCR-based-LDR technology

Technical field

The present invention relates to biological technical field, relate in particular to the method based on multiple competitive PCR and the variation of LDR technology for detection copy number, be applied to bio-science research and clinical molecular diagnosis.

Background technology

Copy number variation (copy number variations, CNVs) is the new form of the genome diversity of discovered in recent years, and it refers to compare with reference sequences, the structure variation phenomenon of the dna fragmentation of 1kb ~ 3Mb in the genome.CNVs extensively is stored in the genome, and is relevant with the generation of some heredopathias, and the variations such as human disease resistance and susceptibility phenotype are had material impact.This just requires to set up a kind of fast, accurately and cheaply CNVs somatotype detection technique.

Along with the development of biotechnology, different research groups has developed many detection methods in succession, mainly comprise hybridizing be the basis and take PCR as the basis detection technique.The former can detect CNVs on full genomic level, and the representative technology has the hybridization of microarray icp gene (SolinasToldo, Lampel et al Genes Chromosomes Cancer.1997Dec; 20 (4): 399-407), full genome SNP chip (Irving, Bloodworth et al.Cancer Res.2005Apr15; 65 (8): 3053-8), representative oligonucleotide microarray technique (Lucito, Healy et al.Genome Res.2003Oct; 13 (10): 2291-305.Epub2003Sep15.) etc., its advantage is the flux height and easily is automated, but the shortcoming that ubiquity resolving power is low, cost is high and the cycle is long.The latter detects for concrete target site, and representational technology has real-time fluorescence quantitative PCR, multiple linking probe amplification technique (MLPA) (Schouten, McElgunn et al.Nucleic Acids Res.2002Jun15; 30 (12): but e57) hybridize (MAPH) (Armour, Sismani et al.Nucleic Acids Res.2000Jan15 with multiple amplification probe; 28 (2): 605-9.) etc.The advantages such as that the real time fluorescent quantitative technology has is simple to operate, good reproducibility, experimental period are short, but it is less to detect flux; Compare with real-time fluorescence quantitative PCR, the detection flux of MLPA and MAPH has had large increase, but the variation of PCR microenvironment can cause different loci not increase by Complete Synchronization, and the platform effect of PCR also can affect detected result.Take PCR as the basis detection technique exist a common defective be exactly sample to be tested and check sample be separate detection, the difference of both PCR efficient can cause the deviation of detected result like this.

Competitive PCR has overcome this defective, realizes quick, accurate, the economic detection of CNVs.In the pcr amplification process, the amount of PCR product can be used formula Y=A(1+R) ⁿRepresent that its Y represents the amount of PCR product, A represents the amount of original template, and R represents the amplification efficiency of PCR, and n represents the cycle number of PCR, and when pcr amplification efficient was identical, the amount of PCR product was directly proportional with the amount of original template.Competitive PCR has utilized this principle, in same PCR reaction system, relate to two groups of templates, one group is sample to be tested, another group is the one section nucleotide sequence that synthesizes, as internal reference, two groups of templates only on target sequence length (insertion or the disappearance that have some bases) have some differences, other reaction conditionss are consistent, therefore both amplification efficiencies approach consistent, the ratio of two kinds of amplified production amounts has reflected the ratio of original template (there are not copy number difference in sample to be tested and internal reference) amount intuitively, can calculate according to the amount of the original template of internal reference the concentration of sample to be tested.When detecting the copy number variation, when two templates had identical concentration or eliminated affecting that concentration difference brings, the ratio of PCR product amount just reflected the difference of template copy number.PRT method (Paralogue Ratio Test) (Armour, Palla et al.Nucleic Acids Res.2007; 35 (3): e19.Epub2006Dec14) be based on a kind of method of a kind of CVNs of detection of competitive PCR, the advantage of this method is that site to be measured and internal reference coexist as in the genome sequence, but shortcoming also is clearly, can only detect for limited gene locus, and all to design a pair of fluorescent primer for different detection site, strengthened experimental cost.

