CN102920745B - Novel use of cryptoporus volvatus - Google Patents
Novel use of cryptoporus volvatus Download PDFInfo
- Publication number
- CN102920745B CN102920745B CN201210460451.4A CN201210460451A CN102920745B CN 102920745 B CN102920745 B CN 102920745B CN 201210460451 A CN201210460451 A CN 201210460451A CN 102920745 B CN102920745 B CN 102920745B
- Authority
- CN
- China
- Prior art keywords
- hidden
- prrsv
- linteus extract
- strain
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention discloses a novel use of cryptoporus volvatus. The novel use of cryptoporus volvatus is at least one of the four uses: 1), an application of cryptoporus volvatus in preparation of an inhibitor for porcine reproductive and respiratory syndrome; 2), an application of cryptoporus volvatus in preparation of a product (such as a drug) for inhibiting copy of a porcine reproductive and respiratory syndrome virus in a host cell; 3), an application of cryptoporus volvatus extract in preparation of an inhibitor for porcine reproductive and respiratory syndrome; 4), an application of cryptoporus volvatus extract in preparation of a product (such as a drug) for inhibiting copy of a porcine reproductive and respiratory syndrome virus in a host cell, wherein the cryptoporus volvatus extract is a water-soluble substance extracted from cryptoporus volvatus sporocarp.
Description
Technical field
The present invention relates to the purposes of hidden pore fungi, particularly hidden pore fungi is preparing the application in porcine reproductive and respiratory syndrome virus inhibitor.
Background technology
Porcine reproductive and respiratory syndrome (being commonly called as reproductive and respiratory syndrome) (Porcine Reproductive and RespiratorySyndrome, PRRS) be the infectious disease of the pig caused by porcine reproductive and respiratory syndrome virus (PRRS virus, PRRSV).This virus of the equal easy infection of pig at various age, its cardinal symptom causes miscarriage, stillborn fetus, mummy tire and weak tire after in-pig infects, and infects piglet and respiratory disorder and high case fatality rate can occur.This disease is in 1987 in U.S.'s reported first, and middle nineteen nineties in last century imports China into.At present, this disease betides nearly all pig-raising countries in the world, for China and world's pig industry cause great economic loss.Within 2006, break out in China the height caused by PRRSV variant to cause a disease Porcine reproductive and respiratory syndrome, its feature is that acute height is lethal, and piglet sickness rate can reach 100%, and mortality rate is up to 50%, Sow abortion rate reaches more than 35%, and sow and growing and fattening pigs mortality rate are up to 30%.The high Porcine reproductive and respiratory syndrome that causes a disease of this time outburst causes huge economic loss to China's pig industry.
Porcine reproductive and respiratory syndrome is the viral infectious caused by porcine reproductive and respiratory syndrome virus (PRRSV).PRRSV belongs to Buddhist nun's many viraleses Arteriviridae Arterivirus, for there being the single strand plus RNA virus of cyst membrane, full-length genome is about 15.4kb, virus is ripe in the assembling of cytoplasm, endoplasmic reticulum and Golgi body, and be gathered in intracellular vesicles with form release of sprouting, then transporte to cells film is discharged into extracellular, completes virus replicative cycle.
At present, prevention and corntrol PRRS viral infection and propagation mainly lean on vaccine, but unsuccessful.Vaccine for PRRS virus comprises attenuated vaccine and inactivated vaccine is applied for many years, but the reproductive and respiratory syndrome that the strain almost consistent with vaccine strain causes still occurs.Atypia or acute reproductive and respiratory syndrome break out immune swinery, and 2006 query to the protectiveness of current vaccine used and safety especially at the height of China's outburst reproductive and respiratory syndrome that causes a disease.Therefore, develop special, efficient anti-PRRS virus drugs to have important practical significance to prevention and corntrol reproductive and respiratory syndrome.
(Cryptoporus volvatus (Peck) Shear is a kind of wild large-form fungi be born on pine forest trunk to hidden pore fungi, also be on the booksly born on old and feeble fir, the trunk of PiceameyeriRehd. Et Wils. or dry wood, there is distribution in multiple province such as Yunnan, Guangdong, Guangxi, Hainan of China.Hidden pore fungi sporophore is less, stockless or have handle once in a while, and general side is born in substrate, suberin, oblate spheroid or subsphaeroidal, 1.5-3.5cm × 2-4.5cm, thick 1-3cm, and cap surface is smooth, shallow khaki or dark eggshell color, reddish tan after old.Edge is pure sliding and thick, is connected with velum.Velum white is white to dirt, and obviously different from cap tone, thick about 1mm.Tube layer is by velum institute clad, and the initial stage is completely closed, after there is a circle or rotund aperture near base portion gradually, occasionally have two, aperture 2-4.5mm.Bacterial context is pure white to dirty white, soft suberin, thick 2-8mm.Tube is with bacterial context color, and long 2-5mm, the mouth of pipe is circular to nearly polygon, and the light pink Lycoperdon polymorphum Vitt in mouth of pipe face or band brown, every millimeter 3-5, wall thickness, peristoma is complete.Spore is smooth, colourless, oblong, 10-13 μm × 4-6 μm.Thing is sucked when Lijiang, yunnan children's Zeng Zuowei among the people weans, or be decocted in water for oral dose treatment tracheitis and asthma.
Summary of the invention
Technical problem to be solved by this invention is to provide the purposes of hidden pore fungi.
The purposes of hidden pore fungi provided by the present invention is following 1)-4) at least one:
1) hidden pore fungi is preparing the application in porcine reproductive and respiratory syndrome virus inhibitor;
2) hidden pore fungi is preparing the application in the product (as medicine) suppressing porcine reproductive and respiratory syndrome virus to copy in host cell;
3) hidden linteus extract is preparing the application in porcine reproductive and respiratory syndrome virus inhibitor, and described hidden linteus extract is the water-soluble substances extracted from hidden pore fungi sporophore;
4) hidden linteus extract is preparing the application in the product (as medicine) suppressing porcine reproductive and respiratory syndrome virus to copy in host cell, and described hidden linteus extract is the water-soluble substances extracted from hidden pore fungi sporophore.
Above-mentioned 1) ,-4), described hidden pore fungi can be sporophore and/or mycelium and/or spore.Described hidden pore fungi sporophore can be fresh sporophore and also can be dry sporophore.
Above-mentioned 2) and 4) in, described host cell can be pig cell, CL2621 cell or MARC44 cell, and described pig cell specifically can be porcine alveolar macrophage.
Above-mentioned 3) and 4) in, described hidden linteus extract can obtain as follows: hidden pore fungi sporophore is pulverized rear flooding, and collection water-soluble substances obtains described hidden linteus extract.
In the preparation method of above-mentioned hidden linteus extract, described hidden pore fungi sporophore can be crushed to 50-80 order.
In the preparation method of above-mentioned hidden linteus extract, described flooding can be 4-65 DEG C (as 4-10 DEG C, 50-65 DEG C, 4 DEG C or 50 DEG C) with flooding 10-14 hour.
In the preparation method of above-mentioned hidden linteus extract, water-soluble substances described in centrifugalize can be adopted.The centrifugal force of described centrifugal employing can be 8000-10000g, and centrifugation time can be 10-20 minute (as 10-15 minute or 15-20 minute).
Experiment of the present invention proves can significantly suppress porcine reproductive and respiratory syndrome virus to copy in porcine alveolar macrophage and cercopithecus aethiops embryo kidney epithelial cell (MARC-145) with hidden linteus extract prepared by hidden pore fungi, that viral load can be made to be reduced to is original ten thousand/, hidden linteus extract does not have obvious toxic and side effects to piglet, the high heat that PRRSV height pathogenic virus strain infection piglet causes can be alleviated, reduce piglet serum-virus titre, improve the survival rate infecting piglet.
Accompanying drawing explanation
Fig. 1 is that mtt assay measures the hidden linteus extract solution of 0-0.7mg/L to the cytotoxicity result of PAMs.
Fig. 2 is that the hidden linteus extract culture fluid of indirect immunofluorescence assay 0-0.6mg/L suppresses PRRSV CH-1a strain to copy result MARC-145 is intracellular.
Marc-145 cell infection PRRSV CH-1a strain (MOI=0.1), after 2 hours, changes containing or does not contain the culture fluid of hidden linteus extract, 24 hours laggard row indirect immunofluorescences, detects virus and copies intracellular.
Fig. 3 is that the hidden linteus extract culture fluid of 0-0.6mg/L suppresses PRRSV CH-1a strain strain to copy MARC-145 is intracellular.
Marc-145 cell infection PRRSV CH-1a (MOI=0.1) is after 2 hours, and change containing or do not contain the culture fluid of hidden linteus extract, 24 h before harvest supernatants survey virus titers.
Fig. 4 is that the hidden linteus extract culture fluid of indirect immunofluorescence assay 0-0.6mg/L suppresses the PRRSV height strain JXwn06 that causes a disease to copy result PAMs is intracellular.
HPV represents the pathogenic strain JXwn06 of PRRSV height.
PAMs cell infection PRRSV height caused a disease strain JXwn06 (MOI=0.1) after 2 hours, changed containing or do not contain the culture fluid of hidden linteus extract, and within 24 hours, laggard row indirect immunofluorescene assay virus copies intracellular.
Fig. 5 is that the hidden linteus extract culture fluid of 0-0.6mg/L suppresses PRRSV VR2332 strain and the PRRSV height strain JXwn06 that causes a disease to copy PAMs is intracellular.
PAMs infects PRRSV VR2332 strain and the pathogenic strain JXwn06 (MOI=0.1) of PRRSV height respectively, after 2h, changes containing or do not contain the culture fluid of hidden linteus extract, receives supernatant and survey virus titer after 37 DEG C of cultivation 24h.
Fig. 6 is the fervescence that the pathogenic strain JXwn06 of hidden linteus extract reduction PRRSV height causes.
Fig. 7 is the serum-virus titre that hidden linteus extract reduces that the pathogenic strain JXwn06 of PRRSV height infects piglet.
Fig. 8 is the survival rate that hidden linteus extract improves that the pathogenic strain JXwn06 of PRRSV height infects piglet.
Fig. 9 is the hidden linteus extract culture fluid pretreatment Marc-145 cell with 0-0.6mg/L, does not suppress PRRSV infection.
Figure 10 is hatched altogether by the hidden linteus extract culture fluid of 0-0.6mg/L and virus, does not have obvious inhibitory action to virus activity.
Figure 11 is the synthesis that hidden linteus extract suppresses PRRSV RNA.
Figure 12 is the impact of hidden linteus extract on the rna polymerase activity that PRRSV RNA relies on.
Figure 13 is the synthesis that hidden linteus extract suppresses PRRSV albumen.
Detailed description of the invention
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Hidden pore fungi (Cryptoporus volvatus (Peck) Shear) (Kohmei KADOWAKI.Behavioral observation of two fungivorous beetles (Coleoptera:Tenebrionidae) on wood-decaying bracket fungus Cryptoporus volvatusens_.EntomologicalScience (2010) 13 in following embodiment, 159 – 161) pick up from Chinese yunnan, the public can from field acquisition, also can obtain from China Agricultural University, to repeat the application's experiment.
Pathogenic strain JXwn06 (the Lei Zhou of PRRSV height in following embodiment, et al.The 30-Amino-AcidDeletion in the Nsp2of Highly Pathogenic Porcine Reproductive and Respiratory SyndromeVirus Emerging in China Is Not Related to Its Virulence.JOURNAL OF VIROLOGY, May2009, p.5156 – 5167), PRRSV CH-1a strain (Xie Liji, Deng. the clone of Guangxi highly pathogenic PRRSV Nsp2 gene, sequence analysis and Epitope prediction. animal medicine is in progress.2008,29 (1): l-4) and PRRSVVR2332 strain (Xie Liji etc. the clone of Guangxi highly pathogenic PRRSV Nsp2 gene, sequence analysis and Epitope prediction. animal medicine is in progress.2008,29 (1): l-4); When meeting the pertinent regulations of national bio-safety, the public can obtain from China Agricultural University, to repeat the application's experiment.
Embodiment 1, prepare porcine reproductive and respiratory syndrome virus inhibitor with hidden pore fungi
One, the preparation of hidden linteus extract
With the dry sporophore of the hidden pore fungi of distilled water immersion, the weight ratio of water and the dry sporophore of hidden pore fungi is 6:1, and 4 DEG C are soaked 2-4 hour, and homogenizer fully blends to 60 orders, 4 DEG C of lixiviates 10 hours, centrifugal 20 minutes of 8000g, and collect supernatant, lyophilizing, obtains hidden linteus extract.The dry sporophore of this hidden pore fungi obtains dry at normal temperatures for fresh hidden pore fungi sporophore.
Hidden linteus extract used in the experiment of following step 2, all also passes through the degerming rear use of metre filter of 0.22 micron with physiological saline solution.
Two, hidden linteus extract suppresses Porcine reproductive and respiratory syndrome (PRRS) virus to copy in porcine alveolar macrophage and cercopithecus aethiops embryo kidney epithelial cell (MARC-145)
Experiment proves, the hidden pore fungi water extract of step 1 can significantly suppress Porcine reproductive and respiratory syndrome (PRRS) virus to copy in porcine alveolar macrophage and cercopithecus aethiops embryo kidney epithelial cell (MARC-145), and titre can be low by 10
4, namely viral load be reduced to original ten thousand/, show that this extract has the ability of very strong suppression PRRS virus.Concrete experimental technique and experimental result as follows:
1, experimental technique
The separation of 1.1 porcine alveolar macrophages and the preparation of virus liquid
By the piglet blood-letting of the specific pathogen free (SPF) in 8 week age, asepticly win its lungs, first wash outer surface with the physiological saline solution of 0.9%, then Hanks balanced salt solution (HBSS) 30.0ml of pH7.2 is poured into lungs from trachea, massage lung surface gently, reclaim irrigating solution after 1 ~ 2min, so repeatedly carry out, till irrigating solution is limpid.By the centrifugal 10min of bronchoalveolar lavage fluid 300g reclaimed, the cell of collection is porcine alveolar macrophage (PAMs).Add appropriate RPMI 1640 (10% hyclone FBS) culture fluid after washing twice with RPMI 1640 and dispel cell, put in culture bottle in 37 DEG C, 5%CO
2cultivate in incubator, after it is adherent, supernatant discarded and non-adherent cell continuation RPMI 1640 (10%FBS) culture fluid are cultivated.
The pathogenic strain JXwn06 of PRRSV height is separated from morbidity pig farm and obtains, and porcine alveolar macrophage is bred.Porcine alveolar macrophage is inoculated into 75cm
2tissue Culture Flask in, after cell attachment, suck supernatant, access the virus liquid 3ml (viral infection plural number MOI=0.5, when namely infecting, ratio that is viral and cell quantity is 0.5) dilute; 37 DEG C of absorption 60min, period rocks culture bottle gently every 15min, fully contacts with cell to make virus liquid; After 60min, add culture fluid, be placed in 37 DEG C of cultivations; After 36h between-80 DEG C and room temperature frozen-thawed cell three times, with cell lysis; Cell pyrolysis liquid is transferred to 50ml centrifuge tube, 4 DEG C, the centrifugal 10min of 5000g, supernatant is virus liquid, is divided by supernatant to be filled to 1.5ml EP and to manage, be stored in-80 DEG C for subsequent use.
1.2 cells are by viral median infective dose (TCID
50) mensuration
Pigs Inoculated pulmonary alveolar macrophage in 96 porocyte culture plates, 37 DEG C, 5%CO
224h is cultivated in incubator; In 1.5ml EP pipe, with cell culture fluid, virus liquid is made the gradient dilution of continuous 10 times, from 10
-1to 10
-7; Be inoculated into by the virus liquid diluted in porcine alveolar macrophage culture plate, each dilution factor inoculates 8 holes, and 100 μ l are inoculated in every hole; If normal cell controls 8 hole; To connect after poison the 4th day, observe and record the quantity in each dilution factor virus-positive hole, calculating viral TCID
50.Obtain the TCID of virus
50can be used for the infection multiplicity (MOI) calculating virus, the ratio of virus and cell quantity when namely infecting.
1.3 indirect immunofluorescences (IFA) method detects virus indirect immunofluorescence with fluorescein-labelled antiglobulin antibody, after antibody is combined with corresponding antigens, fluorescently-labeled antiglobulin antibody is had an effect with the antibody be combined, thus knows the existence of antigen or antibody by inference.
With methanol: acetone (1:1) fixative 4 DEG C of fixed cell 10min; PBS washes twice, the closed 30min of 5% sheep blood serum 37 DEG C; Suck supernatant, add the primary antibodie SDOW17 (1:10,000RuralTechnologies) of anti-PRRS viral N proteins, 4 DEG C are spent the night; PBS washes 3 times, each 5min, adds the rabbit anti-mouse igg two anti-(1:2000, Jackson ImmunoResearch) of green fluorescence FITC labelling, 37 DEG C of lucifuge 1h; PBS washes 3 times, each 5min; Fluorescence microscopy Microscopic observation green fluorescence, green fluorescence represents the virus at time multiplexed cell.
1.4 tetrazolium bromides (MTT) method measures the cytotoxicity of hidden linteus extract
Mtt assay, also known as MTT colorimetry, is a kind of method detecting cell survival and growth.Its Cleaning Principle is that the succinate dehydrogenase in living cells mitochondrion can make exogenous MTT be reduced to water-insoluble bluish violet crystallization first a ceremonial jade-ladle, used in libation (Formazan) and be deposited in cell, and dead cell is without this function.First a ceremonial jade-ladle, used in libation in dimethyl sulfoxide (DMSO) energy dissolved cell, measures its absorbance value with enzyme-linked immunosorbent assay instrument, can indirectly reflect living cells quantity.Within the scope of certain cell number, the amount that MTT crystallization is formed is directly proportional to cell number.
RPMI 1640 (10% hyclone FBS) or DMEM (10% hyclone FBS) culture fluid porcine alveolar macrophage (PAMs) and cercopithecus aethiops embryo kidney epithelial cell (MARC-145) is used to be made into cell suspension respectively, be inoculated into 96 orifice plates, 37 DEG C, 5%CO
224h is cultivated under environment.Dilute hidden linteus extract with culture fluid, obtain the hidden linteus extract culture fluid that hidden linteus extract final concentration is respectively 0.1,0.2,0.3,0.4,0.5,0.6 and 0.7mg/ml, contrast with isopyknic normal saline.Cell culture fluid is abandoned in suction, adds hidden linteus extract culture fluid or the normal saline of isopyknic above-mentioned concentration, hidden linteus extract culture fluid 8 hole of each concentration, normal saline 8 hole; 37 DEG C, 5%CO
2cultivate 48h under environment, every hole adds MTT solution (5mg/ml prepares with the PBS of pH=7.4) 20 μ l, continue to cultivate 4h, carefully inhale the cell culture fluid abandoned in hole, every hole adds 150 μ l DMSO (dimethyl sulfoxide), hatch 10min for 37 DEG C, crystal is fully melted.Absorbance is surveyed at 550nm wavelength place by microplate reader, with cellular control unit survival rate for 100%, the survival rate of experiment with computing group cell:
Experimental group cell survival rate=OD (experimental group)/OD (matched group) %.
1.5 hidden linteus extract suppress the different strains of PRRSV copying on porcine alveolar macrophage (PAMs) and cercopithecus aethiops embryo kidney epithelial cell (MARC-145)
Used by PAMs and MARC-145 RPMI RPMI-1640 (10% hyclone FBS) or DMEM (10% hyclone FBS) culture fluid to be made into cell suspension respectively, be inoculated into 96 orifice plates, 37 DEG C, 5%CO
224h is cultivated under environment.Inoculate PRRSV CH-1a strain (MOI=0.1) respectively, the pathogenic strain JXwn06 (MOI=0.1) of PRRSV height and PRRSV CH-1a strain (MOI=0.1), within after viral infection 2 hours, discard supernatant, add respectively and isopyknicly contain 0, 0.2, 0.4, the fresh RPMI RPMI-1640 of the hidden linteus extract of 0.6mg/ml (dilutes hidden linteus extract with fresh RPMI RPMI-1640, obtain hidden linteus extract final concentration and be respectively 0.2, 0.4 and the hidden linteus extract culture fluid of 0.6mg/ml, to add isopyknic fresh RPMI RPMI-1640 (the fresh RPMI RPMI-1640 of the hidden linteus extract of 0mg/ml) in contrast), hidden linteus extract culture fluid 8 hole of each concentration, 37 DEG C, 5%CO
2cultivate 24h under environment, collect supernatant and measure viral TCID50, detect the decline level of virus in supernatant, fixed cell, does indirect immunofluorescence, the suppression level that Detection and Extraction thing copies intracellular virus simultaneously.
1.6 data analysis
All data are all the independent meansigma methodss obtained in triplicate, the significance of difference is analyzed with two tail T-test (in pairs), P≤0.05 is considered to significant difference, 0.01<P≤0.05 (*), 0.001<P≤0.01 (* *), P≤0.001 (* * *).
2, experimental result
Result shows that the concentration of hidden linteus extract does not all have toxicity (Fig. 1) to porcine alveolar macrophage (PAMs) and cercopithecus aethiops embryo kidney epithelial cell (MARC-145) in the scope of 0.1-0.7mg/ml; The concentration of hidden linteus extract significantly suppresses PRRSV CH-1a strain to copy (Fig. 2 in MARC-145 within the scope of 0.2-0.6mg/ml, Fig. 3), wherein, the PRRSV CH-1a strain added in the Marc-145 cells and supernatant of the hidden linteus extract culture fluid of 0.6mg/ml is 10 to the titre of porcine alveolar macrophage
3.1 ± 0.15tCID
50/ ml is that to add the titre of the PRRSV CH-1a strain in the Marc-145 cells and supernatant of the hidden linteus extract culture fluid of 0mg/ml to porcine alveolar macrophage (be 10
7.0 ± 0.05tCID
50/ ml) ten thousand/.After porcine alveolar macrophage (PAMs) infects PRRSVVR2332 strain and the pathogenic strain JXwn06 of PRRSV height respectively, hidden linteus extract can significantly suppress copying (Fig. 4, Fig. 5) of PRRSV.Wherein, the pathogenic strain JXwn06 of PRRSV height added in the PAMs cells and supernatant of the hidden linteus extract culture fluid of 0.6mg/ml is 10 to the titre of porcine alveolar macrophage
4.56 ± 0.08tCID
50/ ml is the pathogenic titre of strain JXwn06 to porcine alveolar macrophage of PRRSV height added in the PAMs cells and supernatant of the hidden linteus extract culture fluid of 0mg/ml (is 10
7.5 ± 0.02tCID
50/ ml) one thousandth; The PRRSV VR2332 strain added in the PAMs cells and supernatant of the hidden linteus extract culture fluid of 0.6mg/ml is 10 to the titre of porcine alveolar macrophage
2.5 ± 0.04tCID
50/ ml is that to add the titre of the PRRSV VR2332 strain in the PAMs cells and supernatant of the hidden linteus extract culture fluid of 0mg/ml to porcine alveolar macrophage (be 10
5.5 ± 0.03tCID
50/ ml) one thousandth.
Embodiment 2, prepare Porcine reproductive and respiratory syndrome medicine with hidden pore fungi
One, the preparation of hidden linteus extract
With the dry sporophore of the hidden pore fungi of distilled water immersion, the weight ratio of water and the dry sporophore of hidden pore fungi is 7:1, and 4 DEG C are soaked 2-4 hour, homogenizer fully blends to 80 orders, 50 DEG C of lixiviates 10 hours, centrifugal 10 minutes of 8000g, collect supernatant, lyophilizing, obtains hidden linteus extract.The dry sporophore of this hidden pore fungi obtains dry at normal temperatures for fresh hidden pore fungi sporophore.Degerming with the metre filter of the hidden linteus extract of physiological saline solution also by 0.22 micron, obtain hidden linteus extract injection.
Two, hidden linteus extract suppresses the breeding of PRRS virus in pig body
1, experimental technique
Be that the SPF pig in 4 week age of 6-8kg is divided into 2 groups (often organizing 5) at random by 10 body weight, be respectively matched group (only infecting PRRS virus not to hidden linteus extract), administration group (infect PRRS virus, give hidden linteus extract simultaneously).With 1ml (TCID50=10
5) PRRSV height pathogenic strain JXwn06 collunarium infection SPF pig, every pig abdominal cavity of administration group and the intramuscular injection each 5ml of above-mentioned hidden linteus extract injection (12mg/ml), continuous 7 days, twice daily, every pig of matched group injected isopyknic normal saline.Within 3rd, 7,10,16 and 45 day, take a blood sample before infection with after infection, collect serum, by real-time PCR method, detection by quantitative is done to PRRS virus; Every day surveys body temperature, observed and recorded clinical symptoms.At any time necropsy is carried out to the dead pig of morbidity, at the 42nd day, necropsy is carried out to all survival pigs.
The step of 1.1 pig vena cava anterior blood samplings and separation of serum is as follows:
Adopt to piglets Baoding method of lying on the back, a people grasps two hind legs, as far as possible to rear haulage; Mandibular bone presses down with hands by another people, makes head paste ground, and makes two forelimbs substantially vertical with body center line.Now, the front side of first pair, both sides rib and breastbone junction is two obvious recesses.After iodine tincture and cotton ball soaked in alcohol sterilization skin, recess place is from top to bottom to the right for the supporting pin of hand-held vacuum blood collector (0.7 × 25mm), slightly deflection central authorities and direction, thoracic cavity are thrust, see there is blood back, the other end by the supporting pin of vacuum blood collector inserts vacuum test tube, start blood sampling, every piglets adopts 4-5ml blood.Take a blood sample complete, left hand takes cotton ball soaked in alcohol to press pin hole place, and the right hand extracts blood-collecting needle tube rapidly, after slightly hemostasis carved by tabletting, removes Baoding.
Blood taking tube is placed in 37 DEG C of 2h, then 4 DEG C are spent the night, and serum can be separated out, and by the serum collection of precipitation in 1.5mlEP pipe, 4000g, 4 DEG C of centrifugal 10min, discard precipitation, by serum keeping in-80 DEG C, for detecting viral RNA.
Virus titer in 1.2Real-Time PCR standard measure serum
The test kit produced with OMEGA Viral RNA Kit company extracts the viral RNA in serum.Operate by the requirement of test kit description.By 560 μ l QVL lysates, 5.6 μ l carrier RNA and 10 μ l 2 mercapto ethanols join in 1.5ml EP pipe.Get 140 μ l serum to join in the EP pipe containing lysate.Incubated at room 5-10min.560 μ l dehydrated alcohol are added, concussion mixing 30s in sample.By in test kit
rNA adsorption column loads in the collecting pipe of 2ml, and the mixed liquor 650 μ l getting step adds in adsorption column, and 10, the centrifugal 30s of 000g, discard the liquid in collecting pipe, adsorption column is inserted in new collecting pipe, repeat previous step until all mixed liquors are all transferred to adsorption column.In adsorption column, add 500 μ l RWA washing liquids, the centrifugal 30s of 10,000g, discards the liquid in collecting pipe, is inserted in new collecting pipe by adsorption column.In adsorption column, add 500 μ l RWB washing liquids, the centrifugal 30s of 10,000g, discards the liquid in collecting pipe, is inserted by adsorption column in collecting pipe, the centrifugal 3min of 12,000g.Adsorption column is placed in new 1.5ml EP pipe, the central authorities to adsorption column add the H of 50 μ l DEPC process
2o.The RNA that incubated at room 5min, 10,000g centrifugal 1min eluting adsorption column adsorbs, is stored in-80 DEG C and is used for quantitatively by RNA.
Get 2 μ l RNA and be RT-PCR.2 μ l RNA and 1 μ l Random Primer (10 μm, TaKaRa) are added, mixing in 250 μ l PCR pipe; 70 DEG C of 5min, put cooled on ice 2min rapidly; Following component is added: M-MLV 5 × Reaction Buffer 5 μ l in said mixture, dNTP (2.5mM each) 5 μ l, RecombinantRNasinRibonuclease Inhibitor 25units, M-MLV RT (Promega) 200units, finally adds DEPC water polishing volume to 25 μ l; Mix gently, 37 DEG C of 60min; PCR pipe is transferred to 70 DEG C, 15min; Be placed in cooled on ice, cDNA product is stored in-20 DEG C.
Real-Time PCR uses SYBR Premix Ex TaqTM II (the Perfect Real Time) reaction system of TaKaRa.
premix Ex TaqTM (2 ×) 10 μ l, PCR primer ORF7F (AATAACAACGGCAAGCAGCA), each 0.8 μ l of ORF7R (GCACAGTATGATGCGTCGGC) (10 μm), ROX Reference Dye II (50 ×) 0.4 μ l, cDNA template 2 μ l, aseptic double-distilled water 6 μ l, cumulative volume 20 μ l.ABI 7900Real-Time PCR System reacts, takes two-step method pcr amplification standardization program: 95 DEG C of 30s; 95 DEG C of 5s, 60 DEG C of 30s (40 circulations).By SDS2.2.2for 7900 software analysis process data.Standard substance are made (by the PRRSVORF7DNA fragment shown in sequence 1 and pcDNA3.1 carrier (Invitrogen with the plasmid of the PRRSV ORF7 of known copy number, catalog number (Cat.No.) K480001) connect the recombiant plasmid that the obtains standard substance as PRRSV ORF7), Real-Time PCR is after 10 times of gradient dilutions, standard curve is done, according to standard curve to virus RNA quantification with the logarithm of Ct value to plasmid copy number.
2, experimental result
Experimental result shows, hidden linteus extract does not have obvious toxic and side effects to piglet, the high heat (Fig. 6) that PRRSV height pathogenic virus strain infection piglet causes can be alleviated, reduce piglet serum-virus titre (Fig. 7), improve the survival rate (Fig. 8) infecting piglet.Wherein, administration group serum-virus titre of the 10th day after counteracting toxic substances is 1/5th of matched group, administration group can't detect virus titer in the serum of the 45th day after counteracting toxic substances, and matched group is in all death in the 12nd day after counteracting toxic substances, administration group survival rate of the 16th day after counteracting toxic substances is 80%, and administration group survival rate of the 45th day after counteracting toxic substances is 60%.
The mechanism of embodiment 3, the anti-porcine reproductive and respiratory syndrome virus of hidden linteus extract
One, the preparation of hidden linteus extract
With the dry sporophore of the hidden pore fungi of distilled water immersion, the weight ratio of water and the dry sporophore of hidden pore fungi is 6:1, and 4 DEG C are soaked 2-4 hour, and homogenizer fully blends to 50 orders, 4 DEG C of lixiviates 10 hours, centrifugal 15 minutes of 8000g, and collect supernatant, lyophilizing, obtains hidden linteus extract.The dry sporophore of this hidden pore fungi obtains dry at normal temperatures for fresh hidden pore fungi sporophore.Hidden linteus extract used in the experiment of following step 2, all also passes through the degerming rear use of metre filter of 0.22 micron with physiological saline solution.
Two, the mechanism of the anti-porcine reproductive and respiratory syndrome virus of hidden linteus extract
1, test method
1.1, hidden linteus extract pretreatment Marc-145 (the cercopithecus aethiops embryo kidney epithelial cell) impact on PRRSV infection
Marc-145 DMEM culture fluid (10%FBS) is dispelled, is made into cell suspension, be inoculated into 96 orifice plates, 37 DEG C, 5%CO
224h is cultivated under environment.Removing culture fluid, changes the fresh medium containing the hidden linteus extract of variable concentrations, 37 DEG C, 5%CO
2hatch 2h under environment, removing, containing the culture fluid of hidden linteus extract, infects PRRSV CH-1a strain (MOI=0.1), continues to cultivate 24h, receives cells and supernatant and measures virus titer according to the method for embodiment 1.
Wherein, fresh medium containing the hidden linteus extract of variable concentrations be containing 0,0.2,0.42, the fresh DMEM culture fluid of the hidden linteus extract of 0.6mg/ml (dilutes hidden linteus extract with fresh DMEM culture fluid, obtain hidden linteus extract final concentration be respectively 0.2,0.4, the hidden linteus extract culture fluid of 0.6mg/ml, contrast with isopyknic fresh DMEM culture fluid (the fresh DMEM culture fluid of the hidden linteus extract of 0mg/ml)).
1.2, the direct killing effect of hidden linteus extract to PRRSV is measured
By containing 0,0.2,0.4, the fresh DMEM culture fluid of the hidden linteus extract of 0.6mg/ml and the PRRSV (10 of equivalent
5tCID50) hatch 1h and 3h altogether at 37 DEG C, after having hatched, measure virus titer according to the method for embodiment 1.
1.3, the synthesis that hidden linteus extract suppresses PRRSV RNA in Marc-145 cell is measured
Suppress the synthesis of PRRSV RNA in Marc-145 to be dispelled by Marc-145 DMEM culture fluid (10%FBS), be made into cell suspension, be inoculated into six orifice plates, 37 DEG C, cultivate 24h under 5%CO2 environment.Inoculation PRRSVCH-1a strain (MOI=0.01), after viral infection, 24h discards supernatant, add respectively containing 0, 0.2, the fresh DMEM culture fluid of the hidden linteus extract of 0.5mg/ml (dilutes hidden linteus extract with fresh DMEM culture fluid, obtain the hidden linteus extract culture fluid that hidden linteus extract final concentration is respectively 0.2 and 0.5mg/ml, to add isopyknic fresh DMEM culture fluid (the fresh DMEM culture fluid of the hidden linteus extract of 0mg/ml) in contrast), respectively at changing after liquid 6, 12, 24, 48, 72h receives cell, extract cell total rna and be Real-Time PCR.Make standard substance with the plasmid (with embodiment 2) of the PRRSV ORF7 of known copy number, be Real-TimePCR after 10 times of gradient dilutions, do standard curve, according to standard curve to virus RNA quantification with the logarithm of Ct value to plasmid copy number.
Wherein, RNA extraction, reverse transcription and Real-Time PCR method are as follows: every 5-10 × 10
6individual cell adds 1ml Trizol (invitrogen), and repeatedly with pipettor piping and druming mixing, room temperature leaves standstill 5min; In above-mentioned EP pipe, add 0.2ml chloroform, cover EP pipe lid, concussion 15 seconds of exerting oneself in hands, room temperature leaves standstill 10min; 4 DEG C, the centrifugal 15min of 12000g; Get upper strata aqueous phase and be placed in new EP pipe, add 0.5ml isopropyl alcohol, room temperature leaves standstill 10min; 4 DEG C, the centrifugal 10min of 12000g; Carefully abandon supernatant, add 1ml 75% ethanol and wash, 4 DEG C, the centrifugal 5min of 7500g, abandon supernatant; Allow the RNA at room temperature natural drying of precipitation, finally add 20l DEPC water dissolution RNA, with Nanodrop 1000 (Thermo scientific) quantitatively RNA.
Get 500ng RNA and be RT-PCR.500ng RNA and 1 μ l RandomPrimer (10 μMs, TaKaRa) is added, mixing in 250l PCR pipe; 70 DEG C of 5min, put cooled on ice 2min rapidly; Following component is added: M-MLV 5 × Reaction Buffer 5 μ l in said mixture, dNTP (2.5mM each) 5 μ l, RecombinantRNasinRibonuclease Inhibitor 25units, M-MLV RT (Promega) 200units, finally adds DEPC water polishing volume to 25 μ l; Mix gently, 37 DEG C of 60min; PCR pipe is transferred to 70 DEG C, 15min; Be placed in cooled on ice, cDNA product is stored in-20 DEG C.Real-Time PCR uses SYBR Premix ExTaqTM II (the Perfect Real Time) reaction system of TaKaRa.
premix Ex TaqTM (2 ×) 10 μ l, PCR primer ORF7F (AATAACAACGGCAAGCAGCA), each 0.8 μ l of ORF7R (GCACAGTATGATGCGTCGGC) (10 μm), ROX Reference Dye II (50 ×) 0.4 μ l, cDNA template 2 μ l, aseptic double-distilled water 6 μ l, cumulative volume 20 μ l.ABI 7900Real-Time PCR System reacts, takes two-step method pcr amplification standardization program: 95 DEG C of 30s; 95 DEG C of 5s, 60 DEG C of 30s (40 circulations).By SDS2.2.2for 7900 software analysis process data.
1.4, the impact of hidden linteus extract on the rna polymerase activity that PRRSV RNA relies on is measured
RNA polymerase (the method preparation according in following document: De Novo Initiationof RNA Synthesis by the ArterivirusRNA-Dependent RNA Polymerase.JOURNAL OFVIROLOGY that PRRSV RNA relies on, Aug.2007, p.8384 – 8395), in vitro in reaction system, the RNA polymerase that RNA relies on can with poly (U) 18 for template, take ATP as substrate, from 5, to 3, synthesis poly (A) 18, poly (A) 18 is adsorbed with filter paper Binding experiment (filter-binding assays), reaction rna polymerase activity.Ion-exchange cellulose chromatography paper DE81-paper (DE81-filer), with the weak base anion exchanger of diethyl amino ethyl group functional group, can the isotope-labeled RNA chain of binding radioactivity, by reactant liquor by after filter paper, by detecting the amount of the RNA chain that the isotope signals quantitative filter paper on filter paper adsorbs, thus the activity of reaction RNA polymerase.
Following reactant liquor is configured: 5x reaction buffer (250mM HEPES (pH 8.0), 50mMKCl, 5mM DTT, 10mM MnCl in 1.5ml EP pipe
2, 4mM MgCl
2) 10 μ l, PRRSV RNA rely on RNA polymerase nsp92 μM, polyU (18) 400nM, [
32p] ATP 0.5-2.5 μ Ci, ATP 100 μMs, RRI 50unit, the hidden linteus extract normal saline solution of different volumes, make hidden linteus extract final concentration be respectively 0,0.01,0.05,0.1mg/ml; Use DEPC H
2o polishing volume to 50 μ l.30 degree of reaction 60min, add isopyknic 50mM EDTA cessation reaction.50 μ l reactant liquors are dropped on DE-81 (whatman) filter membrane, dry.Three times are washed, each 2min with 0.3M ammonium formate (PH8.0), dry.Add liquid scintillation counting reactant liquor, with instrument counting counts per minute.During not add hidden linteus extract, the activity of RNA polymerase is for 100%, analyzes the impact of hidden linteus extract on the rna polymerase activity that PRRSV RNA relies on.
1.5, the synthesis that hidden linteus extract suppresses PRRSV protein in Marc-145 cell is measured
Suppress the synthesis of PRRSV protein in Marc-145 cell to be dispelled by Marc-145 cell DMEM culture fluid (10%FBS), be made into cell suspension, be inoculated into six orifice plates, 37 DEG C, 5%CO
224h is cultivated under environment.Inoculation PRRSV CH-1a strain (MOI=0.5), after viral infection, 2h discards supernatant, add respectively containing 0,0.2, the fresh medium of the hidden linteus extract of 0.6mg/ml (dilutes hidden linteus extract with fresh DMEM culture fluid, obtain the hidden linteus extract culture fluid that hidden linteus extract final concentration is respectively 0.2 and 0.6mg/ml, contrast with isopyknic fresh DMEM culture fluid (the fresh DMEM culture fluid of the hidden linteus extract of 0mg/ml)), continue to cultivate 24h, remove cell culture fluid, wash one time with PBS.In 6 orifice plates, every porocyte adds the RIPA lysate (Bo Maide) of 200 μ l containing 1mM protease inhibitor PMSF, under several with pipettor piping and druming, lysate is fully contacted with cell.After abundant cracking, the centrifugal 5min of 14,000g, gets supernatant, is the total protein that cell lysis obtains, is Western-blot.Western-blot and Western immunoblotting, is move on on film by protein transduction, then utilizes antibody to detect.What Western Blot adopted is polyacrylamide gel electrophoresis, and detected material is protein, and " probe " is antibody, and " colour developing " resists with two of labelling.Through PAGE be separated protein example, transfer on solid phase carrier (such as cellulose nitrate film), solid phase carrier with non-covalent bond form adsorbed proteins, and can keep the polypeptide forms of electrophoretic separation and biologic activity constant.Using the protein on solid phase carrier or polypeptide as antigen, immunoreation is played with corresponding antibody, react with enzyme or isotope-labeled second antibody again, through substrate colour developing or autoradiography to detect the protein ingredient of the specific destination gene expression of electrophoretic separation.
Quantitative to total protein BCA determination of protein concentration test kit (enhancement mode) (the green skies).Get appropriate 25mg/ml protein standard BSA, being diluted to final concentration with PBS is 0.5mg/ml; Quantity per sample, adds 1 volume BCA reagent B (50:1) by 50 volume BCA reagent A and prepares appropriate BCA working solution, fully mix; Standard substance are added in the standard sample wells of 96 orifice plates by 0,1,2,4,8,12,16,20 μ l, add PBS and supply 20 μ l; Add 2 μ l samples in the sample well of 96 orifice plates, add PBS to 20 μ l; Each hole adds 200 μ l BCA working solutions, places 30min for 37 DEG C; Measure A562, calculate the protein concentration of sample according to standard curve.
Be separated 15 μ g protein samples with 10%SDS-PAGE gel electrophoresis, concentrated glue voltage 80V, separation gel voltage 120V, when bromophenol blue indicator arrives bottom gel, namely stop electrophoresis; Then protein sample is transferred to pvdf membrane (Millipore) at 4 DEG C from gel, electric current 40mA, 2h; After transferring film terminates, pvdf membrane is taken out from electric turn trough, with 5% defatted milk powder (being dissolved in 1 ╳ PBST) at 37 DEG C of closed 1h; With 5% defatted milk powder dilution primary antibodie anti-PRRSV N proteinSDOW17 (1:5,000; Rural Technologies) or anti--actin (1:5,000; Clone AC-15; Sigma, St.Louis, MO), 4 DEG C of overnight incubation, wash 3 times with 1X PBST, each 5min; Dilute two anti-HRP-rabbit against murine two anti-(1:10,000, health is century) with 5% defatted milk powder, hatch 1h for 37 DEG C, 1X PBST washes 3 times, each 5min; Finally use high sensitivity chemistry luminescence detection kit (health is century) development.
Wherein, β-actin (beta-actin) is a kind of major protein components in muscle rhabdomyosarcoma fiber, also be the main component of muscle filament and cytoskeletal filament, there is contractile function, widely distributed, expression relative constancy in each tissue and cell, commonly use it to make object of reference when the expression change detecting albumen, this experiment also uses β-actin in contrast.
1.6, data analysis
All data are all the independent meansigma methodss obtained in triplicate, the significance of difference is analyzed with two tail T-test (in pairs), P≤0.05 is considered to significant difference, 0.01<P≤0.05 (*), 0.001<P≤0.01 (* *), P≤0.001 (* * *).
2, experimental result
All concentration (0.2-0.6mg/ml) hidden linteus extract culture fluid pretreatment Marc-145 (cercopithecus aethiops embryo kidney epithelial cell), does not suppress the infection (Fig. 9) of PRRSV.Hidden linteus extract directly processes PRRSV, hatches 1h, and the process of all concentration (0.2-0.6mg/ml) hidden linteus extract culture fluid does not all have lethal effect to virus; Hatch 3h, concentration is that the process of 0.2mg/ml does not have lethal effect to virus, and the process of 0.4mg/ml and 0.6mg/ml has slight lethal effect (Figure 10) to virus.After PRRSV infection cell, 24h adds hidden linteus extract, the synthesis of viral RNA can be suppressed, the hidden linteus extract culture fluid of 0.5mg/ml after the addition 6h obviously can suppress the synthesis of viral RNA, 48h after the addition, extract is the most obvious for the inhibitory action of viral RNA, during to 72h, the cell of matched group can be dead because of the infection of virus, so the amount of cellular control unit inner virus RNA also can decline (Figure 11).The activity of the RNA polymerase that hidden linteus extract just can obviously suppress PRRSV RNA to rely at low concentration, when concentration is 0.01mg/ml, the activity decrease to 60% (Figure 12) of the RNA polymerase that PRRSV RNA relies on.Hidden linteus extract can suppress PRRSV synthetic proteins in cell, after virus infected cell, 2h adds hidden linteus extract, the expression of viral N proteins is detected after 24h, compared with the control, hidden linteus extract can the synthesis of suppression viral N proteins of dose dependent, and the hidden linteus extract culture fluid of 0.6mg/ml can't detect the expression (Figure 13) of viral N proteins.
Claims (4)
1. hidden linteus extract is preparing the application in porcine reproductive and respiratory syndrome virus inhibitor, and described hidden linteus extract is the water-soluble substances extracted from hidden pore fungi sporophore; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is pathogenic strain JXwn06, PRRSV CH-1a strain of PRRSV height or PRRSV VR2332 strain.
2. hidden linteus extract is preparing the application in the product suppressing porcine reproductive and respiratory syndrome virus to copy in host cell, and described hidden linteus extract is the water-soluble substances extracted from hidden pore fungi sporophore; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is pathogenic strain JXwn06, PRRSV CH-1a strain of PRRSV height or PRRSV VR2332 strain.
3. hidden pore fungi is preparing the application in porcine reproductive and respiratory syndrome virus inhibitor; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is pathogenic strain JXwn06, PRRSV CH-1a strain of PRRSV height or PRRSV VR2332 strain.
4. hidden pore fungi is preparing the application in the product suppressing porcine reproductive and respiratory syndrome virus to copy in host cell; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is pathogenic strain JXwn06, PRRSV CH-1a strain of PRRSV height or PRRSV VR2332 strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210460451.4A CN102920745B (en) | 2012-11-15 | 2012-11-15 | Novel use of cryptoporus volvatus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210460451.4A CN102920745B (en) | 2012-11-15 | 2012-11-15 | Novel use of cryptoporus volvatus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102920745A CN102920745A (en) | 2013-02-13 |
| CN102920745B true CN102920745B (en) | 2015-07-15 |
Family
ID=47635770
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210460451.4A Expired - Fee Related CN102920745B (en) | 2012-11-15 | 2012-11-15 | Novel use of cryptoporus volvatus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102920745B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103908477A (en) * | 2014-01-21 | 2014-07-09 | 中国医学科学院药用植物研究所 | Use of cryptoporus volvatus(Peck)Shear extract in in-vivo and in-vitro inhibition of influenza viruses |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1405314A (en) * | 2001-08-17 | 2003-03-26 | 杭州泰士生物科技有限公司 | Cryptoporus volvatus fermented product, and its preparation method and application |
| CN100509856C (en) * | 2005-08-23 | 2009-07-08 | 杭州赐富生物技术有限公司 | Cryptoporus volvatus polysaccharide, preparation and application thereof |
| CN101803531B (en) * | 2010-03-26 | 2012-08-08 | 中国科学院微生物研究所 | China cryptoporus sinensis and solid cultural method and application thereof |
| CN102920748B (en) * | 2012-11-15 | 2014-04-16 | 中国农业大学 | Application of cryptoporus volvatus in preparation of products for curing porcine reproductive and respiratory syndrome (PRRS) |
| CN102920747B (en) * | 2012-11-15 | 2014-04-16 | 中国农业大学 | Application of cryptoporus volvatus in preparation of products for inhibiting porcine reproductive and respiratory syndrome virus (PRRSV) |
-
2012
- 2012-11-15 CN CN201210460451.4A patent/CN102920745B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN102920745A (en) | 2013-02-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kong et al. | Chinese herbal ingredients are effective immune stimulators for chickens infected with the Newcastle disease virus | |
| Le Deuff et al. | Effects of temperature on herpes-like virus detection among hatchery-reared larval Pacific oyster Crassostrea gigas | |
| CA2127991A1 (en) | Preparation of antigens of and of vaccines for the virus of mystery disease, antigens and vaccines obtained for the prevention of this disease | |
| CN103169773B (en) | Traditional Chinese medicine compound preparation for enhancing livestock immunity and preparation method | |
| CN101007067A (en) | Antivirus medicine for birds and its preparation method | |
| CN102215851B (en) | Anti-influenza viral composition containing bark or stem extract of alnus japonica | |
| CN114788844A (en) | Application of polygonum flaccidum flavone ethyl acetate part in resisting porcine pseudorabies virus and medicament for resisting porcine pseudorabies virus | |
| Studdert et al. | Isolation and characterisation of an equine rhinovirus | |
| CN102920745B (en) | Novel use of cryptoporus volvatus | |
| CN109419804B (en) | Antiviral plant-derived preparation for livestock and poultry | |
| CN102920748B (en) | Application of cryptoporus volvatus in preparation of products for curing porcine reproductive and respiratory syndrome (PRRS) | |
| CN102920747B (en) | Application of cryptoporus volvatus in preparation of products for inhibiting porcine reproductive and respiratory syndrome virus (PRRSV) | |
| CN108969492A (en) | A kind of swine fever takes orally weak malicious freeze dried vaccine and preparation method thereof | |
| CN104888213A (en) | Preparation method of classical swine fever spleen-lymph-sourced compound living vaccine | |
| CN103655684A (en) | Traditional Chinese herbal medicine microecological preparation capable of killing and inhibiting foot and mouth disease virus in vitro and in vivo | |
| CN103505724A (en) | Swine fever and porcine pseudorabies bivalent vaccine as well as preparation method and application thereof | |
| KR102402794B1 (en) | Composition for antiviral activity containing oil distilled from Pinus densiflora xylem | |
| CN111686246B (en) | Antigen-antibody complex vaccine for porcine epidemic diarrhea virus and preparation method thereof | |
| CN103275937A (en) | Recombinant virus expressing PCV2 codon optimized ORF1 and ORF2 tandem gene | |
| CN1919270B (en) | Composition, exract, and pharmaceutical use thereof | |
| CN102764432A (en) | Chinese giant salamander viral hemorrhagic disease cell culture-based inactivated vaccine, its preparation method and application thereof | |
| Balamurugan et al. | Potential Effect of Acacia arabica. on Peste des Petits Ruminants. Virus Replication | |
| CN105853406A (en) | Application of procyanidine in preparation of medicine for preventing and treating porcine reproductive and respiratory syndrome | |
| Keles et al. | Vaccination with glutaraldehyde-fixed bovine respiratory syncytial virus (BRSV)-infected cells stimulates a better immune response in lambs than vaccination with heat-inactivated cell-free BRSV | |
| CN114588168B (en) | Application of toosendanin in preparing medicine for preventing and treating swine virus infectious diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150715 Termination date: 20201115 |