CN102920748B - Application of cryptoporus volvatus in preparation of products for curing porcine reproductive and respiratory syndrome (PRRS) - Google Patents
Application of cryptoporus volvatus in preparation of products for curing porcine reproductive and respiratory syndrome (PRRS) Download PDFInfo
- Publication number
- CN102920748B CN102920748B CN201210461220.5A CN201210461220A CN102920748B CN 102920748 B CN102920748 B CN 102920748B CN 201210461220 A CN201210461220 A CN 201210461220A CN 102920748 B CN102920748 B CN 102920748B
- Authority
- CN
- China
- Prior art keywords
- pore fungi
- hidden pore
- prrsv
- strain
- respiratory syndrome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention discloses a new use of cryptoporus volvatus. The new use of cryptoporus volvatus, which is provided by the invention, is at least one from 1), 2), 3) and 4): 1), the application of cryptoporus volvatus or extract of cryptoporus volvatus to products (such as drugs) for curing a porcine reproductive and respiratory syndrome (PRRS); 2) the application of cryptoporus volvatus or the extract of cryptoporus volvatus to products (such as drugs) for increasing the survival rate of pigs infected with the PRRS; 3),the application of cryptoporus volvatus or the extract of cryptoporus volvatus to products (such as drugs) for reducing the virus titer of PRRS virus in serums of the pigs infected with the PRRS; and 4),the application of cryptoporus volvatus or the extract of cryptoporus volvatus to products (such as drugs) for reducing body temperature of the pigs infected with the PRRS.
Description
Technical field
The present invention relates to the new purposes of hidden pore fungi, the particularly application of hidden pore fungi in preparation treatment Porcine reproductive and respiratory syndrome product.
Background technology
Porcine reproductive and respiratory syndrome (being commonly called as reproductive and respiratory syndrome) (Porcine Reproductive and RespiratorySyndrome, PRRS) is the infectious disease of the pig that caused by porcine reproductive and respiratory syndrome virus (PRRS virus, PRRSV).This virus of the equal easy infection of pig at various ages, its cardinal symptom is to cause miscarriage, stillborn fetus, mummy tire and weak tire after in-pig infects, and infects piglet respiratory disorder and high case fatality rate can occur.This disease is in 1987 Nian U.S. reported first, and middle nineteen nineties in last century is imported China into.At present, this disease betides nearly all country of raising pigs in the world, for China and world's pig industry have caused great economic loss.The pathogenic Porcine reproductive and respiratory syndrome of the height being caused by PRRSV variant has been broken out in 2006 Nian China, its feature is that acute height is lethal, and piglet sickness rate can reach 100%, and mortality rate is up to 50%, sow abortion ratio reaches more than 35%, and sow and growing and fattening pigs mortality rate are up to 30%.The high Porcine reproductive and respiratory syndrome that causes a disease of this time outburst has caused huge economic loss to China's pig industry.
Porcine reproductive and respiratory syndrome is the viral infectious being caused by porcine reproductive and respiratory syndrome virus (PRRSV).PRRSV belongs to many viraleses of Buddhist nun Arteriviridae Arterivirus, for there being the single strand plus RNA virus of cyst membrane, the about 15.4kb of genome total length, virus is ripe in cytoplasm, endoplasmic reticulum and Golgi body assembling, and discharge and be gathered in cell intracellular vesicle with the form of sprouting, then transporte to cells film is discharged into extracellular, completes the virus replication cycle.
At present, prevention and control PRRS viral infection and propagation are main by vaccine, yet unsuccessful.For the vaccine of PRRS virus, comprise that attenuated vaccine and inactivated vaccine apply for many years, yet still occur with the vaccine strain reproductive and respiratory syndrome that almost consistent strain causes.Atypia or acute reproductive and respiratory syndrome break out immune swinery, and the pathogenic reproductive and respiratory syndrome of the height of 2006 Nian China outburst is queried to the protectiveness of current vaccine used and safety especially.Therefore, developing special, efficient anti-PRRS virus drugs has important practical significance to prevention and control reproductive and respiratory syndrome.
(Cryptoporus volvatus (Peck) Shear is a kind of wild macro fungi being born on pine forest trunk to hidden pore fungi, also on the trunk or dry wood of being born in old and feeble fir, PiceameyeriRehd. Et Wils. on the books, there is distribution in a plurality of provinces such as the Yunnan of China, Guangdong, Guangxi, Hainan.Hidden pore fungi sporophore is less, stockless or have once in a while handle, general adnation on base thing, suberin, oblate spheroid or subsphaeroidal, 1.5-3.5cm * 2-4.5cm, thick 1-3cm, cap surface is smooth, shallow khaki or dark eggshell color, old after light red brown.Edge is pure sliding and thick, is connected with velum.Velum white is white to dirt, and obviously different from cap tone, thick about 1mm.Tube layer is by velum institute clad, and the initial stage seals completely, after near base portion, occurring occasionally having two, aperture 2-4.5mm in a circle or rotund aperture gradually.Bacterial context is pure white to dirty white, soft suberin, thick 2-8mm.Tube is with bacterial context color, long 2-5mm, and the mouth of pipe is circular to nearly polygon, the light pink Lycoperdon polymorphum Vitt of mouth of pipe face or band brown, every millimeter 3-5, wall thickness, peristoma is complete.Spore is smooth, colourless, oblong, 10-13 μ m * 4-6 μ m.When weaning, Lijiang, yunnan children's Zeng Zuowei among the people sucks thing, or be decocted in water for oral dose treatment tracheitis and asthma.
Summary of the invention
Technical problem to be solved by this invention is to provide the new purposes of hidden pore fungi.
The new purposes of hidden pore fungi provided by the present invention is following 1)-8) at least one:
1) application of hidden pore fungi in preparation treatment Porcine reproductive and respiratory syndrome product (as medicine).
2) hidden pore fungi is improved the application in reproductive and respiratory syndrome viral infection pig survival rate product (as medicine) in preparation.
3) application in the product (as medicine) of hidden pore fungi virus titer of porcine reproductive and respiratory syndrome virus in preparation reduction porcine reproductive and respiratory syndrome virus infected pigs serum.
4) application of hidden pore fungi in the product (as medicine) of the body temperature of preparation reduction reproductive and respiratory syndrome viral infection pig.
5) application of hidden pore fungi extract in preparation treatment Porcine reproductive and respiratory syndrome product (as medicine), described hidden pore fungi extract is the water-soluble substances extracting from hidden pore fungi sporophore.
6) hidden pore fungi extract improves the application in reproductive and respiratory syndrome viral infection pig survival rate product (as medicine) in preparation, and described hidden pore fungi extract is the water-soluble substances extracting from hidden pore fungi sporophore.
7) application in the product (as medicine) of hidden pore fungi extract virus titer of porcine reproductive and respiratory syndrome virus in preparation reduction porcine reproductive and respiratory syndrome virus infected pigs serum, described hidden pore fungi extract is the water-soluble substances extracting from hidden pore fungi sporophore.
8) application of hidden pore fungi extract in the product (as medicine) of the body temperature of preparation reduction reproductive and respiratory syndrome viral infection pig, described hidden pore fungi extract is the water-soluble substances extracting from hidden pore fungi sporophore.
Above-mentioned 1) ,-8), described hidden pore fungi can be sporophore and/or mycelium and/or spore.Described hidden pore fungi sporophore can be fresh sporophore and also can be dry sporophore.
In above-mentioned application, described hidden pore fungi extract can obtain as follows: after hidden pore fungi sporophore is pulverized, by flooding, collect water-soluble substances and obtain described hidden pore fungi extract.
In the preparation method of above-mentioned hidden pore fungi extract, described hidden pore fungi sporophore can be crushed to 50-80 order.
In the preparation method of above-mentioned hidden pore fungi extract, described with flooding can be 4-65 ℃ (as 4-10 ℃, 50-65 ℃, 4 ℃ or 50 ℃) with flooding 10-14 hour.
In the preparation method of above-mentioned hidden pore fungi extract, can adopt water-soluble substances described in centrifugalize.The centrifugal force of described centrifugal employing can be 8000-10000g, and centrifugation time can be 10-20 minute (as 10-15 minute or 15-20 minute).
Of the present inventionly experimental results show that the hidden pore fungi extract of preparing with hidden pore fungi does not have obvious toxic and side effects to piglet, can alleviate the high heat that the high virus strain infection piglet of causing a disease of PRRSV causes, reduce piglet serum-virus titre, improve the survival rate that infects piglet.
Accompanying drawing explanation
Fig. 1 is the cytotoxicity result of hidden pore fungi extract solution to PAMs that mtt assay is measured 0-0.7mg/L.
Fig. 2 is that the hidden pore fungi extract culture fluid of indirect immunofluorescence assay 0-0.6mg/L suppresses PRRSV CH-1a strain in the intracellular result that copies of MARC-145.
Marc-145 cell infection PRRSV CH-1a strain (MOI=0.1), after 2 hours, is changed the culture fluid that contains or do not contain hidden pore fungi extract, and 24 hours laggard row indirect immunofluorescences detect virus and copy intracellular.
Fig. 3 is that the hidden pore fungi extract culture fluid of 0-0.6mg/L suppresses PRRSV CH-1a strain strain and copies MARC-145 is intracellular.
Marc-145 cell infection PRRSV CH-1a(MOI=0.1) after 2 hours, change the culture fluid that contains or do not contain hidden pore fungi extract, after 24 hours, collect supernatant and survey virus titer.
Fig. 4 is that the hidden pore fungi extract culture fluid of indirect immunofluorescence assay 0-0.6mg/L suppresses the high strain JXwn06 of causing a disease of PRRSV in the intracellular result that copies of PAMs.
HPV represents the high strain JXwn06 of causing a disease of PRRSV.
The high strain JXwn06(MOI=0.1 that causes a disease of PAMs cell infection PRRSV) after 2 hours, change the culture fluid that contains or do not contain hidden pore fungi extract, within 24 hours, laggard row indirect immunofluorescene assay virus copies intracellular.
Fig. 5 is that the hidden pore fungi extract culture fluid of 0-0.6mg/L suppresses PRRSV VR2332 strain and the high strain JXwn06 of causing a disease of PRRSV and copies PAMs is intracellular.
PAMs infects respectively PRRSV VR2332 strain and the high strain JXwn06(MOI=0.1 of causing a disease of PRRSV), after 2h, change the culture fluid that contains or do not contain hidden pore fungi extract, after 37 ℃ of cultivation 24h, receive supernatant and survey virus titer.
Fig. 6 is that hidden pore fungi extract reduces the fervescence that the high strain JXwn06 of causing a disease of PRRSV causes.
Fig. 7 is that hidden pore fungi extract reduces the serum-virus titre that the high strain JXwn06 of causing a disease of PRRSV infects piglet.
Fig. 8 is that hidden pore fungi extract improves the survival rate that the high strain JXwn06 of causing a disease of PRRSV infects piglet.
Fig. 9 is the hidden pore fungi extract culture fluid pretreatment Marc-145 cell with 0-0.6mg/L, does not suppress PRRSV and infects.
Figure 10, for to hatch altogether by hidden pore fungi extract culture fluid and the virus of 0-0.6mg/L, does not have obvious inhibitory action to virus activity.
Figure 11 is that hidden pore fungi extract suppresses the synthetic of PRRSV RNA.
Figure 12 is the impact of hidden pore fungi extract on the rna polymerase activity of PRRSV RNA dependence.
Figure 13 is that hidden pore fungi extract suppresses the synthetic of PRRSV albumen.
The specific embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is conventional method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
Hidden pore fungi in following embodiment (Cryptoporus volvatus (Peck) Shear) (Kohmei KADOWAKI.Behavioral observation of two fungivorous beetles (Coleoptera:Tenebrionidae) on wood-decaying bracket fungus Cryptoporus volvatusens_.EntomologicalScience (2010) 13,159 – 161) pick up from Chinese yunnan, the public can be from field acquisition, Ye Kecong China Agricultural University obtains, to repeat the application's experiment.
The high strain JXwn06(Lei Zhou that causes a disease of PRRSV in following embodiment, et al.The 30-Amino-AcidDeletion in the Nsp2 of Highly Pathogenic Porcine Reproductive and Respiratory SyndromeVirus Emerging in China Is Not Related to Its Virulence.JOURNAL OF VIROLOGY, May2009, p.5156 – 5167), PRRSV CH-1a strain (Xie Liji, Deng. the clone of Guangxi highly pathogenic PRRSV Nsp2 gene, sequence analysis and Epitope prediction. animal medicine progress.2008,29 (1): l-4) and PRRSVVR2332 strain (Xie Liji etc. clone, sequence analysis and the Epitope prediction of Guangxi highly pathogenic PRRSV Nsp2 gene. animal medicine progress.2008,29 (1): l-4); In the situation that meet the pertinent regulations public Ke Cong China Agricultural University of national bio-safety, obtain, to repeat the application's experiment.
Embodiment 1, with hidden pore fungi, prepare porcine reproductive and respiratory syndrome virus inhibitor
One, the preparation of hidden pore fungi extract
With the dry sporophore of the hidden pore fungi of distilled water immersion, the weight ratio of water and the dry sporophore of hidden pore fungi is 6:1, and 4 ℃ are soaked 2-4 hour, and homogenizer fully blends to 60 orders, 4 ℃ of lixiviates 10 hours, and centrifugal 20 minutes of 8000g, collects supernatant, and lyophilizing, obtains hidden pore fungi extract.The dry sporophore of this hidden pore fungi is that fresh hidden pore fungi sporophore is dried and is obtained at normal temperatures.
Hidden pore fungi extract used in the experiment of following step 2, all with physiological saline solution and by using after the filter filtration sterilization of 0.22 micron.
Two, hidden pore fungi extract inhibition Porcine reproductive and respiratory syndrome (PRRS) virus copies in porcine alveolar macrophage and cercopithecus aethiops embryo kidney epithelial cell (MARC-145)
Experimental results show that, the hidden pore fungi water extract of step 1 can significantly suppress Porcine reproductive and respiratory syndrome (PRRS) virus to be copied in porcine alveolar macrophage and cercopithecus aethiops embryo kidney epithelial cell (MARC-145), titre can be low by 104, to be that viral load is reduced to original ten thousand/, show that this extract has the ability of very strong inhibition PRRS virus.Concrete experimental technique and experimental result are as follows:
1, experimental technique
The separation of 1.1 porcine alveolar macrophages and the preparation of virus liquid
By the piglet blood-letting of the specific pathogen free in 8 week age (SPF), aseptic its lungs of winning, first with 0.9% physiological saline solution, wash outer surface, then Hanks balanced salt solution (HBSS) 30.0ml of pH7.2 is poured into lungs from trachea, massage gently lung surface, after 1 ~ 2min, reclaim irrigating solution, so repeatedly carry out, until irrigating solution is limpid.By the centrifugal 10min of bronchoalveolar lavage fluid 300g reclaiming, the cell of collection is porcine alveolar macrophage (PAMs).With adding appropriate RPMI 1640(10% hyclone FBS after RPMI 1640 washed twice) culture fluid dispels cell, puts in culture bottle in 37 ℃, 5%CO
2in incubator, cultivate, after it is adherent, supernatant discarded and non-adherent cell continue to use RPMI 1640(10%FBS) culture fluid cultivation.
PRRSV is high, and the strain JXwn06 that causes a disease obtains from morbidity pig farm separation, on porcine alveolar macrophage, breeds.Porcine alveolar macrophage is inoculated into 75cm
2tissue Culture Flask in, after cell attachment, suck supernatant, the virus liquid 3ml(viral infection plural number MOI=0.5 that access dilute, while infecting, ratio viral and cell quantity is 0.5); 37 ℃ absorption 60min, during every 15min, rock gently culture bottle so that virus liquid fully contacts with cell; After 60min, add culture fluid, be placed in 37 ℃ of cultivations; After 36h between-80 ℃ and room temperature frozen-thawed cell three times, with cell lysis; Cell pyrolysis liquid is transferred to 50ml centrifuge tube, 4 ℃, the centrifugal 10min of 5000g, supernatant is virus liquid, and supernatant is divided and is filled to 1.5ml EP pipe, be stored in-80 ℃ standby.
1.2 cells are by viral median infective dose (TCID
50) mensuration
Pigs Inoculated pulmonary alveolar macrophage in 96 porocyte culture plates, 37 ℃, 5%CO
2in incubator, cultivate 24h; In 1.5ml EP pipe, with cell culture fluid, virus liquid is made to the gradient dilution of continuous 10 times, from 10
-1to 10
-7; The virus liquid having diluted is inoculated in porcine alveolar macrophage culture plate, and each dilution factor is inoculated 8 holes, and 100 μ l are inoculated in every hole; If normal cell contrasts 8 holes; Connect poison latter the 4th day, observe and record the quantity in each dilution factor virus-positive hole, calculate viral TCID
50.Obtain viral TCID
50can be used for calculating viral infection multiplicity (MOI), the ratio of virus and cell quantity while infecting.
1.3 indirect immunofluorescences (IFA) method detects virus indirect immunofluorescence with fluorescein-labelled antiglobulin antibody, after antibody is combined with corresponding antigens, fluorescently-labeled antiglobulin antibody is had an effect with the antibody of being combined, thereby knows the existence of antigen or antibody by inference.
With methanol: 4 ℃ of fixed cell 10min of acetone (1:1) fixative; PBS washes 37 ℃ of sealing 30min of twice, 5% sheep blood serum; Suck supernatant, add primary antibodie SDOW17(1:10, the 000RuralTechnologies of anti-PRRS virus N albumen), 4 ℃ are spent the night; PBS washes 3 times, each 5min, and the rabbit anti-mouse igg two that adds green fluorescence FITC labelling resists (1:2000, Jackson ImmunoResearch),, 37 ℃ of lucifuge 1h; PBS washes 3 times, each 5min; Fluorescence microscopy Microscopic observation green fluorescence, green fluorescence is illustrated in the virus of time multiplexed cell system.
1.4 tetrazolium bromides (MTT) method is measured the cytotoxicity of hidden pore fungi extract
Mtt assay claims again MTT colorimetry, is a kind of method that detects cell survival and growth.Its detection principle is that the succinate dehydrogenase in living cells mitochondrion can make exogenous MTT be reduced to water-insoluble bluish violet crystallization first a ceremonial jade-ladle, used in libation (Formazan) and be deposited in cell, and dead cell is without this function.First a ceremonial jade-ladle, used in libation in dimethyl sulfoxide (DMSO) energy dissolved cell, measures its absorbance value with enzyme-linked immunosorbent assay instrument, can indirectly reflect living cells quantity.Within the scope of certain cell number, the amount that MTT crystallization forms is directly proportional to cell number.
Porcine alveolar macrophage (PAMs) and cercopithecus aethiops embryo kidney epithelial cell (MARC-145) are used respectively to RPMI 1640(10% hyclone FBS) or DMEM(10% hyclone FBS) culture fluid is made into cell suspension, is inoculated into 96 orifice plates, 37 ℃, 5%CO
2under environment, cultivate 24h.With culture fluid, dilute hidden pore fungi extract, obtain hidden pore fungi extract final concentration and be respectively 0.1,0.2,0.3,0.4,0.5,0.6 and the hidden pore fungi extract culture fluid of 0.7mg/ml, with isopyknic normal saline, contrast.Cell culture fluid is abandoned in suction, adds hidden pore fungi extract culture fluid or the normal saline of isopyknic above-mentioned concentration, hidden pore fungi extract culture fluid 8 holes of each concentration, normal saline 8 holes; 37 ℃, 5%CO
2under environment, cultivate 48h, every hole adds MTT solution (5mg/ml, with the PBS preparation of pH=7.4) 20 μ l, continue to cultivate 4h, careful suction abandoned the cell culture fluid in hole, and every hole adds 150 μ l DMSO(dimethyl sulfoxide), hatch 10min for 37 ℃, crystal is fully melted.By microplate reader, at 550nm wavelength place, survey absorbance, take cellular control unit survival rate as 100%, the survival rate of experiment with computing group cell:
Experimental group cell survival rate=OD(experimental group)/OD(matched group) %.
1.5 hidden pore fungi extracts suppress the different strains of PRRSV copying on porcine alveolar macrophage (PAMs) and cercopithecus aethiops embryo kidney epithelial cell (MARC-145)
PAMs and MARC-145 are used respectively to RPMI RPMI-1640 (10% hyclone FBS) or DMEM(10% hyclone FBS) culture fluid is made into cell suspension, is inoculated into 96 orifice plates, 37 ℃, 5%CO
2under environment, cultivate 24h.Inoculate respectively PRRSV CH-1a strain (MOI=0.1), the high strain JXwn06(MOI=0.1 that causes a disease of PRRSV) and PRRSV CH-1a strain (MOI=0.1), within after viral infection 2 hours, discard supernatant, add respectively and isopyknicly contain 0, 0.2, 0.4, the fresh RPMI RPMI-1640 of the hidden pore fungi extract of 0.6mg/ml (dilutes hidden pore fungi extract with fresh RPMI RPMI-1640, obtain hidden pore fungi extract final concentration and be respectively 0.2, 0.4 and the hidden pore fungi extract culture fluid of 0.6mg/ml, to add isopyknic fresh RPMI RPMI-1640 (the fresh RPMI RPMI-1640 of the hidden pore fungi extract of 0mg/ml) in contrast), hidden pore fungi extract culture fluid 8 holes of each concentration, 37 ℃, 5%CO
2under environment, cultivate 24h, collect supernatant and measure viral TCID50, detect the decline level of virus in supernatant, fixed cell, does indirect immunofluorescence, the inhibition level that Detection and Extraction thing copies intracellular virus simultaneously.
1.6 data analysis
All data are all the independent meansigma methodss obtaining in triplicate, paired with two tail T-test() analyze the significance of difference, P≤0.05 is considered to significant difference, 0.01<P≤0.05(*), 0.001<P≤0.01(**), P≤0.001(***).
2, experimental result
Result shows that the concentration of hidden pore fungi extract does not all have toxicity (Fig. 1) to porcine alveolar macrophage (PAMs) and cercopithecus aethiops embryo kidney epithelial cell (MARC-145) in the scope of 0.1-0.7mg/ml; The concentration of hidden pore fungi extract significantly suppresses PRRSV CH-1a strain and copy (Fig. 2 in MARC-145 within the scope of 0.2-0.6mg/ml, Fig. 3), wherein, adding the PRRSV CH-1a strain in the Marc-145 cells and supernatant of the hidden pore fungi extract of 0.6mg/ml culture fluid is 10 to the titre of porcine alveolar macrophage
3.1 ± 0.15tCID
50/ ml is that to add the PRRSV CH-1a strain in the Marc-145 cells and supernatant of the hidden pore fungi extract of 0mg/ml culture fluid (be 10 to the titre of porcine alveolar macrophage
7.0 ± 0.05tCID
50/ ml) ten thousand/.Porcine alveolar macrophage (PAMs) infects respectively after PRRSVVR2332 strain and the high strain JXwn06 of causing a disease of PRRSV, and hidden pore fungi extract can significantly suppress copy (Fig. 4, Fig. 5) of PRRSV.Wherein, adding the high strain JXwn06 of causing a disease of PRRSV in the PAMs cells and supernatant of the hidden pore fungi extract of 0.6mg/ml culture fluid is 10 to the titre of porcine alveolar macrophage
4.56 ± 0.08tCID
50/ ml is that to add the high strain JXwn06 of causing a disease of PRRSV in the PAMs cells and supernatant of the hidden pore fungi extract of 0mg/ml culture fluid (be 10 to the titre of porcine alveolar macrophage
7.5 ± 0.02tCID
50/ ml) one thousandth; Adding the PRRSV VR2332 strain in the PAMs cells and supernatant of the hidden pore fungi extract of 0.6mg/ml culture fluid is 10 to the titre of porcine alveolar macrophage
2.5 ± 0.04tCID
50/ ml is that to add the PRRSV VR2332 strain in the PAMs cells and supernatant of the hidden pore fungi extract of 0mg/ml culture fluid (be 10 to the titre of porcine alveolar macrophage
5.5 ± 0.03tCID
50/ ml) one thousandth.
One, the preparation of hidden pore fungi extract
With the dry sporophore of the hidden pore fungi of distilled water immersion, the weight ratio of water and the dry sporophore of hidden pore fungi is 7:1, and 4 ℃ are soaked 2-4 hour, homogenizer fully blends to 80 orders, 50 ℃ of lixiviates 10 hours, centrifugal 10 minutes of 8000g, collect supernatant, lyophilizing, obtains hidden pore fungi extract.The dry sporophore of this hidden pore fungi is that fresh hidden pore fungi sporophore is dried and is obtained at normal temperatures.With the hidden pore fungi extract of physiological saline solution and by the filter filtration sterilization of 0.22 micron, obtain hidden pore fungi extract injection.
Two, hidden pore fungi extract suppresses the breeding of PRRS virus in pig body
1, experimental technique
The SPF pig in 4 week age that is 6-8kg by 10 body weight is divided into 2 groups (5 every group) at random, is respectively matched group (only infecting PRRS virus not to hidden pore fungi extract), administration group (infect PRRS virus, give hidden pore fungi extract simultaneously).Use 1ml(TCID50=10
5) high the strain JXwn06 collunarium that causes a disease infects SPF pig to PRRSV, every pig abdominal cavity of administration group and above-mentioned hidden each 5ml(12mg/ml of pore fungi extract injection of intramuscular injection), continuous 7 days, every day twice, every pig of matched group was injected isopyknic normal saline.Before infection and after infecting, blood sampling in the 3rd, 7,10,16 and 45 days, collects serum, by real-time PCR method, PRRS virus is done to detection by quantitative; Survey body temperature every day, observed and recorded clinical symptoms.Mortality pig is carried out to necropsy at any time, at the 42nd day, all survival pigs are carried out to necropsy.
The step of 1.1 pig vena cava anterior blood samplings and separation of serum is as follows:
Piglets is adopted to Baoding method of lying on the back, and a people grasps two hind legs, as far as possible to rear haulage; Another people presses down mandibular bone with hands, makes head paste ground, and makes two forelimbs substantially vertical with body center line.Now, the front side of first pair of both sides rib and breastbone junction is two obvious recesses.With after iodine tincture and cotton ball soaked in alcohol sterilization skin, hand-held vacuum blood collector is supporting, and with pin (0.7 * 25mm), recess place is from top to bottom to the right, slightly be partial to central authorities and thoracic cavity direction is thrust, see and have blood back, be about to the supporting other end with pin of vacuum blood collector and insert vacuum test tube, start blood sampling, every piglets is adopted 4-5ml blood.Take a blood sample complete, left hand takes cotton ball soaked in alcohol to press pin hole place, and the right hand is extracted rapidly blood-collecting needle tube, and slightly tabletting is carved after hemostasis, removes Baoding.
Blood taking tube is placed in to 37 ℃ of 2h, and then 4 ℃ are spent the night, and serum can be separated out, and the serum of separating out is collected in 1.5mlEP pipe, and 4000g, 4 ℃ of centrifugal 10min, discard precipitation, by serum keeping in-80 ℃, for detection of viral RNA.
Virus titer in 1.2Real-Time PCR standard measure serum
The test kit of producing with OMEGA Viral RNAKit company extracts the viral RNA in serum.Requirement by test kit description operates.By 560 μ l QVL lysates, 5.6 μ l carrier RNA and 10 μ l 2 mercapto ethanols join in 1.5ml EP pipe.Getting 140 μ l serum joins in the EP pipe that contains lysate.Incubated at room 5-10min.In sample, add 560 μ l dehydrated alcohol, concussion mixes 30s.By in test kit
adsorption column packs in the collecting pipe of 2ml, and the mixed liquor 650 μ l that get step add in adsorption column, and 10, the centrifugal 30s of 000g, discard the liquid in collecting pipe, adsorption column is inserted in new collecting pipe, repeat previous step until all mixed liquors are all transferred to adsorption column.In adsorption column, add 500 μ l RWA washing liquids, the centrifugal 30s of 10,000g, discards the liquid in collecting pipe, and adsorption column is inserted in new collecting pipe.In adsorption column, add 500 μ l RWB washing liquids, the centrifugal 30s of 10,000g, discards the liquid in collecting pipe, adsorption column is inserted in collecting pipe to the centrifugal 3min of 12,000g.Adsorption column is placed in to new 1.5ml EP pipe, to the central authorities of adsorption column, adds the H of 50 μ l DEPC processing
2o.Incubated at room 5min, the RNA adsorbing on the centrifugal 1min eluting of 10,000g adsorption column, is stored in RNA-80 ℃ for quantitatively.
Get 2 μ l RNA and be RT-PCR.In 250 μ l PCR pipes, add 2 μ l RNA and 1 μ l Random Primer(10 μ m, TaKaRa), mix; 70 ℃ of 5min, put rapidly cooled on ice 2min; To adding following component in said mixture: M-MLV 5 * Reaction Buffer 5 μ l, dNTP(2.5mM each) 5 μ l, RecombinantRNasinRibonuclease Inhibitor 25units, M-MLV RT (Promega) 200units, finally adds DEPC water polishing volume to 25 μ l; Mix gently 37 ℃ of 60min; PCR pipe is transferred to 70 ℃, 15min; Be placed in cooled on ice, cDNA product is stored in-20 ℃.
Real-Time PCR is used SYBR Premix Ex TaqTM II (the Perfect Real Time) reaction system of TaKaRa.
premix Ex TaqTM(2 *) 10 μ l, PCR primer ORF7F(AATAACAACGGCAAGCAGCA), ORF7R(GCACAGTATGATGCGTCGGC) (10 μ m) each 0.8 μ l, ROX Reference Dye II(50 *) 0.4 μ l, cDNA template 2 μ l, aseptic double-distilled water 6 μ l, cumulative volume 20 μ l.On ABI 7900Real-Time PCR System, react, take two-step method pcr amplification standardization program: 95 ℃ of 30s; 95 ℃ of 5s, 60 ℃ of 30s (40 circulations).By SDS2.2.2for 7900 software analysis deal with data.With the plasmid of the PRRSV ORF7 of known copy number, make standard substance (by the PRRSVORF7DNA fragment shown in sequence 1 and pcDNA3.1 carrier (Invitrogen, catalog number (Cat.No.) K480001) recombiant plasmid that connection obtains is as the standard substance of PRRSV ORF7), after 10 times of gradient dilutions, be Real-Time PCR, with Ct value, the logarithm of plasmid copy number is done to standard curve, quantitative to viral RNA according to standard curve.
2, experimental result
Experimental result shows, hidden pore fungi extract does not have obvious toxic and side effects to piglet, can alleviate the high heat (Fig. 6) that the high virus strain infection piglet of causing a disease of PRRSV causes, reduces piglet serum-virus titre (Fig. 7), improves the survival rate (Fig. 8) that infects piglet.Wherein, administration group serum-virus titre of the 10th day after counteracting toxic substances is 1/5th of matched group, administration group can't detect virus titer in the serum of the 45th day after counteracting toxic substances, and matched group is in all death in the 12nd day after counteracting toxic substances, administration group survival rate of the 16th day after counteracting toxic substances is 80%, and administration group survival rate of the 45th day after counteracting toxic substances is 60%.
The mechanism of embodiment 3, the anti-porcine reproductive and respiratory syndrome virus of hidden pore fungi extract
One, the preparation of hidden pore fungi extract
With the dry sporophore of the hidden pore fungi of distilled water immersion, the weight ratio of water and the dry sporophore of hidden pore fungi is 6:1, and 4 ℃ are soaked 2-4 hour, and homogenizer fully blends to 50 orders, 4 ℃ of lixiviates 10 hours, and centrifugal 15 minutes of 8000g, collects supernatant, and lyophilizing, obtains hidden pore fungi extract.The dry sporophore of this hidden pore fungi is that fresh hidden pore fungi sporophore is dried and is obtained at normal temperatures.Hidden pore fungi extract used in the experiment of following step 2, all with physiological saline solution and by using after the filter filtration sterilization of 0.22 micron.
Two, the mechanism of the anti-porcine reproductive and respiratory syndrome virus of hidden pore fungi extract
1, test method
1.1, the impact that hidden pore fungi extract pretreatment Marc-145 (cercopithecus aethiops embryo kidney epithelial cell) infects PRRSV
DMEM culture fluid (10%FBS) for Marc-145 is dispelled, be made into cell suspension, be inoculated into 96 orifice plates, 37 ℃, 5%CO
2under environment, cultivate 24h.Remove culture fluid, change the fresh medium that contains the hidden pore fungi extract of variable concentrations, 37 ℃, 5%CO
2under environment, hatch 2h, remove the culture fluid containing hidden pore fungi extract, infect PRRSV CH-1a strain (MOI=0.1), continue to cultivate 24h, receive cells and supernatant and measure virus titer according to the method for embodiment 1.
Wherein, the fresh medium that contains the hidden pore fungi extract of variable concentrations be contain 0,0.2,0.42, the fresh DMEM culture fluid of the hidden pore fungi extract of 0.6mg/ml (dilutes hidden pore fungi extract with fresh DMEM culture fluid, obtain that hidden pore fungi extract final concentration is respectively 0.2,0.4, the hidden pore fungi extract culture fluid of 0.6mg/ml, with isopyknic fresh DMEM culture fluid (the fresh DMEM culture fluid of the hidden pore fungi extract of 0mg/ml), contrast).
1.2, measure the direct killing effect of hidden pore fungi extract to PRRSV
By containing 0,0.2,0.4, the fresh DMEM culture fluid of the hidden pore fungi extract of 0.6mg/ml and the PRRSV(10 of equivalent
5tCID50) at 37 ℃, hatch altogether 1h and 3h, after having hatched, according to the method for embodiment 1, measure virus titer.
1.3, measure hidden pore fungi extract and suppress PRRSV RNA synthetic in Marc-145 cell
Suppress PRRSV the synthetic of RNA in Marc-145 DMEM culture fluid (10%FBS) for Marc-145 is dispelled, be made into cell suspension, be inoculated into six orifice plates, 37 ℃, 5%CO
2under environment, cultivate 24h.Inoculation PRRSVCH-1a strain (MOI=0.01), after viral infection, 24h discards supernatant, add and contain 0 respectively, 0.2, the fresh DMEM culture fluid of the hidden pore fungi extract of 0.5mg/ml (dilutes hidden pore fungi extract with fresh DMEM culture fluid, obtain hidden pore fungi extract final concentration and be respectively 0.2 and the hidden pore fungi extract culture fluid of 0.5mg/ml, to add isopyknic fresh DMEM culture fluid (the fresh DMEM culture fluid of the hidden pore fungi extract of 0mg/ml) in contrast), respectively at changing after liquid 6, 12, 24, 48, 72h receives cell, extract cell total rna and be Real-Time PCR.With the plasmid (with embodiment 2) of the PRRSV ORF7 of known copy number, make standard substance, after 10 times of gradient dilutions, be Real-TimePCR, with Ct value, the logarithm of plasmid copy number is done to standard curve, quantitative to viral RNA according to standard curve.
Wherein, RNA extraction, reverse transcription and Real-Time PCR method are as follows: every 5-10 * 10
6individual cell adds 1ml Trizol (invitrogen), repeatedly with pipettor piping and druming, mixes the standing 5min of room temperature; In above-mentioned EP pipe, add 0.2ml chloroform, cover EP pipe lid, in hands, firmly shake the standing 10min of room temperature 15 seconds; 4 ℃, the centrifugal 15min of 12000g; Get upper strata water and be placed in new EP pipe, add 0.5ml isopropyl alcohol, the standing 10min of room temperature; 4 ℃, the centrifugal 10min of 12000g; Carefully abandon supernatant, add 1ml 75% ethanol and wash, 4 ℃, the centrifugal 5min of 7500g, abandon supernatant; Allow the RNA natural drying at room temperature of precipitation, finally add 20l DEPC water dissolution RNA, with Nanodrop 1000(Thermo scientific) quantitative RNA.
Get 500ng RNA and be RT-PCR.In 250l PCR pipe, add 500ng RNA and 1 μ l RandomPrimer(10 μ M, TaKaRa), mix; 70 ℃ of 5min, put rapidly cooled on ice 2min; To adding following component in said mixture: M-MLV 5 * Reaction Buffer 5 μ l, dNTP(2.5mM each) 5 μ l, RecombinantRNasinRibonuclease Inhibitor 25units, M-MLV RT (Promega) 200units, finally adds DEPC water polishing volume to 25 μ l; Mix gently 37 ℃ of 60min; PCR pipe is transferred to 70 ℃, 15min; Be placed in cooled on ice, cDNA product is stored in-20 ℃.Real-Time PCR is used SYBR Premix ExTaqTM II (the Perfect Real Time) reaction system of TaKaRa.
premix Ex TaqTM(2 *) 10 μ l, PCR primer ORF7F(AATAACAACGGCAAGCAGCA), ORF7R(GCACAGTATGATGCGTCGGC) (10 μ m) each 0.8 μ l, ROX Reference Dye II(50 *) 0.4 μ l, cDNA template 2 μ l, aseptic double-distilled water 6 μ l, cumulative volume 20 μ l.On ABI 7900Real-Time PCR System, react, take two-step method pcr amplification standardization program: 95 ℃ of 30s; 95 ℃ of 5s, 60 ℃ of 30s (40 circulations).By SDS2.2.2for 7900 software analysis deal with data.
1.4, measure the impact of hidden pore fungi extract on the rna polymerase activity of PRRSV RNA dependence
The RNA polymerase that PRRSV RNA relies on (is prepared according to the method in following document: De Novo Initiationof RNA Synthesis by the ArterivirusRNA-Dependent RNA Polymerase.JOURNAL OFVIROLOGY, Aug.2007, p.8384-8395), in vitro in reaction system, the RNA polymerase that RNA relies on can be take poly(U) 18 be template, take ATP as substrate, from 5, to 3, synthetic poly(A) 18, with filter paper, in conjunction with experiment (filter-binding assays), adsorb poly(A) 18, reaction rna polymerase activity.Ion-exchange cellulose chromatography paper DE81-paper (DE81-filer), weak base anion exchanger with diethyl amino ethyl group functional group, can the isotope-labeled RNA chain of binding radioactivity, reactant liquor is passed through after filter paper, by detecting the amount of the RNA chain adsorbing on the isotope signal quantitative filter paper on filter paper, thus the activity of reaction RNA polymerase.
In 1.5ml EP pipe, configure following reactant liquor: 5x reaction buffer (250mM HEPES (pH 8.0), 50mMKCl, 5mM DTT, 10mM MnCl
2, 4mM MgCl
2) 10 μ l, the RNA polymerase nsp92 μ M that PRRSV RNA relies on, polyU (18) 400nM, [
32p] ATP 0.5-2.5 μ Ci, ATP 100 μ M, RRI 50unit, the hidden pore fungi extract normal saline solution of different volumes, makes that hidden pore fungi extract final concentration is respectively 0,0.01,0.05,0.1mg/ml; Use DEPC H
2o polishing volume to 50 μ l.30 degree reaction 60min, add isopyknic 50mM EDTA cessation reaction.50 μ l reactant liquors are dropped in to DE-81(whatman) on filter membrane, dry.With 0.3M ammonium formate (PH8.0), wash three times, each 2min is dry.Add liquid scintillation counting reactant liquor, with instrument counting counts per minute.The activity of RNA polymerase while not adding hidden pore fungi extract of take is 100%, analyzes the impact of hidden pore fungi extract on the rna polymerase activity of PRRSV RNA dependence.
1.5, measure hidden pore fungi extract and suppress PRRSV protein synthetic in Marc-145 cell
Suppress PRRSV the synthetic of protein in Marc-145 cell DMEM culture fluid (10%FBS) for Marc-145 cell is dispelled, be made into cell suspension, be inoculated into six orifice plates, 37 ℃, 5%CO
2under environment, cultivate 24h.Inoculation PRRSV CH-1a strain (MOI=0.5), after viral infection, 2h discards supernatant, add respectively and contain 0,0.2, the fresh medium of the hidden pore fungi extract of 0.6mg/ml (dilutes hidden pore fungi extract with fresh DMEM culture fluid, obtain hidden pore fungi extract final concentration and be respectively 0.2 and the hidden pore fungi extract culture fluid of 0.6mg/ml, with isopyknic fresh DMEM culture fluid (the fresh DMEM culture fluid of the hidden pore fungi extract of 0mg/ml), contrast), continue to cultivate 24h, remove cell culture fluid, with PBS, wash one time.In 6 orifice plates, every porocyte adds 200 μ l containing the RIPA lysate (Bo Maide) of 1mM protease inhibitor PMSF, several with pipettor piping and druming under, lysate is fully contacted with cell.Fully, after cracking, the centrifugal 5min of 14,000g, gets supernatant, is the total protein that cell lysis obtains, and is Western-blot.Western-blot is Western immunoblotting, is protein transduction is moved on on film, then utilizes antibody to detect.What Western Blot adopted is polyacrylamide gel electrophoresis, and detected material is protein, and " probe " is antibody, and " colour developing " resists with two of labelling.Through the protein example of PAGE separation, transfer to solid phase carrier (for example cellulose nitrate film) upper, solid phase carrier is with non-covalent bond form adsorbed proteins, and can keep polypeptide type and the biologic activity thereof of electrophoretic separation constant.Using protein on solid phase carrier or polypeptide as antigen, play immunoreation with corresponding antibody, react with enzyme or isotope-labeled second antibody, the colour developing of process substrate or autoradiography are to detect the protein ingredient of the specific destination gene expression of electrophoretic separation again.
Quantitative to BCA determination of protein concentration test kit (enhancement mode) (the green skies) for total protein.Get appropriate 25mg/ml protein standard BSA, with PBS, being diluted to final concentration is 0.5mg/ml; Quantity, adds 1 volume BCA reagent B (50:1) by 50 volume BCA reagent A and prepares appropriate BCA working solution per sample, fully mixes; Standard substance are added in the standard substance hole of 96 orifice plates by 0,1,2,4,8,12,16,20 μ l, add PBS and supply 20 μ l; Add 2 μ l samples in the sample well of 96 orifice plates, add PBS to 20 μ l; Each hole adds 200 μ l BCA working solutions, places 30min for 37 ℃; Measure A562, according to standard curve, calculate the protein concentration of sample.
With the separated 15 μ g protein samples of 10%SDS-PAGE gel electrophoresis, concentrated glue voltage 80V, separation gel voltage 120V, when bromophenol blue indicator arrives gel bottom, stops electrophoresis; Then protein sample is transferred to pvdf membrane (Millipore), electric current 40mA, 2h at 4 ℃ from gel; After transferring film finishes, pvdf membrane is taken out from electric turn trough, with 5% defatted milk powder (being dissolved in 1 ╳ PBST), at 37 ℃, seal 1h; With 5% defatted milk powder dilution primary antibodie anti-PRRSV N proteinSDOW17(1:5,000; Rural Technologies) or anti--actin (1:5,000; CloneAC-15; Sigma, St.Louis, MO), 4 ℃ of overnight incubation, wash 3 times with 1X PBST, each 5min; With 5% defatted milk powder, dilute the anti-Mus of two anti-HRP-rabbits two anti-(1:10,000, health is century), hatch 1h for 37 ℃, 1X PBST washes 3 times, each 5min; Finally use high sensitivity chemistry luminous detection test kit (health is century) to develop.
Wherein, β-actin(beta-actin) be a kind of main protein composition in muscle rhabdomyosarcoma fiber, also be the main component of muscle filament and cytoskeletal filament, there is contractile function, widely distributed, relative constant with the expression in cell at each tissue, when the expression that detects albumen changes, to commonly use it and make object of reference, this experiment is also used β-actin in contrast.
1.6, data analysis
All data are all the independent meansigma methodss obtaining in triplicate, paired with two tail T-test() analyze the significance of difference, P≤0.05 is considered to significant difference, 0.01<P≤0.05(*), 0.001<P≤0.01(**), P≤0.001(***).
2, experimental result
The hidden pore fungi extract of all concentration (0.2-0.6mg/ml) culture fluid pretreatment Marc-145 (cercopithecus aethiops embryo kidney epithelial cell), does not suppress the infection (Fig. 9) of PRRSV.Hidden pore fungi extract is directly processed PRRSV, hatches 1h, and the hidden pore fungi extract of all concentration (0.2-0.6mg/ml) culture fluid is processed does not all have lethal effect to virus; Hatch 3h, the processing that concentration is 0.2mg/ml does not have lethal effect to virus, and the processing of 0.4mg/ml and 0.6mg/ml has slight lethal effect (Figure 10) to virus.After PRRSV infection cell, 24h adds hidden pore fungi extract, the synthetic meeting of viral RNA is suppressed, hidden pore fungi extract culture fluid 6h after adding of 0.5mg/ml can obviously suppress the synthetic of viral RNA, 48h after adding, extract is the most obvious for the inhibitory action of viral RNA, during to 72h, the cell of matched group meeting death because of viral infection, so the amount of cellular control unit inner virus RNA also can decline (Figure 11).Hidden pore fungi extract just can obviously suppress the activity of the RNA polymerase of PRRSV RNA dependence at low concentration, when concentration is 0.01mg/ml, the activity of the RNA polymerase that PRRSV RNA relies on drops to 60%(Figure 12).Hidden pore fungi extract can suppress PRRSV synthetic proteins in cell, after virus infected cell, 2h adds hidden pore fungi extract, after 24h, detect the expression of virus N albumen, compared with the control, hidden pore fungi extract can dose dependent inhibition virus N albumen synthetic, the hidden pore fungi extract of 0.6mg/ml culture fluid can't detect the expression (Figure 13) of virus N albumen.
Claims (8)
1. the application of hidden pore fungi in preparation treatment Porcine reproductive and respiratory syndrome product; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear).
2. hidden pore fungi is improved the application in reproductive and respiratory syndrome viral infection pig survival rate product in preparation; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
3. the application in the product of hidden pore fungi titre of porcine reproductive and respiratory syndrome virus in preparation reduction porcine reproductive and respiratory syndrome virus infected pigs serum; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
4. the application of hidden pore fungi in the product of the body temperature of preparation reduction reproductive and respiratory syndrome viral infection pig; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
5. the application of hidden pore fungi extract in preparation treatment Porcine reproductive and respiratory syndrome product, described hidden pore fungi extract is the water-soluble substances extracting from hidden pore fungi sporophore; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
6. hidden pore fungi extract improves the application in reproductive and respiratory syndrome viral infection pig survival rate product in preparation, and described hidden pore fungi extract is the water-soluble substances extracting from hidden pore fungi sporophore; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
7. the application in the product of hidden pore fungi extract virus titer of porcine reproductive and respiratory syndrome virus in preparation reduction porcine reproductive and respiratory syndrome virus infected pigs serum, described hidden pore fungi extract is the water-soluble substances extracting from hidden pore fungi sporophore; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
8. the application of hidden pore fungi extract in the product of the body temperature of preparation reduction reproductive and respiratory syndrome viral infection pig, described hidden pore fungi extract is the water-soluble substances extracting from hidden pore fungi sporophore; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210461220.5A CN102920748B (en) | 2012-11-15 | 2012-11-15 | Application of cryptoporus volvatus in preparation of products for curing porcine reproductive and respiratory syndrome (PRRS) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210461220.5A CN102920748B (en) | 2012-11-15 | 2012-11-15 | Application of cryptoporus volvatus in preparation of products for curing porcine reproductive and respiratory syndrome (PRRS) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102920748A CN102920748A (en) | 2013-02-13 |
| CN102920748B true CN102920748B (en) | 2014-04-16 |
Family
ID=47635773
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210461220.5A Active CN102920748B (en) | 2012-11-15 | 2012-11-15 | Application of cryptoporus volvatus in preparation of products for curing porcine reproductive and respiratory syndrome (PRRS) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102920748B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102920745B (en) * | 2012-11-15 | 2015-07-15 | 中国农业大学 | Novel use of cryptoporus volvatus |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1121111A (en) * | 1994-10-15 | 1996-04-24 | 华启洪 | Production method of cryptoporus volvatus powder |
| CN1405314A (en) * | 2001-08-17 | 2003-03-26 | 杭州泰士生物科技有限公司 | Cryptoporus volvatus fermented product, and its preparation method and application |
| CN1919875A (en) * | 2005-08-23 | 2007-02-28 | 杭州赐富生物技术有限公司 | Cryptoporus volvatus polysaccharide, preparation and application thereof |
| CN101803531A (en) * | 2010-03-26 | 2010-08-18 | 中国科学院微生物研究所 | China cryptoporus sinensis and solid cultural method and application thereof |
-
2012
- 2012-11-15 CN CN201210461220.5A patent/CN102920748B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1121111A (en) * | 1994-10-15 | 1996-04-24 | 华启洪 | Production method of cryptoporus volvatus powder |
| CN1405314A (en) * | 2001-08-17 | 2003-03-26 | 杭州泰士生物科技有限公司 | Cryptoporus volvatus fermented product, and its preparation method and application |
| CN1919875A (en) * | 2005-08-23 | 2007-02-28 | 杭州赐富生物技术有限公司 | Cryptoporus volvatus polysaccharide, preparation and application thereof |
| CN101803531A (en) * | 2010-03-26 | 2010-08-18 | 中国科学院微生物研究所 | China cryptoporus sinensis and solid cultural method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102920748A (en) | 2013-02-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101948536B (en) | Porcine transmissible gastroenteritis virus (PTGEV) and porcine epidemic diarrhea virus (PEDV) dual yolk antibody and preparation method thereof | |
| CA2127991A1 (en) | Preparation of antigens of and of vaccines for the virus of mystery disease, antigens and vaccines obtained for the prevention of this disease | |
| CN101280292A (en) | Virus velogen strain for porcine reproductive and respiratory syndrome, attenuated vaccine strain thereof and application thereof | |
| CN102107003A (en) | Porcine reproductive and respiratory syndrome Virosome vaccine and preparation method thereof | |
| CN104789697A (en) | Four-colored fluorescent quantitative PCR method capable of simultaneously detecting CSFV, PRRSV, PRV and PCV2 and reagent kit thereof | |
| CN114788844A (en) | Application of polygonum flaccidum flavone ethyl acetate part in resisting porcine pseudorabies virus and medicament for resisting porcine pseudorabies virus | |
| Studdert et al. | Isolation and characterisation of an equine rhinovirus | |
| CN102920748B (en) | Application of cryptoporus volvatus in preparation of products for curing porcine reproductive and respiratory syndrome (PRRS) | |
| CN102920747B (en) | Application of cryptoporus volvatus in preparation of products for inhibiting porcine reproductive and respiratory syndrome virus (PRRSV) | |
| CN108969492A (en) | A kind of swine fever takes orally weak malicious freeze dried vaccine and preparation method thereof | |
| CN102920745B (en) | Novel use of cryptoporus volvatus | |
| CN103860616A (en) | Manyprickle Acathopanax Root extrat, and preparation method and application thereof | |
| CN104888213A (en) | Preparation method of classical swine fever spleen-lymph-sourced compound living vaccine | |
| Derbyshire et al. | The isolation and characterization of a strain of infectious bovine rhinotracheitis virus from stillbirth in swine. | |
| US20230076197A1 (en) | Application of hypericum japonicum thumb extract in the preparation of a drgu against the blue-ear disease | |
| CN103655684A (en) | Traditional Chinese herbal medicine microecological preparation capable of killing and inhibiting foot and mouth disease virus in vitro and in vivo | |
| CN102727881A (en) | Highly pathogenic porcine reproductive and respiratory syndrome JXAl-R strain- porcine parvovirus disease bigeminal live vaccine and preparation method and application thereof | |
| Shang et al. | Hypericum perforatum extract therapy for chickens experimentally infected with infectious bursal disease virus and its influence on immunity | |
| Cheng et al. | The in vitro anti-herpes simplex virus type-1 and type-2 activity of Long Dan Xie Gan Tan, a prescription of traditional Chinese medicine | |
| Garland et al. | Attempts to infect pigs with coxsackie virus type B5 | |
| CN114681530A (en) | Application of traditional Chinese medicine composition or fermentation product thereof, animal feed and animal feed additive | |
| CN1919270B (en) | Composition, exract, and pharmaceutical use thereof | |
| CN103275937A (en) | Recombinant virus expressing PCV2 codon optimized ORF1 and ORF2 tandem gene | |
| Pejsak et al. | Randomised, placebo‐controlled trial of a live vaccine against porcine reproductive and respiratory syndrome virus in sows on infected farms | |
| CN102764432A (en) | Chinese giant salamander viral hemorrhagic disease cell culture-based inactivated vaccine, its preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |