CN102920747B - Application of cryptoporus volvatus in preparation of products for inhibiting porcine reproductive and respiratory syndrome virus (PRRSV) - Google Patents
Application of cryptoporus volvatus in preparation of products for inhibiting porcine reproductive and respiratory syndrome virus (PRRSV) Download PDFInfo
- Publication number
- CN102920747B CN102920747B CN201210460444.4A CN201210460444A CN102920747B CN 102920747 B CN102920747 B CN 102920747B CN 201210460444 A CN201210460444 A CN 201210460444A CN 102920747 B CN102920747 B CN 102920747B
- Authority
- CN
- China
- Prior art keywords
- pore fungi
- prrsv
- hidden pore
- strain
- respiratory syndrome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses a new use of cryptoporus volvatus. The new use of cryptoporus volvatus, which is provided by the invention, is at least one from 1), 2) and 3): 1), the application of cryptoporus volvatus or extract of cryptoporus volvatus to the preparation of products for inhibiting porcine reproductive and respiratory syndrome virus (PRRSV) from synthetizing ribonucleic acid (RNA) in a host cell; 2) the application of cryptoporus volvatus or the extract of cryptoporus volvatus to the preparation of PRRSV RNA-dependent RNA polymerase active products; and 3) the application of cryptoporus volvatus or the extract of cryptoporus volvatus to products for inhibiting the PRRSV from synthetizing protein in the host cell.
Description
Technical field
The present invention relates to the new purposes of hidden pore fungi, particularly hidden pore fungi suppresses the application in porcine reproductive and respiratory syndrome virus product in preparation.
Background technology
Porcine reproductive and respiratory syndrome (being commonly called as reproductive and respiratory syndrome) (Porcine Reproductive and Respiratory Syndrome, PRRS) be the infectious disease of the pig that caused by porcine reproductive and respiratory syndrome virus (PRRS virus, PRRSV).This virus of the equal easy infection of pig at various ages, its cardinal symptom is to cause miscarriage, stillborn fetus, mummy tire and weak tire after in-pig infects, and infects piglet respiratory disorder and high case fatality rate can occur.This disease is in 1987 in U.S.'s reported first, and middle nineteen nineties in last century is imported China into.At present, this disease betides nearly all country of raising pigs in the world, for China and world's pig industry have caused great economic loss.Within 2006, in China, broken out the pathogenic Porcine reproductive and respiratory syndrome of the height being caused by PRRSV variant, its feature is that acute height is lethal, and piglet sickness rate can reach 100%, and mortality rate is up to 50%, sow abortion ratio reaches more than 35%, and sow and growing and fattening pigs mortality rate are up to 30%.The high Porcine reproductive and respiratory syndrome that causes a disease of this time outburst has caused huge economic loss to China's pig industry.
Porcine reproductive and respiratory syndrome is the viral infectious being caused by porcine reproductive and respiratory syndrome virus (PRRSV).PRRSV belongs to many viraleses of Buddhist nun Arteriviridae Arterivirus, for there being the single strand plus RNA virus of cyst membrane, the about 15.4kb of genome total length, virus is ripe in cytoplasm, endoplasmic reticulum and Golgi body assembling, and discharge and be gathered in cell intracellular vesicle with the form of sprouting, then transporte to cells film is discharged into extracellular, completes the virus replication cycle.
At present, prevention and control PRRS viral infection and propagation are main by vaccine, but unsuccessful.For the vaccine of PRRS virus, comprise that attenuated vaccine and inactivated vaccine apply for many years, but still occur with the vaccine strain reproductive and respiratory syndrome that almost consistent strain causes.Atypia or acute reproductive and respiratory syndrome break out immune swinery, and the height in China outburst in 2006 causes a disease, and query especially by the protectiveness to current vaccine used and safety for reproductive and respiratory syndrome.Therefore, developing special, efficient anti-PRRS virus drugs has important practical significance to prevention and control reproductive and respiratory syndrome.
(Cryptoporus volvatus (Peck) Shear is a kind of wild macro fungi being born on pine forest trunk to hidden pore fungi, also on the trunk or dry wood of being born in old and feeble fir, PiceameyeriRehd. Et Wils. on the books, there is distribution in multiple provinces such as the Yunnan of China, Guangdong, Guangxi, Hainan.Hidden pore fungi sporophore is less, stockless or have once in a while handle, general adnation on base thing, suberin, oblate spheroid or subsphaeroidal, 1.5-3.5cm × 2-4.5cm, thick 1-3cm, cap surface is smooth, shallow khaki or dark eggshell color, old after light red brown.Edge is pure sliding and thick, is connected with velum.Velum white is white to dirt, and obviously different from cap tone, thick about 1mm.Tube layer is by velum institute clad, and the initial stage seals completely, after near base portion, there is a circle or rotund aperture gradually, occasionally have two, aperture 2-4.5mm.Bacterial context is pure white to dirty white, soft suberin, thick 2-8mm.Tube is with bacterial context color, long 2-5mm, and the mouth of pipe is circular to nearly polygon, the light pink Lycoperdon polymorphum Vitt of mouth of pipe face or band brown, every millimeter 3-5, wall thickness, peristoma is complete.Spore is smooth, colourless, oblong, 10-13 μ m × 4-6 μ m.When weaning, Lijiang, yunnan children's Zeng Zuowei among the people sucks thing, or be decocted in water for oral dose treatment tracheitis and asthma.
Summary of the invention
Technical problem to be solved by this invention is to provide the new purposes of hidden pore fungi.
The new purposes of hidden pore fungi provided by the present invention is following 1)-6) at least one:
1) application of hidden pore fungi in the product (as medicine) of preparation inhibition porcine reproductive and respiratory syndrome virus synthetic RNA in host cell.
2) application in the rna polymerase activity product (as medicine) that hidden pore fungi relies at preparation inhibition porcine reproductive and respiratory syndrome virus RNA.
3) application of hidden pore fungi in the product (as medicine) of preparation inhibition porcine reproductive and respiratory syndrome virus synthetic protein in host cell.
4) application of hidden pore fungi extract in the product (as medicine) of preparation inhibition porcine reproductive and respiratory syndrome virus synthetic RNA in host cell, described hidden pore fungi extract is the water-soluble substances extracting from hidden pore fungi sporophore.
5) application in the rna polymerase activity product (as medicine) that hidden pore fungi extract relies at preparation inhibition porcine reproductive and respiratory syndrome virus RNA.
6) hidden pore fungi extract suppresses the application of (as medicine) in the product of porcine reproductive and respiratory syndrome virus synthetic protein in host cell in preparation, and described hidden pore fungi extract is the water-soluble substances extracting from hidden pore fungi sporophore.
Above-mentioned 1)-6) in, described hidden pore fungi can be sporophore and/or mycelium and/or spore.Described hidden pore fungi sporophore can be fresh sporophore and also can be dry sporophore.Described host cell can be pig cell, CL2621 cell or MARC44 cell, and described pig cell specifically can be porcine alveolar macrophage.
In above-mentioned application, described hidden pore fungi extract can obtain as follows: after hidden pore fungi sporophore is pulverized, by flooding, collect water-soluble substances and obtain described hidden pore fungi extract.
In the preparation method of above-mentioned hidden pore fungi extract, described hidden pore fungi sporophore can be crushed to 50-80 order.
In the preparation method of above-mentioned hidden pore fungi extract, described with flooding can be 4-65 ℃ (as 4-10 ℃, 50-65 ℃, 4 ℃ or 50 ℃) with flooding 10-14 hour.
In the preparation method of above-mentioned hidden pore fungi extract, can adopt water-soluble substances described in centrifugalize.The centrifugal force of described centrifugal employing can be 8000-10000g, and centrifugation time can be 10-20 minute (as 10-15 minute or 15-20 minute).
Of the present inventionly experimental results show that 24h adds hidden pore fungi extract after PRRSV infection cell, the synthetic meeting of viral RNA is suppressed, hidden pore fungi extract culture fluid 6h after adding of 2.5mg/ml can obviously suppress the synthetic of viral RNA, 48h after adding, extract is for the most obviously (Figure 11) of inhibitory action of viral RNA.Hidden pore fungi extract just can obviously suppress the activity of the RNA polymerase of PRRSV RNA dependence at low concentration, when concentration is 0.05mg/ml, the activity of the RNA polymerase that PRRSV RNA relies on drops to 60%(Figure 12).Hidden pore fungi extract can suppress PRRSV synthetic proteins in cell, after virus infected cell, 2h adds hidden pore fungi extract, after 24h, detect the expression of virus N albumen, compared with the control, hidden pore fungi extract can dose dependent inhibition virus N albumen synthetic, the hidden pore fungi extract of 3mg/ml culture fluid can't detect the expression (Figure 13) of virus N albumen.
Accompanying drawing explanation
Fig. 1 is that mtt assay is measured the hidden pore fungi extract solution of the 0-0.7mg/L cytotoxicity result to PAMs.
Fig. 2 is that the hidden pore fungi extract culture fluid of indirect immunofluorescence assay 0-0.6mg/L suppresses PRRSV CH-1a strain in the intracellular result that copies of MARC-145.
Marc-145 cell infection PRRSV CH-1a strain (MOI=0.1), after 2 hours, is changed the culture fluid that contains or do not contain hidden pore fungi extract, and 24 hours laggard row indirect immunofluorescences detect virus and copy intracellular.
Fig. 3 is that the hidden pore fungi extract culture fluid of 0-0.6mg/L suppresses PRRSV CH-1a strain strain and copies MARC-145 is intracellular.
Marc-145 cell infection PRRSV CH-1a(MOI=0.1) after 2 hours, change the culture fluid that contains or do not contain hidden pore fungi extract, after 24 hours, collect supernatant and survey virus titer.
Fig. 4 is that the hidden pore fungi extract culture fluid of indirect immunofluorescence assay 0-0.6mg/L suppresses the high strain JXwn06 of causing a disease of PRRSV in the intracellular result that copies of PAMs.
HPV represents the high strain JXwn06 of causing a disease of PRRSV.
The high strain JXwn06(MOI=0.1 that causes a disease of PAMs cell infection PRRSV) after 2 hours, change the culture fluid that contains or do not contain hidden pore fungi extract, within 24 hours, laggard row indirect immunofluorescene assay virus copies intracellular.
Fig. 5 is that the hidden pore fungi extract culture fluid of 0-0.6mg/L suppresses PRRSV VR2332 strain and the high strain JXwn06 of causing a disease of PRRSV and copies PAMs is intracellular.
PAMs infects respectively PRRSV VR2332 strain and the high strain JXwn06(MOI=0.1 of causing a disease of PRRSV), after 2h, change the culture fluid that contains or do not contain hidden pore fungi extract, after 37 ℃ of cultivation 24h, receive supernatant and survey virus titer.
Fig. 6 is that hidden pore fungi extract reduces the fervescence that the high strain JXwn06 of causing a disease of PRRSV causes.
Fig. 7 is that hidden pore fungi extract reduces the serum-virus titre that the high strain JXwn06 of causing a disease of PRRSV infects piglet.
Fig. 8 is that hidden pore fungi extract improves the survival rate that the high strain JXwn06 of causing a disease of PRRSV infects piglet.
Fig. 9 is the hidden pore fungi extract culture fluid pretreatment Marc-145 cell with 0-0.6mg/L, does not suppress PRRSV and infects.
Figure 10 is hatched altogether by hidden pore fungi extract culture fluid and the virus of 0-0.6mg/L, and virus activity is not had to obvious inhibitory action.
Figure 11 is that hidden pore fungi extract suppresses the synthetic of PRRSV RNA.
Figure 12 is the impact of the rna polymerase activity of hidden pore fungi extract on PRRSV RNA dependence.
Figure 13 is that hidden pore fungi extract suppresses the synthetic of PRRSV albumen.
The specific embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is conventional method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
Hidden pore fungi (Cryptoporus volvatus (Peck) Shear) (Kohmei KADOWAKI.Behavioral observation of two fungivorous beetles (Coleoptera:Tenebrionidae) on wood-decaying bracket fungus Cryptoporus volvatusens_.Entomological Science (2010) 13 in following embodiment, 159 – 161) pick up from Chinese yunnan, the public can be from field acquisition, also can obtain from China Agricultural University, to repeat the application's experiment.
The high strain JXwn06(Lei Zhou that causes a disease of PRRSV in following embodiment, et al.The30-Amino-Acid Deletion in the Nsp2of Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus Emerging in China Is Not Related to Its Virulence.JOURNAL OF VIROLOGY, May2009, p.5156 – 5167), PRRSV CH-1a strain (Xie Liji, Deng. the clone of Guangxi highly pathogenic PRRSV Nsp2 gene, sequence analysis and Epitope prediction. animal medicine progress.2008,29 (1): l-4) and PRRSV VR2332 strain (Xie Liji etc. clone, sequence analysis and the Epitope prediction of Guangxi highly pathogenic PRRSV Nsp2 gene. animal medicine progress.2008,29 (1): l-4); In the case of the pertinent regulations that meet national bio-safety, the public can obtain from China Agricultural University, to repeat the application's experiment.
Embodiment 1, prepare porcine reproductive and respiratory syndrome virus inhibitor with hidden pore fungi
One, the preparation of hidden pore fungi extract
With the dry sporophore of the hidden pore fungi of distilled water immersion, the weight ratio of water and the dry sporophore of hidden pore fungi is 6:1, and 4 ℃ are soaked 2-4 hour, and homogenizer fully blends to 60 orders, 4 ℃ of lixiviates 10 hours, and centrifugal 20 minutes of 8000g, collects supernatant, and lyophilizing, obtains hidden pore fungi extract.The dry sporophore of this hidden pore fungi is by fresh hidden pore fungi sporophore dry obtaining at normal temperatures.
Hidden pore fungi extract used in the experiment of following step 2, all with physiological saline solution and by using after the filter filtration sterilization of 0.22 micron.
Two, hidden pore fungi extract inhibition Porcine reproductive and respiratory syndrome (PRRS) virus copies in porcine alveolar macrophage and cercopithecus aethiops embryo kidney epithelial cell (MARC-145)
The hidden pore fungi water extract that experiment showed, step 1 can significantly suppress Porcine reproductive and respiratory syndrome (PRRS) virus to be copied in porcine alveolar macrophage and cercopithecus aethiops embryo kidney epithelial cell (MARC-145), and titre can be low by 10
4, viral load be reduced to original ten thousand/, show that this extract has the ability of very strong inhibition PRRS virus.Concrete experimental technique and experimental result are as follows:
1, experimental technique
The separation of 1.1 porcine alveolar macrophages and the preparation of virus liquid
By the piglet blood-letting of the specific pathogen free in 8 week age (SPF), aseptic its lungs of winning, first with 0.9% physiological saline solution, wash outer surface, then Hanks balanced salt solution (HBSS) 30.0ml of pH7.2 is poured into lungs from trachea, massage gently lung surface, after 1 ~ 2min, reclaim irrigating solution, so repeatedly carry out, until irrigating solution is limpid.By the centrifugal 10min of bronchoalveolar lavage fluid 300g reclaiming, the cell of collection is porcine alveolar macrophage (PAMs).With adding appropriate RPMI1640(10% hyclone FBS after RPMI1640 washed twice) culture fluid dispels cell, puts in culture bottle in 37 ℃, 5%CO
2in incubator, cultivate supernatant discarded and non-adherent cell continuation RPMI1640(10%FBS after it is adherent) culture fluid cultivation.
The high strain JXwn06 of causing a disease of PRRSV separates and obtains from morbidity pig farm, on porcine alveolar macrophage, breeds.Porcine alveolar macrophage is inoculated into 75cm
2tissue Culture Flask in, after cell attachment, suck supernatant, the virus liquid 3ml(viral infection plural number MOI=0.5 that access dilute, while infecting, ratio viral and cell quantity is 0.5); 37 ℃ of absorption 60min, rock culture bottle every 15min, during this time gently so that virus liquid fully contacts with cell; After 60min, add culture fluid, be placed in 37 ℃ of cultivations; After 36h between-80 ℃ and room temperature frozen-thawed cell three times, with cell lysis; Cell pyrolysis liquid is transferred to 50ml centrifuge tube, 4 ℃, the centrifugal 10min of 5000g, supernatant is virus liquid, and supernatant is divided and is filled to 1.5ml EP pipe, be stored in-80 ℃ standby.
1.2 cells are by viral median infective dose (TCID
50) mensuration
Pigs Inoculated pulmonary alveolar macrophage in 96 porocyte culture plates, 37 ℃, 5%CO
2in incubator, cultivate 24h; In 1.5ml EP pipe, with cell culture fluid, virus liquid is made to the gradient dilution of continuous 10 times, from 10
-1to 10
-7; The virus liquid having diluted is inoculated in porcine alveolar macrophage culture plate, and each dilution factor is inoculated 8 holes, and 100 μ l are inoculated in every hole; If normal cell contrasts 8 holes; Connect poison latter the 4th day, observe and record the quantity in each dilution factor virus-positive hole, calculate viral TCID
50.Obtain viral TCID
50can be used for calculating viral infection multiplicity (MOI), the ratio of virus and cell quantity while infecting.
1.3 indirect immunofluorescences (IFA) method detects virus indirect immunofluorescence with fluorescein-labelled antiglobulin antibody, after antibody is combined with corresponding antigens, fluorescently-labeled antiglobulin antibody is had an effect with the antibody of being combined, thereby knows the existence of antigen or antibody by inference.
With methanol: 4 ℃ of fixed cell 10min of acetone (1:1) fixative; PBS washes 37 ℃ of sealing 30min of twice, 5% sheep blood serum; Suck supernatant, add the primary antibodie SDOW17(1:10 of anti-PRRS virus N albumen, 000Rural Technologies), 4 ℃ are spent the night; PBS washes 3 times, each 5min, and the rabbit anti-mouse igg two that adds green fluorescence FITC labelling resists (1:2000, Jackson Immuno Research),, 37 ℃ of lucifuge 1h; PBS washes 3 times, each 5min; Fluorescence microscopy Microscopic observation green fluorescence, green fluorescence is illustrated in the virus of time multiplexed cell system.
1.4 tetrazolium bromides (MTT) method is measured the cytotoxicity of hidden pore fungi extract
Mtt assay claims again MTT colorimetry, is a kind of method that detects cell survival and growth.Its detection principle is that the succinate dehydrogenase in living cells mitochondrion can make exogenous MTT be reduced to water-insoluble bluish violet crystallization first a ceremonial jade-ladle, used in libation (Formazan) and be deposited in cell, and dead cell is without this function.First a ceremonial jade-ladle, used in libation in dimethyl sulfoxide (DMSO) energy dissolved cell, measures its absorbance value with enzyme-linked immunosorbent assay instrument, can indirectly reflect living cells quantity.Within the scope of certain cell number, the amount that MTT crystallization forms is directly proportional to cell number.
Porcine alveolar macrophage (PAMs) and cercopithecus aethiops embryo kidney epithelial cell (MARC-145) are used respectively to RPMI1640(10% hyclone FBS) or DMEM(10% hyclone FBS) culture fluid is made into cell suspension, is inoculated into 96 orifice plates, 37 ℃, 5%CO
2under environment, cultivate 24h.Dilute hidden pore fungi extract with culture fluid, obtain hidden pore fungi extract final concentration and be respectively 0.1,0.2,0.3,0.4,0.5,0.6 and the hidden pore fungi extract culture fluid of 0.7mg/ml, with isopyknic normal saline, contrast.Cell culture fluid is abandoned in suction, adds hidden pore fungi extract culture fluid or the normal saline of isopyknic above-mentioned concentration, hidden pore fungi extract culture fluid 8 holes of each concentration, normal saline 8 holes; 37 ℃, 5%CO
2under environment, cultivate 48h, every hole adds MTT solution (5mg/ml, with the PBS preparation of pH=7.4) 20 μ l, continue to cultivate 4h, the careful cell culture fluid of abandoning in hole of inhaling, every hole adds 150 μ l DMSO(dimethyl sulfoxide), hatch 10min for 37 ℃, crystal is fully melted.By microplate reader, at 550nm wavelength place, survey absorbance, take cellular control unit survival rate as 100%, the survival rate of experiment with computing group cell:
Experimental group cell survival rate=OD(experimental group)/OD(matched group) %.
1.5 hidden pore fungi extracts suppress the different strains of PRRSV copying on porcine alveolar macrophage (PAMs) and cercopithecus aethiops embryo kidney epithelial cell (MARC-145)
PAMs and MARC-145 are used respectively to RPMI1640 culture fluid (10% hyclone FBS) or DMEM(10% hyclone FBS) culture fluid is made into cell suspension, is inoculated into 96 orifice plates, 37 ℃, 5%CO
2under environment, cultivate 24h.Inoculate respectively PRRSV CH-1a strain (MOI=0.1), the high strain JXwn06(MOI=0.1 that causes a disease of PRRSV) and PRRSV CH-1a strain (MOI=0.1), within after viral infection 2 hours, discard supernatant, add respectively and isopyknicly contain 0, 0.2, 0.4, the fresh RPMI1640 culture fluid of the hidden pore fungi extract of 0.6mg/ml (dilutes hidden pore fungi extract with fresh RPMI1640 culture fluid, obtain hidden pore fungi extract final concentration and be respectively 0.2, 0.4 and the hidden pore fungi extract culture fluid of 0.6mg/ml, to add isopyknic fresh RPMI1640 culture fluid (the fresh RPMI1640 culture fluid of the hidden pore fungi extract of 0mg/ml) in contrast), hidden pore fungi extract culture fluid 8 holes of each concentration, 37 ℃, 5%CO
2under environment, cultivate 24h, collect supernatant and measure viral TCID50, detect the decline level of virus in supernatant, fixed cell, does indirect immunofluorescence, the inhibition level that Detection and Extraction thing copies intracellular virus simultaneously.
1.6 data analysis
All data are all the independent meansigma methodss obtaining in triplicate, paired with two tail T-test() analyze the significance of difference, P≤0.05 is considered to significant difference, 0.01<P≤0.05(*), 0.001<P≤0.01(**), P≤0.001(***).
2, experimental result
Result shows that the concentration of hidden pore fungi extract does not all have toxicity (Fig. 1) to porcine alveolar macrophage (PAMs) and cercopithecus aethiops embryo kidney epithelial cell (MARC-145) in the scope of 0.1-0.7mg/ml; The concentration of hidden pore fungi extract significantly suppresses PRRSV CH-1a strain and copy (Fig. 2 in MARC-145 within the scope of 0.2-0.6mg/ml, Fig. 3), wherein, adding the PRRSV CH-1a strain in the Marc-145 cells and supernatant of the hidden pore fungi extract of 0.6mg/ml culture fluid is 10 to the titre of porcine alveolar macrophage
3.1 ± 0.15tCID
50/ ml is that to add PRRSV CH-1a strain in the Marc-145 cells and supernatant of the hidden pore fungi extract of the 0mg/ml culture fluid titre to porcine alveolar macrophage (be 1
07.0 ± 0.05tCID
50/ ml) ten thousand/.Porcine alveolar macrophage (PAMs) infects respectively after PRRSV VR2332 strain and the high strain JXwn06 of causing a disease of PRRSV, and hidden pore fungi extract can significantly suppress copy (Fig. 4, Fig. 5) of PRRSV.Wherein, adding the high strain JXwn06 of causing a disease of PRRSV in the PAMs cells and supernatant of the hidden pore fungi extract of 0.6mg/ml culture fluid is 10 to the titre of porcine alveolar macrophage
4.56 ± 0.08tCID
50/ ml is that to add the high strain JXwn06 of causing a disease of PRRSV in the PAMs cells and supernatant of the hidden pore fungi extract of the 0mg/ml culture fluid titre to porcine alveolar macrophage (be 10
7.5 ± 0.02tCID
50/ ml) one thousandth; Adding the PRRSV VR2332 strain in the PAMs cells and supernatant of the hidden pore fungi extract of 0.6mg/ml culture fluid is 10 to the titre of porcine alveolar macrophage
2.5 ± 0.04tCID
50/ ml is that to add PRRSV VR2332 strain in the PAMs cells and supernatant of the hidden pore fungi extract of the 0mg/ml culture fluid titre to porcine alveolar macrophage (be 10
5.5 ± 0.03tCID
50/ ml) one thousandth.
One, the preparation of hidden pore fungi extract
With the dry sporophore of the hidden pore fungi of distilled water immersion, the weight ratio of water and the dry sporophore of hidden pore fungi is 7:1, and 4 ℃ are soaked 2-4 hour, homogenizer fully blends to 80 orders, 50 ℃ of lixiviates 10 hours, centrifugal 10 minutes of 8000g, collect supernatant, lyophilizing, obtains hidden pore fungi extract.The dry sporophore of this hidden pore fungi is by fresh hidden pore fungi sporophore dry obtaining at normal temperatures.With the hidden pore fungi extract of physiological saline solution and by the filter filtration sterilization of 0.22 micron, obtain hidden pore fungi extract injection.
Two, hidden pore fungi extract suppresses the breeding of PRRS virus in pig body
1, experimental technique
The SPF pig in 4 week age that is 6-8kg by 10 body weight is divided into 2 groups (5 every group) at random, is respectively matched group (only infecting PRRS virus not to hidden pore fungi extract), administration group (infect PRRS virus, give hidden pore fungi extract simultaneously).Use 1ml(TCID50=10
5) high the strain JXwn06 collunarium that causes a disease infects SPF pig to PRRSV, every pig abdominal cavity of administration group and the each 5ml(12mg/ml of the above-mentioned hidden pore fungi extract injection of intramuscular injection), continuous 7 days, every day twice, every pig of matched group was injected isopyknic normal saline.Before infection and after infecting, blood sampling in the 3rd, 7,10,16 and 45 days, collects serum, PRRS virus is done to detection by quantitative by real-time PCR method; Survey body temperature every day, observed and recorded clinical symptoms.Mortality pig is carried out to necropsy at any time, at the 42nd day, all survival pigs are carried out to necropsy.
The step of 1.1 pig vena cava anterior blood samplings and separation of serum is as follows:
Piglets is adopted to Baoding method of lying on the back, and a people grasps two hind legs, as far as possible to rear haulage; Another people presses down mandibular bone with hands, makes head paste ground, and makes two forelimbs substantially vertical with body center line.Now, both sides first are two obvious recesses to the front side of rib and breastbone junction.With after iodine tincture and cotton ball soaked in alcohol sterilization skin, hand-held vacuum blood collector is supporting, and with pin (0.7 × 25mm), recess place is from top to bottom to the right, slightly be partial to central authorities and thoracic cavity direction is thrust, see and have blood back, be about to the supporting other end with pin of vacuum blood collector and insert vacuum test tube, start blood sampling, every piglets is adopted 4-5ml blood.Take a blood sample complete, left hand takes cotton ball soaked in alcohol to press pin hole place, and the right hand is extracted rapidly blood-collecting needle tube, and slightly tabletting is carved after hemostasis, removes Baoding.
Blood taking tube is placed in to 37 ℃ of 2h, and then 4 ℃ are spent the night, and serum can be separated out, and the serum of separating out is collected in 1.5mlEP pipe, and 4000g, 4 ℃ of centrifugal 10min, discard precipitation, by serum keeping in-80 ℃, for detection of viral RNA.
Virus titer in 1.2Real-Time PCR standard measure serum
The test kit of producing with OMEGA Viral RNA Kit company extracts the viral RNA in serum.By the requirement of test kit description, operate.By 560 μ l QVL lysates, 5.6 μ l carrier RNA and 10 μ l2-mercaptoethanols join in 1.5ml EP pipe.Getting 140 μ l serum joins in the EP pipe that contains lysate.Incubated at room 5-10min.In sample, add 560 μ l dehydrated alcohol, concussion mixes 30s.By in test kit
adsorption column packs in the collecting pipe of 2ml, and the mixed liquor 650 μ l that get step add in adsorption column, and 10, the centrifugal 30s of 000g, discard the liquid in collecting pipe, adsorption column is inserted in new collecting pipe, repeat previous step until all mixed liquors are all transferred to adsorption column.In adsorption column, add 500 μ l RWA washing liquids, the centrifugal 30s of 10,000g, discards the liquid in collecting pipe, and adsorption column is inserted in new collecting pipe.In adsorption column, add 500 μ l RWB washing liquids, the centrifugal 30s of 10,000g, discards the liquid in collecting pipe, adsorption column is inserted in collecting pipe to the centrifugal 3min of 12,000g.Adsorption column is placed in to new 1.5ml EP pipe, the H that adds 50 μ l DEPC to process to the central authorities of adsorption column
2o.Incubated at room 5min, the RNA adsorbing on the centrifugal 1min eluting of 10,000g adsorption column, is stored in RNA-80 ℃ for quantitatively.
Get 2 μ l RNA and be RT-PCR.In 250 μ l PCR pipes, add 2 μ l RNA and 1 μ l Random Primer(10 μ m, TaKaRa), mix; 70 ℃ of 5min, put rapidly cooled on ice 2min; To adding following component in said mixture: M-MLV5 × Reaction Buffer5 μ l, dNTP(2.5mM each) 5 μ l, Recombinant RNasin Ribonuclease Inhibitor25units, M-MLV RT (Promega) 200units, finally adds DEPC water polishing volume to 25 μ l; Mix gently 37 ℃ of 60min; PCR pipe is transferred to 70 ℃, 15min; Be placed in cooled on ice, cDNA product is stored in-20 ℃.
Real-Time PCR is used SYBR Premix Ex Taq TM II (the Perfect Real Time) reaction system of TaKaRa.
premix Ex TaqTM(2 ×) 10 μ l, PCR primer ORF7F(AATAACAACGGCAAGCAGCA), ORF7R(GCACAGTATGATGCGTCGGC) (10 μ are each 0.8 μ l m), ROX Reference Dye II(50 ×) 0.4 μ l, cDNA template 2 μ l, aseptic double-distilled water 6 μ l, cumulative volume 20 μ l.On ABI7900Real-Time PCR System, react, take two-step method pcr amplification standardization program: 95 ℃ of 30s; 95 ℃ of 5s, 60 ℃ of 30s (40 circulations).By SDS2.2.2for7900 software analysis deal with data.Make standard substance (by the PRRSV ORF7DNA fragment shown in sequence 1 and pcDNA3.1 carrier (Invitrogen with the plasmid of the PRRSV ORF7 of known copy number, catalog number (Cat.No.) K480001) connect the recombiant plasmid that the obtains standard substance as PRRSV ORF7), after 10 times of gradient dilutions, be Real-Time PCR, with Ct value, the logarithm of plasmid copy number is done to standard curve, quantitative to viral RNA according to standard curve.
2, experimental result
Experimental result shows, hidden pore fungi extract does not have obvious toxic and side effects to piglet, can alleviate the high heat (Fig. 6) that the high virus strain infection piglet of causing a disease of PRRSV causes, reduces piglet serum-virus titre (Fig. 7), improves the survival rate (Fig. 8) that infects piglet.Wherein, administration group serum-virus titre of the 10th day after counteracting toxic substances is 1/5th of matched group, administration group can't detect virus titer in the serum of the 45th day after counteracting toxic substances, and matched group is in all death in the 12nd day after counteracting toxic substances, administration group survival rate of the 16th day after counteracting toxic substances is 80%, and administration group survival rate of the 45th day after counteracting toxic substances is 60%.
The mechanism of embodiment 3, the anti-porcine reproductive and respiratory syndrome virus of hidden pore fungi extract
One, the preparation of hidden pore fungi extract
With the dry sporophore of the hidden pore fungi of distilled water immersion, the weight ratio of water and the dry sporophore of hidden pore fungi is 6:1, and 4 ℃ are soaked 2-4 hour, and homogenizer fully blends to 50 orders, 4 ℃ of lixiviates 10 hours, and centrifugal 15 minutes of 8000g, collects supernatant, and lyophilizing, obtains hidden pore fungi extract.The dry sporophore of this hidden pore fungi is by fresh hidden pore fungi sporophore dry obtaining at normal temperatures.Hidden pore fungi extract used in the experiment of following step 2, all with physiological saline solution and by using after the filter filtration sterilization of 0.22 micron.
Two, the mechanism of the anti-porcine reproductive and respiratory syndrome virus of hidden pore fungi extract
1, test method
1.1, the impact that hidden pore fungi extract pretreatment Marc-145 (cercopithecus aethiops embryo kidney epithelial cell) infects PRRSV
DMEM culture fluid (10%FBS) for Marc-145 is dispelled, be made into cell suspension, be inoculated into 96 orifice plates, 37 ℃, 5%CO
2under environment, cultivate 24h.Remove culture fluid, change the fresh medium that contains the hidden pore fungi extract of variable concentrations, 37 ℃, 5%CO
2under environment, hatch 2h, remove the culture fluid containing hidden pore fungi extract, infect PRRSV CH-1a strain (MOI=0.1), continue to cultivate 24h, receive cells and supernatant and measure virus titer according to the method for embodiment 1.
Wherein, the fresh medium that contains the hidden pore fungi extract of variable concentrations be contain 0,0.2,0.42, the fresh DMEM culture fluid of the hidden pore fungi extract of 0.6mg/ml (dilutes hidden pore fungi extract with fresh DMEM culture fluid, obtain that hidden pore fungi extract final concentration is respectively 0.2,0.4, the hidden pore fungi extract culture fluid of 0.6mg/ml, with isopyknic fresh DMEM culture fluid (the fresh DMEM culture fluid of the hidden pore fungi extract of 0mg/ml), contrast).
1.2, measure the direct killing effect of hidden pore fungi extract to PRRSV
By containing 0,0.2,0.4, the fresh DMEM culture fluid of the hidden pore fungi extract of 0.6mg/ml and the PRRSV(10 of equivalent
5tCID50) at 37 ℃, hatch altogether 1h and 3h, after having hatched, according to the method for embodiment 1, measure virus titer.
1.3, measure hidden pore fungi extract and suppress PRRSV RNA synthetic in Marc-145 cell
Suppress PRRSV the synthetic of RNA in Marc-145 DMEM culture fluid (10%FBS) for Marc-145 is dispelled, be made into cell suspension, be inoculated into six orifice plates, 37 ℃, 5%CO
2under environment, cultivate 24h.Inoculation PRRSV CH-1a strain (MOI=0.01), after viral infection, 24h discards supernatant, add and contain 0 respectively, 0.2, the fresh DMEM culture fluid of the hidden pore fungi extract of 0.5mg/ml (dilutes hidden pore fungi extract with fresh DMEM culture fluid, obtain hidden pore fungi extract final concentration and be respectively 0.2 and the hidden pore fungi extract culture fluid of 0.5mg/ml, to add isopyknic fresh DMEM culture fluid (the fresh DMEM culture fluid of the hidden pore fungi extract of 0mg/ml) in contrast), respectively at changing after liquid 6, 12, 24, 48, 72h receives cell, extract cell total rna and be Real-Time PCR.Make standard substance with the plasmid (with embodiment 2) of the PRRSV ORF7 of known copy number, after 10 times of gradient dilutions, be Real-Time PCR, with Ct value, the logarithm of plasmid copy number is done to standard curve, quantitative to viral RNA according to standard curve.
Wherein, RNA extraction, reverse transcription and Real-Time PCR method are as follows: every 5-10 × 10
6individual cell adds 1ml Trizol (invitrogen), repeatedly with pipettor piping and druming, mixes the standing 5min of room temperature; In above-mentioned EP pipe, add 0.2ml chloroform, cover EP pipe lid, in hands, firmly shake the standing 10min of room temperature 15 seconds; 4 ℃, the centrifugal 15min of 12000g; Get upper strata water and be placed in new EP pipe, add 0.5ml isopropyl alcohol, the standing 10min of room temperature; 4 ℃, the centrifugal 10min of 12000g; Carefully abandon supernatant, add 1ml75% ethanol and wash, 4 ℃, the centrifugal 5min of 7500g, abandon supernatant; Allow the at room temperature natural drying of RNA of precipitation, finally add 20l DEPC water dissolution RNA, use Nanodrop1000(Thermo scientific) quantitative RNA.
Get 500ng RNA and be RT-PCR.In 250l PCR pipe, add 500ng RNA and 1 μ l Random Primer(10 μ M, TaKaRa), mix; 70 ℃ of 5min, put rapidly cooled on ice 2min; To adding following component in said mixture: M-MLV5 × Reaction Buffer5 μ l, dNTP(2.5mM each) 5 μ l, Recombinant RNasin Ribonuclease Inhibitor25units, M-MLV RT (Promega) 200units, finally adds DEPC water polishing volume to 25 μ l; Mix gently 37 ℃ of 60min; PCR pipe is transferred to 70 ℃, 15min; Be placed in cooled on ice, cDNA product is stored in-20 ℃.Real-Time PCR is used SYBR Premix Ex TaqTM II (the Perfect Real Time) reaction system of TaKaRa.
premix Ex TaqTM(2 ×) 10 μ l, PCR primer ORF7F(AATAACAACGGCAAGCAGCA), ORF7R(GCACAGTATGATGCGTCGGC) (10 μ are each 0.8 μ l m), ROX Reference Dye II(50 ×) 0.4 μ l, cDNA template 2 μ l, aseptic double-distilled water 6 μ l, cumulative volume 20 μ l.On ABI7900Real-Time PCR System, react, take two-step method pcr amplification standardization program: 95 ℃ of 30s; 95 ℃ of 5s, 60 ℃ of 30s (40 circulations).By SDS2.2.2for7900 software analysis deal with data.
1.4, measure the impact of the rna polymerase activity of hidden pore fungi extract on PRRSV RNA dependence
The RNA polymerase that PRRSV RNA relies on (is prepared according to the method in following document: De Novo Initiation of RNA Synthesis by the Arterivirus RNA-Dependent RNA Polymerase.JOURNAL OF VIROL OGY, Aug2007p8384-8395), in vitro in reaction system, the RNA polymerase that RNA relies on can be take poly(U) 18 be template, take ATP as substrate, from 5, to 3, synthetic poly(A) 18, with filter paper in conjunction with experiment (filter-binding assays) adsorb poly(A) 18, reaction rna polymerase activity.Ion-exchange cellulose chromatography paper DE81-paper (DE81-filer), with the weak base anion exchanger of diethyl amino ethyl group functional group, can the isotope-labeled RNA chain of binding radioactivity, reactant liquor is passed through after filter paper, by detecting the amount of the RNA chain adsorbing on the isotope signal quantitative filter paper on filter paper, thus the activity of reaction RNA polymerase.
In 1.5ml EP pipe, configure following reactant liquor: 5x reaction buffer (250mM HEPES (pH8.0), 50mM KCl, 5mM DT T, 10mM MnCl
2, 4mM MgCl
2) 10 μ l, the RNA polymerase nsp92 μ M that PRRSV RNA relies on, polyU (18) 400nM, [
32p] ATP0.5-2.5 μ Ci, ATP100 μ M, RRI50unit, the hidden pore fungi extract normal saline solution of different volumes, makes that hidden pore fungi extract final concentration is respectively 0,0.01,0.05,0.1mg/ml; Use DEPC H
2o polishing volume to 50 μ l.30 degree reaction 60min, add isopyknic 50mM EDTA cessation reaction.50 μ l reactant liquors are dropped in to DE-81(whatman) on filter membrane, dry.With 0.3M ammonium formate (PH8.0), wash three times, each 2min, is dried.Add liquid scintillation counting reactant liquor, with instrument counting counts per minute.The activity of RNA polymerase is as 100% when not adding hidden pore fungi extract, analyzes the impact of the rna polymerase activity that hidden pore fungi extract relies on PRRSV RNA.
1.5, measure hidden pore fungi extract and suppress PRRSV protein synthetic in Marc-145 cell
Suppress PRRSV the synthetic of protein in Marc-145 cell DMEM culture fluid (10%FBS) for Marc-145 cell is dispelled, be made into cell suspension, be inoculated into six orifice plates, 37 ℃, 5%CO
2under environment, cultivate 24h.Inoculation PRRSV CH-1a strain (MOI=0.5), after viral infection, 2h discards supernatant, add respectively and contain 0,0.2, the fresh medium of the hidden pore fungi extract of 0.6mg/ml (dilutes hidden pore fungi extract with fresh DMEM culture fluid, obtain hidden pore fungi extract final concentration and be respectively 0.2 and the hidden pore fungi extract culture fluid of 0.6mg/ml, with isopyknic fresh DMEM culture fluid (the fresh DMEM culture fluid of the hidden pore fungi extract of 0mg/ml), contrast), continue to cultivate 24h, remove cell culture fluid, wash one time with PBS.In 6 orifice plates, every porocyte adds 200 μ l containing the RIPA lysate (Bo Maide) of 1mM protease inhibitor PMSF, several with pipettor piping and druming under, lysate is fully contacted with cell.Fully, after cracking, the centrifugal 5min of 14,000g, gets supernatant, is the total protein that cell lysis obtains, and is Western-blot.Western-blot is Western immunoblotting, is protein transduction is moved on on film, then utilizes antibody to detect.What Western Blot adopted is polyacrylamide gel electrophoresis, and detected material is protein, and " probe " is antibody, and " colour developing " resists with two of labelling.The protein example separating through PAGE, transfers to solid phase carrier (for example cellulose nitrate film) upper, and solid phase carrier is with non-covalent bond form adsorbed proteins, and can keep polypeptide type and the biologic activity thereof of electrophoretic separation constant.Using the protein on solid phase carrier or polypeptide as antigen, play immunoreation with corresponding antibody, react with enzyme or isotope-labeled second antibody, the colour developing of process substrate or autoradiography are with the protein ingredient of the specific destination gene expression of detection electrophoretic separation again.
Quantitative with BCA determination of protein concentration test kit (enhancement mode) (the green skies) to total protein.Get appropriate 25mg/ml protein standard BSA, with PBS, being diluted to final concentration is 0.5mg/ml; Quantity per sample, adds 1 volume BCA reagent B (50:1) by 50 volume BCA reagent A and prepares appropriate BCA working solution, fully mixes; Standard substance are added in the standard substance hole of 96 orifice plates by 0,1,2,4,8,12,16,20 μ l, add PBS and supply 20 μ l; Add 2 μ l samples in the sample well of 96 orifice plates, add PBS to 20 μ l; Each hole adds 200 μ l BCA working solutions, places 30min for 37 ℃; Measure A562, according to standard curve, calculate the protein concentration of sample.
Separate 15 μ g protein samples with 10%SDS-PAGE gel electrophoresis, concentrated glue voltage 80V, separation gel voltage 120V, when bromophenol blue indicator arrives gel bottom, stops electrophoresis; Then protein sample is transferred to pvdf membrane (Millipore), electric current 40mA, 2h at 4 ℃ from gel; After transferring film finishes, pvdf membrane is taken out from electric turn trough, with 5% defatted milk powder (being dissolved in 1 ╳ PBST) 37 ℃ sealing 1h; With 5% defatted milk powder dilution primary antibodie anti-PRRSV N proteinSDOW17(1:5,000; Rural Technologies) or anti--actin (1:5,000; CloneAC-15; Sigma, St.Louis, MO), 4 ℃ of overnight incubation, wash 3 times each 5min with 1XPBST; Dilute the anti-Mus of two anti-HRP-rabbits two anti-(1:10,000, health is century) with 5% defatted milk powder, hatch 1h for 37 ℃, 1XPBST washes 3 times, each 5min; Finally use high sensitivity chemistry luminous detection test kit (health is century) to develop.
Wherein, β-actin(beta-actin) be a kind of main protein composition in muscle rhabdomyosarcoma fiber, also be the main component of muscle filament and cytoskeletal filament, there is contractile function, widely distributed, relative constant with the expression in cell at each tissue, when the expression that detects albumen changes, to commonly use it and make object of reference, this experiment is also used β-actin in contrast.
1.6, data analysis
All data are all the independent meansigma methodss obtaining in triplicate, paired with two tail T-test() analyze the significance of difference, P≤0.05 is considered to significant difference, 0.01<P≤0.05(*), 0.001<P≤0.01(**), P≤0.001(***).
2, experimental result
The hidden pore fungi extract of all concentration (0.2-0.6mg/ml) culture fluid pretreatment Marc-145 (cercopithecus aethiops embryo kidney epithelial cell), does not suppress the infection (Fig. 9) of PRRSV.Hidden pore fungi extract is directly processed PRRSV, hatches 1h, and the hidden pore fungi extract of all concentration (0.2-0.6mg/ml) culture fluid is processed does not all have lethal effect to virus; Hatch 3h, the processing that concentration is 0.2mg/ml does not have lethal effect to virus, and the processing of 0.4mg/ml and 0.6mg/ml has slight lethal effect (Figure 10) to virus.After PRRSV infection cell, 24h adds hidden pore fungi extract, the synthetic meeting of viral RNA is suppressed, hidden pore fungi extract culture fluid 6h after adding of 0.5mg/ml can obviously suppress the synthetic of viral RNA, 48h after adding, extract is the most obvious for the inhibitory action of viral RNA, during to 72h, cell meeting death because of viral infection of matched group, so the amount of cellular control unit inner virus RNA also can decline (Figure 11).Hidden pore fungi extract just can obviously suppress the activity of the RNA polymerase of PRRSV RNA dependence at low concentration, when concentration is 0.01mg/ml, the activity of the RNA polymerase that PRRSV RNA relies on drops to 60%(Figure 12).Hidden pore fungi extract can suppress PRRSV synthetic proteins in cell, after virus infected cell, 2h adds hidden pore fungi extract, after 24h, detect the expression of virus N albumen, compared with the control, hidden pore fungi extract can dose dependent inhibition virus N albumen synthetic, the hidden pore fungi extract of 0.6mg/ml culture fluid can't detect the expression (Figure 13) of virus N albumen.
Claims (6)
1. the application of hidden pore fungi extract in the product of preparation inhibition porcine reproductive and respiratory syndrome virus synthetic RNA in host cell, described hidden pore fungi extract is the water-soluble substances extracting from hidden pore fungi sporophore; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
2. the application in the rna polymerase activity product that hidden pore fungi extract relies at preparation inhibition porcine reproductive and respiratory syndrome virus RNA; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
3. the application of hidden pore fungi extract in the product of preparation inhibition porcine reproductive and respiratory syndrome virus synthetic protein in host cell, described hidden pore fungi extract is the water-soluble substances extracting from hidden pore fungi sporophore; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
4. the application of hidden pore fungi in the product of preparation inhibition porcine reproductive and respiratory syndrome virus synthetic RNA in host cell; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
5. the application in the rna polymerase activity product that hidden pore fungi relies at preparation inhibition porcine reproductive and respiratory syndrome virus RNA; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
6. the application of hidden pore fungi in the product of preparation inhibition porcine reproductive and respiratory syndrome virus synthetic protein in host cell; Described hidden pore fungi is for hiding the hidden pore fungi in hole (Cryptoporus volvatus (Peck) Shear); Described porcine reproductive and respiratory syndrome virus is high cause a disease strain JXwn06, PRRSV CH-1a strain or PRRSV VR2332 strain of PRRSV.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210460444.4A CN102920747B (en) | 2012-11-15 | 2012-11-15 | Application of cryptoporus volvatus in preparation of products for inhibiting porcine reproductive and respiratory syndrome virus (PRRSV) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210460444.4A CN102920747B (en) | 2012-11-15 | 2012-11-15 | Application of cryptoporus volvatus in preparation of products for inhibiting porcine reproductive and respiratory syndrome virus (PRRSV) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102920747A CN102920747A (en) | 2013-02-13 |
| CN102920747B true CN102920747B (en) | 2014-04-16 |
Family
ID=47635772
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210460444.4A Expired - Fee Related CN102920747B (en) | 2012-11-15 | 2012-11-15 | Application of cryptoporus volvatus in preparation of products for inhibiting porcine reproductive and respiratory syndrome virus (PRRSV) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102920747B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102920745B (en) * | 2012-11-15 | 2015-07-15 | 中国农业大学 | Novel use of cryptoporus volvatus |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1121111A (en) * | 1994-10-15 | 1996-04-24 | 华启洪 | Production method of cryptoporus volvatus powder |
| CN1405314A (en) * | 2001-08-17 | 2003-03-26 | 杭州泰士生物科技有限公司 | Cryptoporus volvatus fermented product, and its preparation method and application |
| CN1919875A (en) * | 2005-08-23 | 2007-02-28 | 杭州赐富生物技术有限公司 | Cryptoporus volvatus polysaccharide, preparation and application thereof |
| CN101803531A (en) * | 2010-03-26 | 2010-08-18 | 中国科学院微生物研究所 | China cryptoporus sinensis and solid cultural method and application thereof |
-
2012
- 2012-11-15 CN CN201210460444.4A patent/CN102920747B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1121111A (en) * | 1994-10-15 | 1996-04-24 | 华启洪 | Production method of cryptoporus volvatus powder |
| CN1405314A (en) * | 2001-08-17 | 2003-03-26 | 杭州泰士生物科技有限公司 | Cryptoporus volvatus fermented product, and its preparation method and application |
| CN1919875A (en) * | 2005-08-23 | 2007-02-28 | 杭州赐富生物技术有限公司 | Cryptoporus volvatus polysaccharide, preparation and application thereof |
| CN101803531A (en) * | 2010-03-26 | 2010-08-18 | 中国科学院微生物研究所 | China cryptoporus sinensis and solid cultural method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102920747A (en) | 2013-02-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mertens et al. | Enhanced infectivity of modified bluetongue virus particles for two insect cell lines and for TwoCulicoidesVector species | |
| CA2127991A1 (en) | Preparation of antigens of and of vaccines for the virus of mystery disease, antigens and vaccines obtained for the prevention of this disease | |
| CN101280292A (en) | Virus velogen strain for porcine reproductive and respiratory syndrome, attenuated vaccine strain thereof and application thereof | |
| CN102107003A (en) | Porcine reproductive and respiratory syndrome Virosome vaccine and preparation method thereof | |
| Studdert et al. | Isolation and characterisation of an equine rhinovirus | |
| CN114788844A (en) | Application of polygonum flaccidum flavone ethyl acetate part in resisting porcine pseudorabies virus and medicament for resisting porcine pseudorabies virus | |
| CN102221618A (en) | Method for establishing hog cholera lapinized virus labeled vaccine strain and preparing vaccine | |
| CN102920747B (en) | Application of cryptoporus volvatus in preparation of products for inhibiting porcine reproductive and respiratory syndrome virus (PRRSV) | |
| CN108969492A (en) | A kind of swine fever takes orally weak malicious freeze dried vaccine and preparation method thereof | |
| CN102920748B (en) | Application of cryptoporus volvatus in preparation of products for curing porcine reproductive and respiratory syndrome (PRRS) | |
| CN102920745B (en) | Novel use of cryptoporus volvatus | |
| CN104888213A (en) | Preparation method of classical swine fever spleen-lymph-sourced compound living vaccine | |
| CN103860616A (en) | Manyprickle Acathopanax Root extrat, and preparation method and application thereof | |
| CN106310250A (en) | Swine fever oral attenuated freezing-dry vaccine and preparation method thereof and freeze-drying protective agent | |
| Pignatelli et al. | Molecular characterization of a new PToV strain. Evolutionary implications | |
| CN109055320B (en) | Infectious bronchitis virus isolate and application thereof in vaccine preparation | |
| CN102363770A (en) | Recombinant baculovirus capable of expressing porcine circovirus type 2 Cap protein and somatostatin in fusion manner, and subunit vaccine thereof | |
| CN103505724A (en) | Swine fever and porcine pseudorabies bivalent vaccine as well as preparation method and application thereof | |
| CN103495180B (en) | Freezing and drying protecting agentCryoprotectant for porcine reproductive and respiratory syndrome compound inactivated vaccine | |
| Cheng et al. | The in vitro anti-herpes simplex virus type-1 and type-2 activity of Long Dan Xie Gan Tan, a prescription of traditional Chinese medicine | |
| Wilkinson et al. | Transmission studies with African swine fever virus: The early distribution of virus in pigs infected by airborne virus | |
| CN111686246B (en) | Antigen-antibody complex vaccine for porcine epidemic diarrhea virus and preparation method thereof | |
| CN103275937A (en) | Recombinant virus expressing PCV2 codon optimized ORF1 and ORF2 tandem gene | |
| Garland et al. | Attempts to infect pigs with coxsackie virus type B5 | |
| CN102764432A (en) | Chinese giant salamander viral hemorrhagic disease cell culture-based inactivated vaccine, its preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140416 Termination date: 20201115 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |