CN102911961B

CN102911961B - Construction method for linearized expression vector and simulated vector segments used for construction of linearized expression vector

Info

Publication number: CN102911961B
Application number: CN201110218384.0A
Authority: CN
Inventors: 尚玉栓; 张瑞娟
Original assignee: Individual
Current assignee: Individual
Priority date: 2011-08-01
Filing date: 2011-08-01
Publication date: 2014-07-16
Anticipated expiration: 2031-08-01
Also published as: CN102911961A

Abstract

The invention provides a construction method for a linearized expression vector and simulated vector segments used for the construction of the linearized expression vector. The construction method for the linearized expression vector comprises the following steps of designing and constructing a front simulated vector segment, a back simulated vector segment and a target gene segment; and connecting the front simulated vector segment, the back simulated vector segment and the target gene segment with ligase to obtain a linearized double-strand DNA expression vector. The invention further provides the simulated vector segments used for the construction of the linearized expression vector. By preparing simulated linearized vector segments through efficient and accurate connection reaction, a process of obtaining the linearized vector segments through the construction of complex and time-consuming ring-shaped plasmid vectors can be avoided; and simultaneously, and the generation of target gene terminals is not limited by the sequence, so that operations are greatly simplified; cost can be reduced; experimental period is shortened; and the method has very good application prospects in expression systems of yeast and the like.

Description

A kind of linearizing expression vector establishment method and for the class carrier segments of linearizing expression vector establishment

Technical field

The present invention relates to biological gene recombination and expression techniques, be specifically related to that a kind of ligation direct construction linearized vector fragment by efficiently and accurately realizes linearizing expression vector establishment method and for the class carrier segments of linearizing expression vector establishment.

Background technology

DNA recombinant expression technology is in an increasingly wide range of applications in current bio-science research and industrialization.At present, the host living beings of DNA recombinant expression has a variety of, such as intestinal bacteria, subtilis, yeast and mammalian cell etc.In a lot of situations, when utilizing these host living beings to express goal gene, need first in intestinal bacteria, to build a correct cyclic plasmid carrier that inserts goal gene, to after this carrier purification, linearizing, transform again host living beings, goal gene is incorporated into by homologous recombination in the genome of host living beings, can obtain the clone of stably express according to screening-gene.Such as the conventional pPIC9K carrier (Invitrogen) of formula yeast (Pichia pastoris) and the pOptiVEC of Chinese hamster ovary cell CHO of finishing ^tM-TOPO carrier (Invitrogen) all belongs to this type of.Fig. 2 be take and finished the bacterial strain GS115 of formula yeast (Pichia pastoris) and carrier pPIC9K expressing green fluorescent protein GFP and the basic step of this recombinant expressed process is described as example.This recombinant expressed process has been operated by 17 steps substantially as we know from the figure, wherein having 15 step operations is to build a linearized vector fragment, need during this time repeatedly the operations such as microbial culture, plasmid extraction, enzyme are cut, purifying, cost is higher and loaded down with trivial details, generally needs one week above time.If can by can DNA fragmentation scale similar substrates that prepare, general and that contain the required element of genetic expression and goal gene fragment by ligation, directly prepare the required linearized vector fragment of the 15th step in Fig. 2 or have the DNA fragmentation of identical function, can avoid plamid vector construction process, related work can complete in one day and be very simple, this will accelerate recombinant expressed speed greatly, and technological line is shown in Fig. 3.

The process of above-mentioned direct construction linearized vector requires very high to ligation efficiency.In the clonal expression of current gene, the type of the ligation of widespread use has following three kinds: one, in the clonal expression plasmid vector of the ring-type of thumping majority, all contain multiple clone site, goal gene and carrier produce end after the digestion with restriction enzyme in multiple clone site, between end, can pass through ligase enzyme catalysis ligation; Two, in T carrier and TOPO serial carrier (Invitrogen), carrier and goal gene produce ligation by base T and the A of end, wherein in T carrier, reaction, by ligase enzyme catalysis, mediates ligation and react in TOPO serial carrier by topoisomerase I (Topoisomerase I); Three, other disconnected enzymatic ligation, as the LoxP site homologous recombination construction carrier of GatewayTM system (Gibco/Life Technologies) and the mediation of EchoTM system (Invitrogen) employing Cre enzyme.In practice, find that above-mentioned three major types ligation joint efficiency is all very low and very easily produce incorrect link, need in intestinal bacteria, screen positive colony that is correctly connected into goal gene, be obviously not suitable for being directly used in structure linearized vector.

Chinese patent application case (Chinese Patent Application No. 02116936.5,02117763.5 and 02123460.4) has been reported three kinds of linearized vector construction processs without clone and has been focused on participating in the generation of the end of ligation.In each invention, providing respectively a kind of method that end produces, is respectively to using the RNA protruding terminus that the digestion with restriction enzyme of asymmetry cutting produces end, DNA and RNA crossbred to produce end as end, nickase and exonuclease effect.Thereby the fragment that is equivalent to carrier and goal gene with associated end produce ligation structure without clone's linearized vector by the catalysis of T4DNA ligase enzyme.In practical application, these methods are subject to certain restrictions, and fail to be further widely applied.

Summary of the invention

The object of the invention is to overcome defect of the prior art, provide a kind of ligation direct construction linearized vector fragment by efficiently and accurately to realize quick transgenic method.

The present invention is mainly that the ligation direct construction of the efficiently and accurately of the three segment DNA fragments by as shown in Figure 1 transforms the fragment of expressing the required linearized vector fragment of the host living beings of goal gene or having identical function, avoided obtaining the cumbersome approaches of linearized vector fragment by building cyclic plasmid carrier, thereby realized quick genetically modified operation.

For convenience of statement, in the present invention three sections of DNA fragmentations that connect successively in Fig. 1 are called to front class carrier segments, goal gene fragment and rear class carrier segments.In goal gene fragment, coding strand 5 ' holds one end of corresponding DNA sequence dna to be called the front end of goal gene fragment, and coding strand 3 ' holds one end of corresponding DNA sequence dna to be called the rear end of goal gene fragment.The front end of goal gene fragment is connected with front class carrier segments rear end, and the rear end of goal gene fragment is connected with rear class carrier segments front end.

One aspect of the present invention provides a kind of linearizing expression vector establishment method, comprises the following steps:

1) design front class carrier segments, rear class carrier segments and goal gene fragment,

Described front class carrier segments, rear class carrier segments and goal gene fragment meet following requirement;

Described goal gene fragment contains goal gene and two ends are 5 ' redundancy sticky end;

5 ' redundancy sticky end of described goal gene fragment meets following requirement simultaneously:

A) the redundancy base number of single 5 ' redundancy sticky end is 1-10, is preferably 2-6, and best is 2-4;

B) the redundancy base of two 5 ' redundancy sticky ends is selected from three kinds at the most in A, T, C and G, and arbitrary redundancy base all holds the complementary base of first base different from 3 ' of arbitrary single stranded DNA in goal gene fragment, cohesive end is produced by the degraded of T4 archaeal dna polymerase;

Further preferred, 5 ' redundancy sticky end of described goal gene fragment also meets at least one item in following requirement:

C) in two 5 ' redundancy sticky ends, only have at the most a 5 ' redundancy sticky end to contain palindrome symmetric sequences; Preferably two 5 ' redundancy sticky ends all do not have palindrome symmetric sequences.

D) between two 5 ' redundancy sticky ends, the matching rate of base is low.Preferably, between two 5 ' redundancy sticky ends, the base number of maximum continuous pairings is not more than half of redundancy base number of any 5 ' redundancy sticky end, and when there is the continuous pairing at a plurality of intervals, the total number of base of coupling is less than the total number of unmatched base.The base that continuously pairing refers to 2 or 2 above next-door neighbours in a cohesive end simultaneously with another cohesive end in corresponding base pairing.

An end of described front class carrier segments is 5 ' redundancy sticky end, and in described goal gene fragment, 5 ' the redundancy sticky end (front end of goal gene fragment) that coding strand 5 ' end is corresponding is complementary mutually, this end is the rear end of front class carrier segments, another end is flush end or the end processed through dephosphorylation enzyme, and this end is the front end of front class carrier segments;

An end of described rear class carrier segments is 5 ' redundancy sticky end, and in described goal gene fragment, 5 ' the redundancy sticky end (rear end of goal gene fragment) that coding strand 3 ' end is corresponding is complementary mutually, this end is the front end of rear class carrier segments, another end is flush end or the end processed through dephosphorylation enzyme, and this end is the rear end of rear class carrier segments;

2) according to step 1) the front class carrier segments of design construction, rear class carrier segments and goal gene fragment;

3) by step 2) the front class carrier segments, rear class carrier segments and the goal gene fragment that build directly adopt ligase enzyme to connect to obtain front class carrier segments, goal gene fragment and rear class carrier segments connected linear dsdna expression vector successively.

Step 1), in, described 5 ' redundancy sticky end refers to 5 ' outstanding sticky end; Described redundancy base refers to the strand base of 5 ' protuberance in 5 ' redundancy sticky end.

The redundancy base of two 5 ' redundancy sticky ends of described goal gene is selected from three kinds at the most in A, T, C and G, and arbitrary redundancy base all holds the complementary base of first base different from arbitrary single stranded DNA 3 ' in goal gene fragment.For instance, as following fragment meets afore mentioned rules:

In above-mentioned fragment, underscore is partly redundancy base, with the base of square frame, is the complementary base that single stranded DNA 3 ' is held first base.In fragment (1), redundancy base kind is A, T and G, and two single stranded DNAs 3 ' hold the complementary base of first base to be C, and arbitrary redundancy base all holds the complementary base of first base different from two single stranded DNAs 3 '; In fragment (2), redundancy base kind is T and G, and two single stranded DNAs 3 ' hold the complementary base of first base to be respectively C and A, and arbitrary redundancy base all holds the complementary base of first base different from two single stranded DNAs 3 '.

Design and meet step 1) after the front class carrier segments, rear class carrier segments and the goal gene fragment that require, front class carrier segments and rear class carrier segments can be implemented in to the class carrier segments that plasmid vector contains required end with preparation, the pcr amplification product of goal gene can be processed to prepare the goal gene fragment that contains required end with T4 archaeal dna polymerase enzyme.

Described step 3), in, ligase enzyme can be selected from T4 DNA ligase or intestinal bacteria ligase enzyme.

In the present invention, three segment DNAs successively linked enzyme connect to produce in the ligation of linearized vector fragment (i.e. front class carrier segments, goal gene fragment and rear class carrier segments successively connected linear dsdna expression vector) of " front class carrier-goal gene-rear class carrier ", only has the ligation of the rear end of front class carrier segments and the front end of goal gene fragment, and after the ligation of the front end of class carrier segments and the rear end of goal gene fragment expect, and ligation between other ends is all unexpected.

For guaranteeing that the front end of front class carrier segments or the rear end of rear class carrier segments do not participate in any ligation as much as possible, optimized mode is that the front end of front class carrier segments or the rear end of rear class carrier segments are flat end, selects intestinal bacteria ligase enzyme.The generation of flat end is the restriction enzyme of flat end after can adopting enzyme to cut, and the sticky end after also can cutting enzyme scabbles to process to obtain flat end or fill to process through archaeal dna polymerase through single-chain nucleic acid excision enzyme and obtains flat end.

Preferably, the structure of goal gene fragment comprises the following steps:

A. design the pcr amplification product that primer amplification goal gene obtains goal gene;

B. by after the pcr amplification product purifying of goal gene, utilize T4DNA polysaccharase to produce 5 ' redundancy sticky end.

Primer described in steps A comprises that a upstream primer and downstream are to primer, and described upstream primer all adds the polynucleotide joint sequence of 1-10 base corresponding with the redundancy base section of 5 ' the redundancy sticky end with designed with 5 ' end of downstream primer.

In above-mentioned steps B, the method of utilizing T4DNA polysaccharase to produce 5 ' redundancy sticky end is: by the pcr amplification product of the goal gene of purifying in the reaction system that has base substrate to exist, with T4 archaeal dna polymerase, process, the final goal gene fragment obtaining with 5 ' redundancy sticky end, described base substrate is selected from dATP, dCTP, dGTP and dTTP, and must be containing the corresponding base substrate of first base that needs to be built two single stranded DNAs, the 3 ' end of goal gene, and must not be containing the corresponding base substrate of complementary base of arbitrary redundancy base in the goal gene fragment that needs to be built.

Described base substrate and must be containing the corresponding base substrate of first base that needs to be built two single stranded DNAs, the 3 ' end of goal gene, and must not be containing the corresponding base substrate of complementary base of arbitrary redundancy base in the goal gene fragment that needs to be built.For instance, as follows if intend the goal gene fragment of structure:

For fragment (1), this fragment redundancy base kind is A, T and G, their complementary base is just T, A and C, corresponding base substrate is exactly dTTP, dATP and dCTP respectively, article two, single stranded DNA 3 ' holds first base to be G, corresponding base substrate is exactly dGTP, and step B base substrate used must contain dGTP so, and must not contain dTTP, dATP and dCTP.

For fragment (2), this fragment redundancy base kind is T and G, their complementary base is just A and C, corresponding base substrate is exactly dATP and dCTP respectively, article two, single stranded DNA 3 ' holds first base to be G and T, corresponding base substrate is exactly dGTP and dTTP, and step B base substrate used must contain dGTP and dTTP so, and must not contain dATP and dCTP.

The principle that adopts aforesaid method to build goal gene fragment is to have utilized the degrading activity of T4 archaeal dna polymerase 3 ' → 5 ' end to obtain 5 ' redundancy sticky end.The aminoterminal of selecting the expression product of being everlasting while being subject to the restriction of goal gene sequence and restriction endonuclease sites that this end construction process has not only overcome the restriction enzyme of multiple clone site in various plasmid vectors leaves several amino acid whose shortcomings, and make front class carrier segments and rear class carrier segments have very strong versatility, be that identical front class carrier segments and rear class carrier segments can be used for the not expression of homotactic goal gene, be easy to higher flux and commercialization.

Front class carrier segments rear end and rear class carrier segments front end be respectively with the sticky end of two 5 ' redundancy sticky end complementations of goal gene fragment, be also 5 ' cohesive end, base kind, number and sequence determine by the cohesive end of goal gene.The cohesive end of considering front class carrier segments rear end and rear class carrier segments front end must easily produce and have the requirement of 5 ' phosphorylation, and front class carrier segments and rear class carrier segments (afterwards all referred to as class carrier segments) be preparation easily, after designing class carrier segments, at its 4 ends, add polynucleotide joint respectively, after the class carrier segments of preparation with polynucleotide joint, be cloned in cyclic plasmid carrier (as pUC18, the common carrier such as pBR322) in or transform more existing plasmid vectors (as pPIC9K, the common carrier such as pPIC3.5K), it can copy in intestinal bacteria, extract plasmid, pass through restriction enzyme, polynucleotide joint in a series of toolenzymes processing such as nuclease and polysaccharase carrier can obtain and meet step 1) described end, specifically and preferably, the described polynucleotide joint with toolenzyme processing class carrier segments end selects one of following methods to produce:

Method one: utilize the polynucleotide joint of digestion with restriction enzyme class carrier segments end, directly obtain end and just meet step 1) tip designs requires front class carrier segments and rear class carrier segments.As cut polynucleotide joint (5 ' GTCTAC 3 '), restriction enzyme Not I enzyme with restriction enzyme A cc I enzyme, cut polynucleotide joint (5 ' GCGGCCGC 3 ') and restriction enzyme Cpo I enzyme and cut the 5 ' cohesive end that polynucleotide joint (5 ' CGGACCG 3 ') produces and can be used as the rear end of front class carrier and the front end of rear class carrier; With restriction enzyme SnaB I and EcoR V respectively enzyme cut the rear end that flat end that polynucleotide joint (5 ' TACGTA 3 ' and 5 ' GATATC 3 ') produces can be used as front end and the rear class carrier of front class carrier.

When the front class carrier segments that method two: utilize and fail to obtain end after the polynucleotide joint of digestion with restriction enzyme class carrier segments end and just meet step 1) tip designs requires and rear class carrier segments, also need again to comprise with various nucleases, archaeal dna polymerase that end that T4DNA polysaccharase treatment limits restriction endonuclease produces could produce and meet step 1) cohesive end that tip designs requires, it is the individual not 5 ' cohesive end of grade of 0-10 that the method can produce redundancy base number.As restriction enzyme Kpn I enzyme is cut polynucleotide joint (5 ' CXGGTACC 3 ', wherein CX is than the inner side of the more close class carrier of Kpn I end, X can be 0-9 even more bases, can be any base in base A, T, G) after, base 5 ' the XGGTAC 3 ' that degrades successively under base substrate dCTP existence condition with T4DNA polysaccharase again can produce step 1) rear end of desired front class carrier and the front end of rear class carrier, according to the difference of X base, can produce 5 ' cohesive end and be exemplified below: 3 ' AC 5 '; 3 ' ACC 5 '; 3 ' ATCC 5 '; 3 ' ACTATC 5 '; 3 ' CACTCAAC 5 '; 3 ' CACTCAACAC 5 '.As restriction enzyme Pst I enzyme is cut after polynucleotide joint (5 ' CTGCAG 3 '), base 5 ' the TGCA 3 ' that degrades successively under base substrate dCTP existence condition with T4DNA polysaccharase again can produce flat end, can be used as the rear end of front end and the rear class carrier of front class carrier.

For guarantee goal gene can be in host living beings stably express, in the linear expression vector of " front class carrier-goal gene-rear class carrier " that the present invention is constructed (i.e. front class carrier segments, goal gene fragment and rear class carrier segments successively connected linear dsdna expression vector) containing the element being necessary, comprise homologous recombination sequence, screening-gene, promotor and terminator, the albumen that also optionally comprises enhanser, signal peptide and merge with goal gene product.

Homologous recombination sequence is one section of sequence with host living beings genome homology, can make the fragment of " front class carrier-goal gene-rear class carrier " be incorporated in host's karyomit(e), thereby make stable the going down to posterity of goal gene.Screening-gene is the screening for positive colony, has two kinds of the auxotrophic gene of covering and antibiotics resistance genes.If selecting the expression strain of host living beings is the auxotrophic strain of the synthetic gene disappearances such as an amino acid or Nucleotide, screening-gene can be this synthetic gene, auxotrophic strain can not be grown in the substratum of compound that does not add this gene product generation, and positive colony that transforms goal gene is owing to carrying this gene, can self produce corresponding compound, can in the substratum of compound that does not add this gene product generation, grow, reach the object of screening.To antibiotics resistance gene, in yeast and mammalian cell conversion, use very extensive, such as bleomycin (Zeocin) etc., in use, unlike above-mentioned auxotroph one class, be limited to and have or not corresponding bacterial strain, positive colony that only transforms goal gene can be grown in adding this kind of antibiotic substratum, thereby reaches the object of screening.Enhanser is generally used in mammalian cell expression vector, is mainly the expression that strengthens goal gene.Expression for a gene, select after a kind of host living beings, its selectable promotor, terminator, enhanser, signal peptide, homologous recombination sequence and screening-gene generally can find from this kind of host's commercialization expression vector or conventional expression vector, identical with the function of respective element in existing commercialization carrier or conventional expression vector in use.

In the fragment of " front class carrier-goal gene-rear class carrier ", goal gene next-door neighbour's promotor and terminator also form with it the expression cassette of correct reading frame, correct transcription and translation, the both sides that homologous recombination sequence is positioned at fragment are beneficial to restructuring, if need signal peptide, assist to express or need fusion rotein, it is between promotor and goal gene, and be connected into the formation that will guarantee equally proper reading frame, other element is positioned at the middle part of two class carrier segments (front class carrier segments and rear class carrier segments) as enhanser and screening-gene.

Thereby key of the present invention is by the tip designs for front class carrier segments, goal gene fragment and rear class carrier segments, the connection of efficiently and accurately to be achieved.Adopt method of the present invention can build cyclic plasmid carrier and direct construction linearized vector.The selecting of restriction enzyme that in the present invention, the production method of target gene 5 ' cohesive end has overcome multiple clone site in various plasmid vectors is subject to the be everlasting aminoterminal of expression product of the restriction of goal gene sequence and selected restriction endonuclease sites to leave several amino acid whose shortcomings, thereby make class carrier segments have very strong versatility, identical class carrier segments can be used for the not expression of homotactic goal gene.Linear expression vector by direct construction " front class carrier-goal gene-rear class carrier " in the present invention obtains the method for clone and greatly simplifies work, pick up speed, be easy to higher flux simultaneously and implement, such as have extraordinary application prospect in yeast two-hybrid experiment.

According to the principle of design of aforesaid method, it is a kind of for building the class carrier segments of linearizing expression vector that the present invention also provides, and comprises front class carrier segments and rear class carrier segments, and described front class carrier segments and rear class carrier segments meet following requirement:

The rear end of front class carrier segments is 5 ' redundancy sticky end, and front end is flush end; The front end of rear class carrier segments is 5 ' redundancy sticky end, and rear end is flush end; 5 ' redundancy sticky end of described front class carrier segments and rear class carrier segments meets following requirement simultaneously:

A. the redundancy base number of 5 ' redundancy sticky end of the rear end of front class carrier segments is 2, and the redundancy base number of 5 ' redundancy sticky end of the front end of rear class carrier segments is 3;

B. described two 5 ' redundancy sticky ends are without palindrome symmetric sequences;

C. described two 5 ' redundancy sticky ends self and between continuously the base number of pairing be less than 2.

Further, the necessary element that described front class carrier segments and rear class carrier segments contain conventional expression vector, comprises homologous recombination sequence, screening-gene, promotor and terminator.

Further, in front class carrier segments and rear class carrier segments, be equipped with homologous recombination sequence, described homologous recombination sequence is positioned near the front end of front class carrier segments or front end and near the rear end or rear end of rear class carrier segments, is AOX1 gene.

Further, described promotor is positioned near the rear end or rear end of front class carrier segments, is AOX1 promotor, and described terminator is positioned at the front end of rear class carrier, is AOX1 terminator.

Further, described screening-gene is positioned at the middle part of front class carrier segments and rear class carrier segments, is HIS4 and Kan.

The use of above-mentioned class carrier segments can, by adding polynucleotide joint in design PCR primer and processing with T4DNA polysaccharase after the goal gene fragment that obtains two ends and front class carrier segments rear end and the complementation of rear class carrier segments front end, adopt ligase enzyme to connect and obtain linear expression vector.

According to above-mentioned principle of design, the embodiment of the present invention specifically discloses a kind of for building the class carrier segments of linearizing expression vector, the redundancy base sequence of 5 ' redundancy sticky end of prepared front class carrier segments is " 3 '-GA 5 ' ", another end is flush end, the redundancy base sequence of 5 ' redundancy sticky end of rear class carrier segments is " 5 ' GAC-3 ' ", and another end is flush end.Front class carrier segments is included in sequence SEQ ID NO:1, two ends are contained restriction enzyme site SnaB I and Acc I and are described ends through the end that two enzyme enzymes are cut generation, rear class carrier segments is included in sequence SEQ ID NO:2, and two ends are contained restriction enzyme site SnaB I and Cpo I and are described ends through the end that two enzyme enzymes are cut generation.Described class carrier confirms that it can be used for building linearizing expression vector.

The method of using class carrier segments of the present invention, can comprise the following steps:

1) structure of goal gene fragment:

A. design the pcr amplification product that obtains goal gene with the PCR primer amplification goal gene of polynucleotide joint; The polynucleotide joint of design should meet and makes pcr amplification product all produce 5 ' redundancy sticky end in two ends after T4DNA polysaccharase is processed, and rear end 5 ' the redundancy sticky end of 5 ' the redundancy sticky end that coding strand 5 ' end is corresponding and the front class carrier segments of described class carrier segments is complementary, front end 5 ' the redundancy sticky end of 5 ' the redundancy sticky end that coding strand 3 ' end is corresponding and the rear class carrier segments of described class carrier segments is complementary;

Other designs of PCR primer meet the requirement of general design of primers.

B. by after the pcr amplification product purifying of goal gene, utilize the processing of T4DNA polysaccharase or toolenzyme enzyme to cut and produce 5 ' redundancy sticky end;

2) goal gene fragment is connected with described class carrier segments.Connecting product is that linear dsdna fragment can be used for transforming expressive host.

As embodiment enumerates, step 1) primer of the pcr amplification goal gene of design meets following condition; 5 ' end of primer adds polynucleotide joint, and goal gene front end primer is that 5 ' of upstream primer is held front 3 joints that base is CTA, and goal gene rear end primer is that 5 ' of downstream primer is held front 4 joints that base is GTCA; Pcr amplification product with these 2 polynucleotide joints produces 5 ' redundancy sticky end after T4 archaeal dna polymerase is processed when base substrate dTTP exists, and rear end 5 ' the redundancy sticky end of 5 ' the redundancy sticky end that coding strand 5 ' end is corresponding and the front class carrier segments of described class carrier segments is complementary, front end 5 ' the redundancy sticky end of 5 ' the redundancy sticky end that coding strand 3 ' end is corresponding and the rear class carrier segments of described class carrier segments is complementary;

According to principle of design of the present invention, those skilled in the art can also design front class carrier segments and the rear class carrier segments that much meets above-mentioned end requirement, particularly for the transposing of described front and back class carrier end and Expression element or/and change, these changes can produce numerous class carrier segments, being applied to the biological linear carriers such as multiple yeast builds, and be not limited to recombinant expressed step, such as Replacement being become after yeast two-hybrid carrier element, can carry out related experiment by fast high-flux, very convenient.

Find after deliberation, do not participate in expecting the front end of front class carrier segments of ligation and the rear end of rear class carrier segments most economical should be effectively flat end, the rear end of front class carrier segments and the front end of rear class carrier segments that participate in expection ligation are 5 ' cohesive end.The palindrome symmetric sequences of cohesive end can cause the connection certainly of end, produce false positive and reduce fragment service efficiency, so palindrome symmetric sequences does not appear in two cohesive ends of the present invention's design.In addition, goal gene fragment end can be easily by increasing primer jointing and preparing by the mode of T4DNA ligase enzyme degraded, unlike the conventional expression vector of majority, need to adopt restriction enzyme to prepare goal gene sticky end, thereby make can connect and prepare linearized vector fragment from different goal gene with a pair of class carrier segments.The present invention prepares similar linearized vector fragment by the ligation of efficiently and accurately, avoided obtaining by the structure of loaded down with trivial details cyclic plasmid carrier consuming time the process of linearized vector fragment, the generation of goal gene end simultaneously is not subject to the restriction of its sequence can greatly simplify the operation, reduce costs and shorten experimental period, has good application prospect in yeast expression system.

Accompanying drawing explanation

Fig. 1: linearizing expression vector establishment method and technology route schematic diagram of the present invention

Fig. 2: the recombination and expression techniques route map of finishing formula yeast GS115 and carrier pPIC9K expressing green fluorescent protein GFP

Fig. 3: the recombinant expressed Technology Roadmap of finishing formula yeast GS115 and class vector expression green fluorescent protein GFP

Fig. 4: class carrier segments schematic diagram of the present invention

Fig. 5: ligation liquid agarose gel electrophoresis result

Fig. 6: thalline PCR proof diagram

Fig. 7: fluorescent microscope detects GFP expression

Embodiment

Term used in the present invention is general molecular biology and Biochemical Nomenclature.

The present invention be take and finished the bacterial strain GS115 of formula yeast (Pichia pastoris) and homemade class carrier segments expressing green fluorescent protein GFP and specifically set forth this working of an invention as example.Should understand example not for limiting the scope of the invention.

Embodiment 1

Class carrier segments before and after preparation

For convenience of class carrier segments before and after preparation, in the embodiment of the present invention, be first implemented in plasmid vector, by purification plasmid, enzyme, cut and the step such as recovery can obtain standby front and back class carrier segments.

The sequence SEQ ID NO:1 that contains front class carrier segments is structured in plasmid pUC18, method is as follows: 1) with primer (5 ' ATGCGGATCCTACGTAAACATCCAAAGACGAAAGG 3 ' (SEQ ID NO:3), 5 ' ATGCCTGCAGGTAGACTCGATCCTTCGAATAATTAG 3 ' (SEQ ID NO:4)) sequence of the approximately 7bp-944bp of amplification plasmid pPIC9K, glue reclaims amplified production and uses restriction enzyme BamH I and Pst I double digestion, and enzyme is cut product glue and reclaimed standby; 2) plasmid pUC18 is used restriction enzyme BamH I and Pst I double digestion glue reclaim standby; 3) enzyme of preparing in above-mentioned two steps is cut to carrier and be connected with fragment, and will connect product conversion bacillus coli DH 5 alpha, by screening, obtain plasmid pUC18-seq1, through nucleotide sequencing plasmid pUC18-seq1, contain sequence SEQ ID NO:1.Plasmid pUC18-seq1 is cut with restriction enzyme SnaB I and Acc I enzyme and glue reclaim about 0.95kb fragment be front class carrier segments, the fragment that is equivalent to sequence and is SEQ ID NO:1 is cut and is produced two ends through restriction enzyme SnaB I and Acc I enzyme, and end sequence is:

The sequence SEQ ID NO:2 that contains rear class carrier segments is structured in plasmid pPIC9K, the approximately 1234bp-6879bp of plasmid pPIC9K is required sequence, it after its two ends add restriction enzyme Cpo I and SnaB I site, is sequence shown in sequence SEQ ID NO:2, the method of transformation plasmid pPIC9K is as follows: 1) with primer (5 ' GTACGGATCCGGATCCAAACGATGAGATT 3 ' (SEQ ID NO:5), 5 ' GTACGCGGCCGCCGGTCCGCCTAGGGAATTCTACGTAAGC 3 ' (SEQ ID NO:6)) sequence of the approximately 938bp-1233bp of amplification plasmid pPIC9K, glue reclaims amplified production and uses restriction enzyme BamH I and Not I double digestion, enzyme is cut product glue and is reclaimed standby, 2) plasmid pPIC9K is used restriction enzyme BamH I and Not I double digestion glue reclaim standby, 3) enzyme of preparing in above-mentioned two steps is cut to carrier and be connected with fragment, and will connect product conversion bacillus coli DH 5 alpha, by screening, obtain plasmid pPIC9K-seq2-1, this is for adding Cpo I site process, 4) with primer (5 ' ATGCAGATCTTACGTACTGCCTCGCGCGTTTCGGTGATGAC 3 ' (SEQ ID NO:7), 5 ' AGTCAGATCTCGAATAATAACTGTTATTTTTCAG 3 ' (SEQ ID NO:8)) sequence of the approximately 6880bp-9276bp of amplification plasmid pPIC9K, glue reclaims amplified production and cuts with restriction enzyme Bgl II enzyme, and enzyme is cut product glue and reclaimed standby, 2) plasmid pPIC9K-seq2-1 being cut to also glue with Bgl II enzyme reclaims standby, 3) enzyme of preparing in above-mentioned two steps being cut to carrier is connected with fragment, and will connect product conversion bacillus coli DH 5 alpha, by screening, obtain plasmid pPIC9K-seq2, this,, for adding SnaB I site process, contains sequence SEQ ID NO:2 through nucleotide sequencing plasmid pPIC9K-seq2.Plasmid pPIC9K-seq2 is cut with restriction enzyme SnaB I and Cpo I enzyme and glue reclaim about 5.65kb fragment be rear class carrier segments, the fragment that is equivalent to sequence and is SEQ ID NO:2 is cut and is produced two ends through restriction enzyme SnaB I and Cpo I enzyme, and end sequence is:

The object of condition of above-mentioned pcr amplification is: 10 * Pyrobest DNA Polymorase Buffer, 5 μ L; DNTP (10mM), 4 μ L; Primer (20 μ M), each 1 μ L; Plasmid template, 1ng; Pyrobest DNA Polymerase (TaKaRaCode DR005A), 0.5-1U; Mend distilled water to cumulative volume 50 μ L.PCR cycling condition is: 94 ℃ of 5min; 94 ℃ of 1min, 50-55 ℃ of 1min, 72 ℃ of 1.5-3min, 30 circulations; 72 ℃ of 10min.Described plasmid extraction requires according to test kit (QIAGENPlasmid Mini Kit Cat.No.12123) specification sheets and replaces TE damping fluid to dissolve plasmid with sterile distilled water.It is that Acc I (TaKaRa Code D1001A), SnaB I (TaKaRaCode D1179A), Cpo I (TaKaRa Code D1035A), BamH I (TaKaRa Code D1010A), Pst I (TaKaRaCode D1073A), Not I (TaKaRa Code D1166A) and Bgl II (TaKaRa Code D1021A) etc. are all used to specifications that the enzyme of described plasmid and carrier is cut restriction enzyme used.It is standby after glue reclaims test kit (QIAGEN MinElute Gel Extraction Kit Cat.No.28604) recovery that PCR product and enzyme are cut product, and operation is undertaken by test kit specification sheets.Described ligation and embodiment 3.Described connection product transforms, clone is screened and microbial culture etc. is basic molecular biology operation, and plasmid construction used, the bacterial strain that copies and preserve are bacillus coli DH 5 alpha.Before and after containing, the plasmid of class carrier segments is correct through the order-checking contained SEQ ID NO:1 of proof and SEQID NO:2 sequence.

SEQ?ID?NO：1

TACGTAAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCCACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGCCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAGGATCGAGTCTAC

SEQ?ID?NO：2

CGGACCGGCGGCCGCGAATTAATTCGCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTTATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCTATCGAATCTAAATGTAAGTTAAAATCTCTAAATAATTAAATAAGTCCCAGTTTCTCCATACGAACCTTAACAGCATTGCGGTGAGCATCTAGACCTTCAACAGCAGCCAGATCCATCACTGCTTGGCCAATATGTTTCAGTCCCTCAGGAGTTACGTCTTGTGAAGTGATGAACTTCTGGAAGGTTGCAGTGTTAACTCCGCTGTATTGACGGGCATATCCGTACGTTGGCAAAGTGTGGTTGGTACCGGAGGAGTAATCTCCACAACTCTCTGGAGAGTAGGCACCAACAAACACAGATCCAGCGTGTTGTACTTGATCAACATAAGAAGAAGCATTCTCGATTTGCAGGATCAAGTGTTCAGGAGCGTACTGATTGGACATTTCCAAAGCCTGCTCGTAGGTTGCAACCGATAGGGTTGTAGAGTGTGCAATACACTTGCGTACAATTTCAACCCTTGGCAACTGCACAGCTTGGTTGTGAACAGCATCTTCAATTCTGGCAAGCTCCTTGTCTGTCATATCGACAGCCAACAGAATCACCTGGGAATCAATACCATGTTCAGCTTGAGACAGAAGGTCTGAGGCAACGAAATCTGGATCAGCGTATTTATCAGCAATAACTAGAACTTCAGAAGGCCCAGCAGGCATGTCAATACTACACAGGGCTGATGTGTCATTTTGAACCATCATCTTGGCAGCAGTAACGAACTGGTTTCCTGGACCAAATATTTTGTCACACTTAGGAACAGTTTCTGTTCCGTAAGCCATAGCAGCTACTGCCTGGGCGCCTCCTGCTAGCACGATACACTTAGCACCAACCTTGTGGGCAACGTAGATGACTTCTGGGGTAAGGGTACCATCCTTCTTAGGTGGAGATGCAAAAACAATTTCTTTGCAACCAGCAACTTTGGCAGGAACACCCAGCATCAGGGAAGTGGAAGGCAGAATTGCGGTTCCACCAGGAATATAGAGGCCAACTTTCTCAATAGGTCTTGCAAAACGAGAGCAGACTACACCAGGGCAAGTCTCAACTTGCAACGTCTCCGTTAGTTGAGCTTCATGGAATTTCCTGACGTTATCTATAGAGAGATCAATGGCTCTCTTAACGTTATCTGGCAATTGCATAAGTTCCTCTGGGAAAGGAGCTTCTAACACAGGTGTCTTCAAAGCGACTCCATCAAACTTGGCAGTTAGTTCTAAAAGGGCTTTGTCACCATTTTGACGAACATTGTCGACAATTGGTTTGACTAATTCCATAATCTGTTCCGTTTTCTGGATAGGACGACGAAGGGCATCTTCAATTTCTTGTGAGGAGGCCTTAGAAACGTCAATTTTGCACAATTCAATACGACCTTCAGAAGGGACTTCTTTAGGTTTGGATTCTTCTTTAGGTTGTTCCTTGGTGTATCCTGGCTTGGCATCTCCTTTCCTTCTAGTGACCTTTAGGGACTTCATATCCAGGTTTCTCTCCACCTCGTCCAACGTCACACCGTACTTGGCACATCTAACTAATGCAAAATAAAATAAGTCAGCACATTCCCAGGCTATATCTTCCTTGGATTTAGCTTCTGCAAGTTCATCAGCTTCCTCCCTAATTTTAGCGTTCAACAAAACTTCGTCGTCAAATAACCGTTTGGTATAAGAACCTTCTGGAGCATTGCTCTTACGATCCCACAAGGTGGCTTCCATGGCTCTAAGACCCTTTGATTGGCCAAAACAGGAAGTGCGTTCCAAGTGACAGAAACCAACACCTGTTTGTTCAACCACAAATTTCAAGCAGTCTCCATCACAATCCAATTCGATACCCAGCAACTTTTGAGTTGCTCCAGATGTAGCACCTTTATACCACAAACCGTGACGACGAGATTGGTAGACTCCAGTTTGTGTCCTTATAGCCTCCGGAATAGACTTTTTGGACGAGTACACCAGGCCCAACGAGTAATTAGAAGAGTCAGCCACCAAAGTAGTGAATAGACCATCGGGGCGGTCAGTAGTCAAAGACGCCAACAAAATTTCACTGACAGGGAACTTTTTGACATCTTCAGAAAGTTCGTATTCAGTAGTCAATTGCCGAGCATCAATAATGGGGATTATACCAGAAGCAACAGTGGAAGTCACATCTACCAACTTTGCGGTCTCAGAAAAAGCATAAACAGTTCTACTACCGCCATTAGTGAAACTTTTCAAATCGCCCAGTGGAGAAGAAAAAGGCACAGCGATACTAGCATTAGCGGGCAAGGATGCAACTTTATCAACCAGGGTCCTATAGATAACCCTAGCGCCTGGGATCATCCTTTGGACAACTCTTTCTGCCAAATCTAGGTCCAAAATCACTTCATTGATACCATTATTGTACAACTTGAGCAAGTTGTCGATCAGCTCCTCAAATTGGTCCTCTGTAACGGATGACTCAACTTGCACATTAACTTGAAGCTCAGTCGATTGAGTGAACTTGATCAGGTTGTGCAGCTGGTCAGCAGCATAGGGAAACACGGCTTTTCCTACCAAACTCAAGGAATTATCAAACTCTGCAACACTTGCGTATGCAGGTAGCAAGGGAAATGTCATACTTGAAGTCGGACAGTGAGTGTAGTCTTGAGAAATTCTGAAGCCGTATTTTTATTATCAGTGAGTCAGTCATCAGGAGATCCTCTACGCCGGACGCATCGTGGCCGACCTGCAGGGGGGGGGGGGGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGAGGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTTTCCCCCCCCCCCCTGCAGGTCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGAGTATCTATGATTGGAAGTATGGGAATGGTGATACCCGCATTCTTCAGTGTCTTGAGGTCTCCTATCAGATTATGCCCAACTAAAGCAACCGGAGGAGGAGATTTCATGGTAAATTTCTCTGACTTTTGGTCATCAGTAGACTCGAACTGTGAGACTATCTCGGTTATGACAGCAGAAATGTCCTTCTTGGAGACAGTAAATGAAGTCCCACCAATAAAGAAATCCTTGTTATCAGGAACAAACTTCTTGTTTCGAACTTTTTCGGTGCCTTGAACTATAAAATGTAGAGTGGATATGTCGGGTAGGAATGGAGCGGGCAAATGCTTACCTTCTGGACCTTCAAGAGGTATGTAGGGTTTGTAGATACTGATGCCAACTTCAGTGACAACGTTGCTATTTCGTTCAAACCATTCCGAATCCAGAGAAATCAAAGTTGTTTGTCTACTATTGATCCAAGCCAGTGCGGTCTTGAAACTGACAATAGTGTGCTCGTGTTTTGAGGTCATCTTTGTATGAATAAATCTAGTCTTTGATCTAAATAATCTTGACGAGCCAAGGCGATAAATACCCAAATCTAAAACTCTTTTAAAACGTTAAAAGGACAAGTATGTCTGCCTGTATTAAACCCCAAATCAGCTCGTAGTCTGATCCTCATCAACTTGAGGGGCACTATCTTGTTTTAGAGAAATTTGCGGAGATGCGATATCGAGAAAAAGGTACGCTGATTTTAAACGTGAAATTTATCTCAAGATCTTACGTA

Embodiment 2

Prepare goal gene fragment

Design two primers green fluorescent protein GFP gene that is used for increasing, 5 ' the end at upstream primer adds base CTA (to note: because first amino acid is ATG coding, for guaranteeing that reading frame is correct, first base of GFP gene A is replaced by the A in CTA base), 5 ' end of downstream primer adds bases G TCA and terminator codon, and the sequence of primer is as follows:

Upstream primer 5 ' cTAtGGTGAGCAAGG 3 ' (SEQ ID NO:9)

Downstream primer 5 ' gTCAtTATACTTGTACAGC 3 ' (SEQ ID NO:10)

The object of condition of pcr amplification is: 10 * Pyrobest DNA Polymorase Buffer, 5 μ L; DNTP (10mM), 4 μ L; Upstream primer (20 μ M), 1 μ L; Downstream primer (20 μ M), 1 μ L; The plasmid pEGFP-C1 that contains GFP gene (GenBank Accession #:U55763), 1ng; Pyrobest DNA Polymerase (TaKaRa Code DR005A), 0.5-1U; Mend distilled water to cumulative volume 50 μ L.PCR cycling condition is: 94 ℃ of 5min; 94 ℃ of 1min, 55 ℃ of 1min, 72 ℃ of 1.5min, 30 circulations; 72 ℃ of 10min.Product is standby after PCR product purification test kit (QIAGEN MinElute PCRPurification Kit Cat.No.28004) purifying is measured concentration by agarose gel electrophoresis, and purification process is undertaken by test kit specification sheets.

The PCR product that purifying is obtained is processed with T4 DNA Polymerase (TaKaRa Code D2040), and reaction system is: 10 * T4 DNA Polymorase Buffer, 5 μ L; DTTP (2.5mM), 4 μ L; Pcr amplification GFP product, 10nmol; T4 DNA Polymerase, 4U; Mend distilled water to cumulative volume 50 μ L, 37 ℃ of reaction 0.5h.Vortex termination reaction, standby.

Above-mentioned prepared goal gene fragment is about 0.73kb, and end sequence is respectively at above-mentioned class carrier segments end sequence coupling, and its end sequence is:

Embodiment 3

The class carrier segments of above-mentioned preparation is connected to (E.coli DNA Ligase, TaKaRa Code D2160A) with goal gene fragment with intestinal bacteria ligase enzyme, and reaction system is: class carrier segments, each 10pmol; Goal gene fragment, 10pmol; 10 * E.coli DNA Ligase Buffer, 10 μ L; 10 * BSA (0.05%) 10 μ L; E.coli DNA Ligase, 3U; Mend distilled water to cumulative volume 100 μ L, 16 ℃ of reaction 3h, 0.8-1% agarose gel electrophoresis monitoring is take in reaction, and (result is as Fig. 5: swimming lane 3 is connection 3h detected result, swimming lane 2 is not for adding the control group of ligase enzyme), and the DNA fragmentation of glue recovery 7.3kb is standby, this fragment is the linearization plasmid carrier segments of " class carrier after front class carrier-GFP-".From electrophoresis result, can find out very efficiently and accurately of joint efficiency, substantially see the band of few incorrect link, 5.65kb fragment is found that there is higher than 80% fragment generation ligation by densitometric scan.If any not junction fragment existence, obviously reclaim junction fragment and connect product for transforming to be better than directly transforming.

Embodiment 4

Transform host living beings screening positive clone

The above-mentioned linearized vector fragment building is transformed to complete formula yeast (Pichia pastoris) bacterial strain GS115, operate the method transforming according to shocking by electricity in the complete formula yeast expression handbook of Invitrogen company completely and in solid MD flat board, screen acquisition positive colony.By bacterium colony thalline PCR, confirm that two bacterium colonies contain GFP gene, thalline PCR method is consistent with PCR method in above-described embodiment 2, only template is changed into yeast thalline and replace Pyrobest archaeal dna polymerase with Taq archaeal dna polymerase (TaKaRa Code DR001A), the results are shown in Figure 6.

The positive colony that picking thalline PCR checking contains GFP gene, according to the expression of the complete formula yeast expression handbook induction GFP albumen of Invitrogen company, and with inverted fluorescence microscope Axiovert 200, observe the expression of GFP albumen, see Fig. 7, Fig. 7 A is the rear white light passage observations of induction, and thalline is high-visible, and Fig. 7 B is bacterium colony GFP passage observations after inducing, background is black, thalline clear-cut visible (bacterium colony that does not turn GFP gene is invisible at this passage).

Claims

1. a linearizing expression vector establishment method, comprises the following steps:

A) the redundancy base number of single 5 ' redundancy sticky end is 2-4;

B) the redundancy base of two 5 ' redundancy sticky ends is selected from three kinds at the most in A, T, C and G, and arbitrary redundancy base all holds the complementary base of first base different from 3 ' of arbitrary single stranded DNA in goal gene fragment, cohesive end is produced by the degraded of T4DNA polysaccharase;

An end of described front class carrier segments is 5 ' redundancy sticky end, and with described goal gene fragment in, 5 ' the redundancy sticky end that coding strand 5 ' end is corresponding is complementary mutually, another end is flush end or the end processed through dephosphorylation enzyme;

2) described rear class carrier segments end is 5 ' redundancy sticky end, and with described goal gene fragment in, 5 ' the redundancy sticky end that coding strand 3 ' end is corresponding is complementary mutually, another end is flush end or the end processed through dephosphorylation enzyme; According to the front class carrier segments of the design construction of step 1), rear class carrier segments and goal gene fragment, the structure of goal gene fragment comprises the following steps:

B. by after the pcr amplification product purifying of goal gene, utilize T4DNA polysaccharase to produce 5 ' redundancy sticky end, in described step B, the method of utilizing T4DNA polysaccharase to produce 5 ' redundancy sticky end is: by the pcr amplification product of the goal gene of purifying in the reaction system that has base substrate to exist, with T4DNA polysaccharase, process, the final goal gene fragment obtaining with 5 ' redundancy sticky end, described base substrate is selected from dATP, dCTP, dGTP and dTTP, and must be containing the corresponding base substrate of first base that needs to be built two single stranded DNAs, the 3 ' end of goal gene fragment, and must not be containing the corresponding base substrate of complementary base of arbitrary redundancy base in the goal gene fragment that needs to be built,

3) by step 2) the front class carrier segments building, rear class carrier segments and goal gene fragment adopt ligase enzyme to connect to obtain front class carrier segments, goal gene fragment and rear class carrier segments connected linear dsdna expression vector successively, and described ligase enzyme is selected from T4DNA ligase enzyme or intestinal bacteria ligase enzyme.

2. linearizing expression vector establishment method as claimed in claim 1, is characterized in that, in described step 1), 5 ' redundancy sticky end of described goal gene fragment also meets in following requirement at least one:

C) in two 5 ' redundancy sticky ends, only have at the most a 5 ' redundancy sticky end to contain palindrome symmetric sequences;

D) between two 5 ' redundancy sticky ends, the matching rate of base is low.

3. linearizing expression vector establishment method as claimed in claim 2, is characterized in that the described c of requirement) be: two 5 ' redundancy sticky ends all do not have palindrome symmetric sequences; The described d of requirement) be specially: between two 5 ' redundancy sticky ends, the base number of maximum continuous pairings is not more than half of redundancy base number of any 5 ' redundancy sticky end, and when there is the continuous pairing at a plurality of intervals, the total number of base of coupling is less than the total number of unmatched base.

4. linearizing expression vector establishment method as claimed in claim 1, it is characterized in that, step 2) in, the preparation method of described front class carrier segments and rear class carrier segments is: 4 ends in the class carrier segments designing add polynucleotide joint, after the class carrier segments of preparation with polynucleotide joint, be cloned in cyclic plasmid carrier or transformed more existing plasmid vectors, then described plasmid vector is copied in intestinal bacteria, extract plasmid, by toolenzyme, processes the acquisition of polynucleotide joint and meet the end requiring described in step 1).

5. linearizing expression vector establishment method as claimed in claim 4, is characterized in that, describedly with toolenzyme, processes polynucleotide joint and obtains and meet the end requiring described in step 1), selects one of following methods:

Method one: utilize the polynucleotide joint of digestion with restriction enzyme class carrier segments end, directly obtain end and just meet front class carrier segments and the rear class carrier segments that step 1) tip designs requires;

Method two: first utilize the polynucleotide joint of digestion with restriction enzyme class carrier segments end, then the end producing with nuclease, archaeal dna polymerase treatment limits restriction endonuclease meets to produce the cohesive end that step 1) tip designs requires.

6. linearizing expression vector establishment method as claimed in claim 1, it is characterized in that, described front class carrier segments, goal gene fragment and rear class carrier segments in connected linear dsdna expression vector, contain homologous recombination sequence, screening-gene, promotor and terminator successively.

7. linearizing expression vector establishment method as claimed in claim 6, it is characterized in that, described front class carrier segments, goal gene fragment and rear class carrier segments also contain successively enhanser, signal peptide in connected linear dsdna expression vector and the albumen that merges with goal gene product at least one.

8. for building a class carrier segments for linearizing expression vector, comprise front class carrier segments and rear class carrier segments, the rear end of described front class carrier-pellet degree is 5 ' redundancy sticky end, and front end is flush end; The front end of rear class carrier segments is 5 ' redundancy sticky end, and rear end is flush end; The redundancy base sequence of rear end 5 ' the redundancy sticky end of described front class carrier segments is 3 '-GA5 ', and another end is flush end; The redundancy base sequence of front end 5 ' the redundancy sticky end of rear class carrier segments is 5 ' GAC-3 ', and another end is flush end.

9. as claimed in claim 8 for building the class carrier segments of linearizing expression vector, it is characterized in that, described front class carrier segments and rear class carrier segments contain homologous recombination sequence, screening-gene, promotor and terminator.

10. as claimed in claim 8 for building the class carrier segments of linearizing expression vector, it is characterized in that, described front class carrier segments is included in the fragment that sequence is SEQ ID NO:1, two ends are cut and are produced described end through SnaB I and Acc I enzyme, described rear class carrier segments is included in the fragment that sequence is SEQ ID NO:2, and two ends are cut and produced described end through SnaB I and Cpo I enzyme.

11. as arbitrary in claim 8-10 as described in the using method of class carrier segments, comprise the following steps:

1) structure of goal gene fragment:

2) goal gene fragment is connected with described class carrier segments.

12. using method as claimed in claim 11, it is characterized in that, in PCR primer with polynucleotide joint described in step 1), the upstream primer of goal gene is with 5 ' CTA-3 ' joint, the downstream primer of goal gene is with 3 '-ACTG5 ' joint, adopt the amplified production after described PCR primer amplification, under base substrate dTTP exists, through T4DNA polysaccharase, after processing, produce 5 ' redundancy sticky end.