For some quantitative techniques based on multiple competitive PCR, because the necessary energy of the length of its PCR product sharp separation, this design to the PCR product has proposed higher requirement.The situation close for some PCR product length then can't detect.The present invention utilizes the LDR technology exactly, and the length of PCR product is not claimed, and has solved the difficult point of multiplex PCR design.

Summary of the invention

Technical problem to be solved

The technical problem to be solved in the present invention is the problem that overcomes some multiple competitive PCR product Design of length difficult points of prior art, and the CNVs that a kind of cost is low, flux is high, the sample demand is low, detection sensitivity is high, popularization degree is wide detection method is provided.

Technical scheme

In summing up prior art on the relative merits basis of various detection methods, the contriver is through the autonomous innovation research and development, be surprisingly found out that successfully to solve the problems of the technologies described above by following design, and be successfully applied to the fields such as bio-science research and clinical molecular diagnosis.Purpose of the present invention is achieved through the following technical solutions:

One of technical scheme of the present invention provides the method for a kind of multiple competitive PCR and the variation of LDR joint-detection copy number, may further comprise the steps:

(1) provide multiple competitive PCR primer: described multiple competitive PCR primer is by forming with reference to the section primer for section to be measured with reference at least one pair of section primer to be measured of section design and at least one pair of respectively, TM value 〉=62 ℃, length range is 18 ~ 50bp, and the intersegmental difference in length of different amplified production sheets that described multiple competitive PCR primer produces does not require;

(2) provide the internal reference sequence: compare only sequence of replacing the difference of base by synthetic one of full gene synthesis method with one of amplified production fragment of described multiple competitive PCR, and the position of described replacement base is not at PBR; Perhaps by the carrier cloning method with the PCR product cloning to plasmid, and import Substitution in certain base, and the position of the base of described Substitution is not at PBR;

(3) multiple competitive PCR reaction: will contain section to be measured and mix with the diluent of described internal reference respectively with reference to the sample to be tested of section and check sample, the dna molecular number of described sample to be tested and described check sample differs in 10 times of scopes with the dna molecular number of described internal reference diluent respectively, carries out multiple competitive PCR reaction;

(4) multi-LDR sequencing reaction: the product of getting described multiple competitive PCR reaction mixes with the LDR reaction system that contains described order-checking probe, carries out the LDR sequencing reaction;

(5) LDR order-checking product electrophoretic separation: the product to described LDR sequencing reaction carries out electrophoretic separation, the principle of utilizing the LDR sequencing reaction single base difference to be transformed into sequence length difference distinguishes described sample to be tested or described check sample respectively with the internal reference product, and utilize concentration and the linear principle of template concentrations of LDR order-checking product, obtain respectively described sample to be tested by detecting the concentration of LDR order-checking product after electrophoretic separation, described check sample, with the relative concentration of corresponding each template of described internal reference, described relative concentration represents with peak height and/or the peak area of electrophoretic separation fragment;

(6) data analysis

I. make ratio with each section to be measured with reference to the peak height of section and/or peak height and/or the peak area (I) of peak area (S) and internal reference, obtain each section to be measured and with reference to the ratio (S/I) of section;

Ii makes ratio with it take the ratio with reference to section as standard respectively with other sections to be measured with reference to the ratio of section, carries out the standard laid down by the ministries or commissions of the Central Government in the data;

Iii. the interior standard laid down by the ministries or commissions of the Central Government value of sample to be tested and check sample is made ratio, obtain the ratio of sample to be tested and check sample, this ratio multiply by the copy number of check sample, obtains the copy number of sample to be tested.

One of optimal way of technique scheme is, described section primer to be measured and described length range with reference to the section primer are 38 ~ 45bp.

Two of the optimal way of technique scheme is that the length range of the amplified production that described multiple PCR primer is corresponding is 120 ~ 1000bp.

Three of the optimal way of technique scheme is that the length range of the product that described LDR order-checking probe is corresponding is 70 ~ 200bp.

Four of the optimal way of technique scheme is that described multiple competitive PCR primer contains one to 25 pair for the section primer to be measured of different testing genes.As another kind of embodiment, described multiple competitive PCR primer by a pair of to 20 pairs for the section primer to be measured of different testing genes with a pair ofly form with reference to primer to six pairs.As another embodiment, described multiple competitive PCR primer by a pair of to ten pairs for the section primer to be measured of different testing genes with a pair ofly form with reference to primer to three pairs.

In the multiple PCR technique field, tens pairs of as many as on the sequence without the primer of homology to realizing respectively that in same PCR reaction system independently amplified reaction has been routine techniques.Prior art also provides more than 20 pairs, 30 pairs and even more primer has been realized respectively that in same PCR reaction system principle, scheme and the concrete operations of amplified reaction independently instruct, and namely prior art intactly provides the necessary and sufficient conditions of realizing other embodiments; The specific embodiment of the present invention or embodiment should not be regarded as the restriction to other embodiments under such technical background.

Five of the optimal way of technique scheme is that described order-checking probe is by four look fluorescent marks.As one of embodiment, described order-checking probe is by blue-fluorescence FAM mark.

Those skilled in the art is by four look fluorescence detecting systems of existing four look fluorescent mark technology and ABI sequenator (such as 3130/3730) etc., can easily the embodiment of blue-fluorescence FAM label L DR order-checking probe of the present invention be extended to the fluorescent probe of dichromatism, three looks or four color markers, to support 25 pairs and even the sequencing analysis of the heavy competitive PCR primer of multi-to-multi more, the copy number of finishing 25 and even how different testing genes detects.

Two of technical scheme of the present invention is a kind of test kits based on aforesaid method, comprise provide multiple competitive PCR primer by at least one pair of section primer to be measured and at least one pair of with reference to the section primer form, the reagent of the reaction of quantitative internal reference DNA, LDR fluorescent mark order-checking probe and/or multiple competitive PCR and/or the reagent of LDR sequencing reaction.

Three of technical scheme of the present invention provides the application of above-mentioned test kit in detecting the variation of Human genome copy number.

Beneficial effect

The present invention passes through the ingehious design detection scheme, has the following advantages astoundingly:

When 1, multiple competitive PCR designs primer and product, do not need to consider to separate different products and design the product difference in length.

2, suitability is wide.All sequenators based on capillary electrophoresis all are suitable for.

If 3 utilize other species of primates and human sequence high homology, start with from the nucleic acid-templated of primates, can prepare fast internal reference by the PCR cloning.

4, experimental period is short.With respect to MLPA technology (needs two days), just can obtain experimental result in one day.Can detect simultaneously a plurality of genes of a small amount of sample, greatly shorten experimental period, improve conventional efficient.

Description of drawings

Fig. 1 be one with reference to the test-results of the multiplex PCR of section and three target sections.R is with reference to section; 1,2,3 is 3 detector segments.

Fig. 2 is the ultimate principle diagram of LDR technology.

Fig. 3 is pattern detection result schematic diagram among the embodiment 1.

Embodiment

Below in conjunction with specific embodiment, further illustrate the present invention, should be understood that embodiment only is used for explanation the present invention and is not used in and limits the scope of the invention.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read the content that the present invention lectures, these equivalent form of values have and fall within equally the application's appended claims limited range.

Embodiment 1

Utilize method of the present invention that VIPR2 constant gene segment C (GeneBank sequence number NT_007741) and No. 10 karyomit(e)s, No. 5 karyomit(e)s (GeneBank sequence number NT_030059, NT_006576) have upward been carried out the detection of copy number with reference to section, wherein 3 PCR detector segments of design in the constant gene segment C of VIPR2.

1, the design of multiple PCR primer:

The design of multiple PCR primer: select us to design altogether 5 pairs of special primers according to section to be measured with reference to section, require TM value 〉=62 ℃, the length of amplified production is between 100 ~ 500bp.All primers all pass through the analysis of Blast and Oligo mask software, thereby reduce non-specific amplification and primer dimer.

The sequence of multiple competitive PCR primer represents with underscore in the sequence, and the connection site base represents with the italic lowercase character.

Designed nucleotide sequence is as follows:

No. 10 chromosome segments (5 '-3 ')

TCTCAGCCTCCCAAGTAGCTGGAAATACAGGCATGTGCCACCATGCCCAGCTAA

TTTTGTATTTTTAGTAAAGATGGAGTTTCTTCATGTTGGCCAGGTTGGTCTCA?A?A

ACCTGCCTTGGCCTCCCAAAGTGCTCGGATTACAG

GCATGAGTCACTGCACCTG gCATATAGATACCATTTTAAATGAGACATTTAAAT

AAATTACAGACACCATCACACTTCATCCCT

CTAT

ACGTAAGGGCATTTTCCTGTGAAACAATAATACCATTATCATACCTAAGAAAAT

TAATGTTAAGTCACCATTGTTACCTAATATGTGCAGTCCATAGTAACATTTCCCC

AATTTTCCCAATGGTGTCTCTTGTAACTCTTTTTGT

No. 5 chromosome segments (5 '-3 ')

CTAGATGAAAACTTCTCTGAAACATCCTAGATTTCTTGAATAGATATGCTCACGT

TATGCTAAGGTTTGTAATATATTGTGCTAAAGTAGATGCAAAATGAAGCAAACA

CTATAG

CACTGCTGTACTAGGATTGTCTTATTCAA

TTTACTTAAGGTCTATGGTTATCTGATTCTACCGTTTAAGAAGCAGAAGCTAAG

GAGACAACAAGTCAAACATACAGTTCTGGAAAATAAGTTATTAAACATATTTCT

GATGTTCTATAT gGGTACTGTCACCAGAGAAAGACTAGAAAAGGTTCTCTGGGA

TTTAGGTTTTACCACTGTGTATTAGATAGGCCATAATAATATATTGCATTATAAC

CTTCTTATCACTGTAGAAAGAACTGTCATCTTCAAAATAGGTTCTGCCTGACCTT

TCCTC

CTCTTGGCCTTACAGGGTTATCATTCTG

AGCTAAAGATAGTCATCTGTACCTAAGCAGTGACATTCTATGTGGA

VIPR2-1 fragment (5 '-3 ')

AGAGTTTCAACCCCTGCCTGGGGCCACACACTCCTTCATGCAGAGCCTGGTGTG

CAGACCCTGCTGCCTTGGATGGTCCATCCTGGGTCAGGCACGTACCTCCCCTCCT

CCGGCATCGGCCAGCTCCATGCCCAGAAGCGCCTGGCGCACCGCTGTGTTTCCT

ACAGGTCCGCTGCCCTGTGCTGCAC

CATCCTTCCA

CCTTCCTGATCATGTGGACCTCTAATTCCTTCACCTTCATCTCCCTCCCATTAGG

AGAATCTT cCCTAGCGGATTCCTTTAGAACTTAAAGAACTTGGAGACCCAATCG

CCATCCCCAGG CCTTCTTAACCTCCTTCCCTGGT

CCCGTATCTCCTTTGGCCCTGAAAAGACTCATCCATTTATTTGGAAAGTATTAAG

CATCACATGCACAGGTTAAAACTAAACAGCAGAAAAGTGCTCATAATCCTGTCT

GGTTGTGCCAGGTGACAGCTGAATGATTTCTGCCTGTGGC

>VIPR2-2（5’-3’）

GATTATTTAGGGGAAAAATCTACATAATTCTTGCAGGGCAGGAGGGGGCTTCTG

GTGCAGTGTTAGGAAGTGGAACCTCACCACCGTAGCACCACGCAGGAGCCTAC

CTTGCTCTCATCCTCCGGGTCGCTGTAGCCACAGGCATCGACGAAAT

CCGTCACTCGTACAGTTTTTGCTTATGTTTCCTGGAAAGTGA

AGTTCAGATATTTTATCT gCAAGTCCATGAAAACTGGCCTTAGAAGGGACCTTA

GTCCGTGCTGAGCCCGTGCTCTATTAAAATGCTTCCCACACCCAGGGGTCAGCT

AGGAGACAGGACTGCCACTCAAAAAAC ATGTGAC

CTGGACAGCAGGTCACCTCTCGGGGCCGGTGGGTCCTGAGATGTGAGTGAACGC

ACTGTGTCATAAGTCATAATTACCGCAACTGTAAGTGTAGTTCTTTTGGGGCAG

AATGAAAATTCTTAACAGACTCTTAGGTTCTGCCACCAT

Table one primer sequence

Table two LDR probe sequence

* the physical location that checks order behind the electrophoresis can be less than normal than theoretical position, and this is the systematic error of instrument, does not affect the result

2, preparation internal reference fragment:

With full gene synthetic method design and the basically identical internal reference sequence of PCR product, unique difference is to have a base to be replaced.Different bases has the lowercase of bold Italic to represent, underscore is arranged down.

No. 10 karyomit(e) internal references (5 '-3 ')

TTCCTGACCTCAGGTGATCCACCTGCCTTGGCCTCCCAAAGTGCTCGGATTACAG

GCATGAGTCACTGCACCTG

CATATAGATACCATTTTAAATGAGACATTTAAATA

AATTACAGACACCATCACACTTCATCCCTCAATACTTCGGCATGGGTCT

No. 5 karyomit(e) internal references (5 '-3 ')

TGATCCTACTACACGGCAGACACTGCTGTACTAGGATTGTCTTATTCAATTTACT

TAAGGTCTATGGTTATCTGATTCTACCGTTTAAGAAGCAGAAGCTAAGGAGACA

ACAAGTCAAACATACAGTTCTGGAAAATAAGTTATTAAACATATTTCTGATGTT

CTATAT

GGTACTGTCACCAGAGAAAGACTAGAAAAGGTTCTCTGGGATTTAGG

TTTTACCACTGTGTATTAGATAGGCCATAATAATATATTGCATTATAACCTTCTT

ATCACTGTAGAAAGAACTGTCATCTTCAAAATAGGTTCTGCCTGACCTTTCCTCC

TATTGCCACACTCTAAAGCTG

VIPR2-1 internal reference (5 '-3 ')

ATCATCCTGGTGTGCTCCTCCATCCTTCCACCTTCCTGATCATGTGGACCTCTAA

TTCCTTCACCTTCATCTCCCTCCCATTAGGAGAATCTT

CCTAGCGGATTCCTTTA

GAACTTAAAGAACTTGGAGACCCAATCGCCATCCCCAGGCACCAGCGTATCTGT

GCATT

VIPR2-2 internal reference (5 '-3 ')

CTGGGAACGTCTCTGACCATCCGTCACTCGTACAGTTTTTGCTTATGTTTCCTGG

AAAGTGAAGTTCAGATATTTTATCT

CAAGTCCATGAAAACTGGCCTTAGAAGG

GACCTTAGTCCGTGCTGAGCCCGTGCTCTATTAAAATGCTTCCCACACCCAGGG

GTCAGCTAGGAGACAGGACTGCCACTCAAAAAACCTTCCTTGCCCTCCTAGTCC

3, the reaction process of multiple competitive PCR

(1) sample DNA (sample to be tested and check sample) ultraviolet is quantitative, and it is for subsequent use to be diluted to 30ng/ μ L, and the volumetric molar concentrations such as sample DNA and internal reference are mixed.

(2) mix all primers, and concentration is adjusted to 0.5 μ M.

(3) multi-PRC reaction system and response procedures

Table three (1) multi-PRC reaction system

Component	Volume (μ L)	Final concentration
			ddH ₂O	Supply 10
10 * PCR Buffer(contains 15mM Mg ²⁺）	1	1×
			25mM?Mg ²⁺	0.6	3mM
Each 2.5mM of dNTP mix()	2	Each 500 μ M
			Primers(0.5μM)	2	General each 0.2 μ M
HotStarTaq?DNA?Polymerase（5units/μL）	0.2	The 1unit/ reaction
			Templates(15ng/μL）	2	The 30g/ reaction

Table three (2) multiplex PCR temperature cycle condition

Step	Temperature (℃)	Time (min)
			1	95	15
2	94	0.5
			3	59	2
4	65	2
			5	Repeats?steps2-4，35cycles
6	68	20

(4) multi-LDR reaction system and response procedures are as follows:

Table four (1) multi-LDR reaction system

Component	Volume (μ L)	Final concentration
			ddH ₂O	Supply 10
10×LDR?Buffer	1	1×
			Probe(0.5μM)	1	General each 0.2 μ M
Taq?ligase（40units/μL）	0.5	The 2unit/ reaction
			The PCR product	1

Table four (2) multi-LDR temperature cycle condition

Step	Temperature (℃)	Time (min)
			1	92	2
2	94	0.5
			3	50	2
4	Repeats?steps2-4，30cycles

(5) get 1 μ L LDR product, add the dna molecular standard of Hi-Di and the 0.4 μ L of 8.6 μ L.95 ℃ of said mixtures, sex change 5min, rapid ice-water bath 2min then, centrifugal detect with ABI sequenator 3730 afterwards.

4, data analysis:

The detected result of the 3730 type DNA sequencers that American AB I company produces is through GeneScan

3.0 and ID software v3.2 software analysis obtains product clip size, the data such as peak height, peak area.The product clip size is drawn by the dna molecular standard, and peak height or peak area are in order to judge the amount of PCR product.

Table five data analysis

No. 10, the PCR fragment on No. 5 karyomit(e) is two references.In the data during standard laid down by the ministries or commissions of the Central Government, with No. 10 karyomit(e) PCR as standard; During the data external mark, with check sample as standard.

For the sudden change sample, its VIPR2 gene copy number is 3; Compare with No. 10 marking of karyomit(e) results rear and check sample, the result of VIPR2-1, VIPR2-2 shows that should be the 1.5(actual numerical value is 1.38 and 1.63), actual copy numerical digit 3 and No. 5 chromosomal copy numbers are 2, its markization ratio rear and check sample is 1, and the actual copy number is 2.

Claims

1. the method for a multiple competitive PCR and LDR joint-detection copy number variation may further comprise the steps:

(6) data analysis

2. the method for detection copy number according to claim 1 variation is characterized in that, described section primer to be measured and described length range with reference to the section primer are 38 ~ 45bp.

3. the method for detection copy number variation according to claim 1 is characterized in that the length range of the amplified production that described multiple PCR primer is corresponding is 120 ~ 1000bp.

4. the method for detection copy number variation according to claim 1 is characterized in that, the length range of the product that described LDR order-checking probe is corresponding is 70 ~ 200bp.

5. the method for detection copy number variation according to claim 1 is characterized in that described multiple competitive PCR primer contains one to 25 pair for the section primer to be measured of different testing genes.

6. the method for detection copy number according to claim 5 variation is characterized in that, described multiple competitive PCR primer by a pair of to 20 pairs for the section primer to be measured of different testing genes with a pair ofly form with reference to primer to six pairs.

7. the method for detection copy number according to claim 6 variation is characterized in that, described multiple competitive PCR primer by a pair of to ten pairs for the section primer to be measured of different testing genes with a pair ofly form with reference to primer to three pairs.

8. the method for detection copy number variation according to claim 1 is characterized in that described order-checking probe is by four look fluorescent marks.

9. test kit based on the method for detection copy number claimed in claim 1 variation, comprise provide multiple competitive PCR primer by at least one pair of section primer to be measured and at least one pair of with reference to the section primer form, the reagent of the reaction of quantitative internal reference DNA, LDR fluorescent mark order-checking probe and/or multiple competitive PCR and/or the reagent of LDR sequencing reaction.

10. the application of test kit claimed in claim 9 in detecting the variation of Human genome copy number.