CN102911961A

CN102911961A - Construction method for linearized expression vector and simulated vector segments used for construction of linearized expression vector

Info

Publication number: CN102911961A
Application number: CN2011102183840A
Authority: CN
Inventors: 尚玉栓
Original assignee: Individual
Current assignee: Individual
Priority date: 2011-08-01
Filing date: 2011-08-01
Publication date: 2013-02-06
Anticipated expiration: 2031-08-01
Also published as: CN102911961B

Abstract

The invention provides a construction method for a linearized expression vector and simulated vector segments used for the construction of the linearized expression vector. The construction method for the linearized expression vector comprises the following steps of designing and constructing a front simulated vector segment, a back simulated vector segment and a target gene segment; and connecting the front simulated vector segment, the back simulated vector segment and the target gene segment with ligase to obtain a linearized double-strand DNA expression vector. The invention further provides the simulated vector segments used for the construction of the linearized expression vector. By preparing simulated linearized vector segments through efficient and accurate connection reaction, a process of obtaining the linearized vector segments through the construction of complex and time-consuming ring-shaped plasmid vectors can be avoided; and simultaneously, and the generation of target gene terminals is not limited by the sequence, so that operations are greatly simplified; cost can be reduced; experimental period is shortened; and the method has very good application prospects in expression systems of yeast and the like.

Description

A kind of linearizing expression vector establishment method reaches the class carrier segments that is used for the linearizing expression vector establishment

Technical field

The present invention relates to the biological gene recombination and expression techniques, be specifically related to the class carrier segments that a kind of ligation direct construction linearized vector fragment by efficiently and accurately realizes linearizing expression vector establishment method and is used for the linearizing expression vector establishment.

Background technology

The dna recombinant expression technology is in an increasingly wide range of applications in current bio-science research and industrialization.At present, the host living beings of dna recombinant expression has a variety of, such as intestinal bacteria, subtilis, yeast and mammalian cell etc.In a lot of situations, when utilizing these host living beings to express goal gene, need in intestinal bacteria, to make up first a correct cyclic plasmid carrier that inserts goal gene, to transform again host living beings after this carrier purification, the linearizing, goal gene is incorporated into by homologous recombination in the genome of host living beings, can obtain clone's of stably express according to screening-gene.Such as the pPIC9K carrier (Invitrogen) of formula yeast (Pichia pastoris) and the pOptiVEC of Chinese hamster ovary cell CHO of finishing commonly used ^TM-TOPO carrier (Invitrogen) all belongs to this type of.Fig. 2 is take the bacterial strain GS115 that finishes formula yeast (Pichia pastoris) and carrier pPIC9K expressing green fluorescent protein GFP illustrates this recombinant expressed process as example basic step.This recombinant expressed process is finished by the operation of 17 steps basically as we know from the figure, it is to make up a linearized vector fragment that the operation of 15 steps is wherein arranged, need during this time repeatedly the operations such as microbial culture, plasmid extraction, enzyme are cut, purifying, cost is higher and loaded down with trivial details, generally needs the above time in a week.Go on foot required linearized vector fragment or the dna fragmentation of identical function is arranged if but scale preparation, general dna fragmentation similar substrates and that contain the required element of genetic expression and goal gene fragment directly can be prepared among Fig. 2 the 15th by ligation, then can avoid the plamid vector construction process, related work can be finished in one day and be very simple, this will accelerate recombinant expressed speed greatly, and technological line is seen Fig. 3.

The process of above-mentioned direct construction linearized vector requires very high to ligation efficient.The type of the ligation of widespread use had following three kinds during current gene cloning was expressed: one, all contain multiple clone site in the clonal expression plasmid vector of the ring-type of thumping majority, produce end behind goal gene and the carrier digestion with restriction enzyme in multiple clone site, can pass through ligase enzyme catalysis ligation between end; Two, in T carrier and TOPO serial carrier (Invitrogen), carrier and goal gene produce ligation by terminal base T and A, wherein reaction mediates ligation by ligase enzyme catalysis and react by topoisomerase I (Topoisomerase I) in the TOPO serial carrier in the T carrier; Three, other disconnected enzymatic ligation is such as the LoxP site homologous recombination construction carrier of GatewayTM system (Gibco/Life Technologies) and the mediation of the employing Cre of EchoTM system (Invitrogen) enzyme.Find in the practice that above-mentioned three major types ligation joint efficiency is all very low and very easily produce incorrect link, need in intestinal bacteria, screen the positive colony that correctly is connected into goal gene, obviously be not suitable for being directly used in the structure linearized vector.

Chinese patent application case (Chinese patent application number 02116936.5,02117763.5 and 02123460.4) has been reported three kinds of linearized vector construction processs that need not to clone and has been paid attention to participating in the generation of the end of ligation.Providing respectively a kind of method of end generation during each is invented, is respectively to produce the RNA protruding terminus of end, DNA and RNA crossbred as end, nickase and exonuclease effect generation end with the digestion with restriction enzyme that asymmetry is cut.Thereby the fragment that is equivalent to carrier and goal gene with associated end produce the linearized vector that the ligation structure need not to clone by the catalysis of T4DNA ligase enzyme.These methods are subject to certain restrictions in the practical application, fail further to be widely applied.

Summary of the invention

The objective of the invention is to overcome defective of the prior art, provide a kind of ligation direct construction linearized vector fragment by efficiently and accurately to realize quick transgenic method.

The present invention mainly is that the ligation direct construction of the efficiently and accurately of three segment DNA fragments by as shown in Figure 1 transforms the required linearized vector fragment of the host living beings of expressing goal gene or the fragment of identical function is arranged, avoided obtaining the cumbersome approaches of linearized vector fragment by making up the cyclic plasmid carrier, thereby realized quick genetically modified operation.

Be convenient statement, in the present invention three sections dna fragmentations that connect successively among Fig. 1 be called front class carrier segments, goal gene fragment and rear class carrier segments.In the goal gene fragment, an end of the dna sequence dna that coding strand 5 ' end is corresponding is called the front end of goal gene fragment, and an end of the dna sequence dna that coding strand 3 ' end is corresponding is called the rear end of goal gene fragment.The front end of goal gene fragment is connected with front class carrier segments rear end, and the rear end of goal gene fragment is connected with rear class carrier segments front end.

One aspect of the present invention provides a kind of linearizing expression vector establishment method, comprises the following steps:

1) design front class carrier segments, rear class carrier segments and goal gene fragment,

Described front class carrier segments, rear class carrier segments and goal gene fragment satisfy following requirement;

Described goal gene fragment contains goal gene and two ends are 5 ' redundant sticky end;

5 ' redundant sticky end of described goal gene fragment satisfies following requirement simultaneously:

A) the redundant base number of single 5 ' redundant sticky end is 1-10, and better is 2-6, and best is 2-4;

B) the redundant base of two 5 ' redundant sticky ends is selected among A, T, C and the G three kinds at the most, and arbitrary redundant base is all different from the complementary base of the first base of 3 ' end of arbitrary single stranded DNA in the goal gene fragment, and cohesive end is by the degraded generation of T4 archaeal dna polymerase;

Further preferred, 5 ' redundant sticky end of described goal gene fragment also satisfies at least one item in the following requirement:

C) only have at the most a 5 ' redundant sticky end to contain palindrome symmetric sequences in two 5 ' redundant sticky ends; Preferably two 5 ' redundant sticky ends all do not have palindrome symmetric sequences.

D) matching rate of base is low between two 5 ' redundant sticky ends.Better, the base number of maximum continuous pairings is not more than half of redundant base number of any 5 ' redundant sticky end between two 5 ' redundant sticky ends, and when the continuous pairing at a plurality of intervals occurring, the total number of the base of coupling is less than the total number of unmatched base.Continuously pairing refer in the cohesive end more than 2 or 2 next-door neighbour's base simultaneously with another cohesive end in corresponding base pairing.

An end of described front class carrier segments is 5 ' redundant sticky end, and in described goal gene fragment, 5 ' the redundant sticky end (front end of goal gene fragment) that coding strand 5 ' end is corresponding is complementary mutually, this end is the rear end of front class carrier segments, another end is flush end or the end processed through the dephosphorylation enzyme, and this end is the front end of front class carrier segments;

An end of described rear class carrier segments is 5 ' redundant sticky end, and in described goal gene fragment, 5 ' the redundant sticky end (rear end of goal gene fragment) that coding strand 3 ' end is corresponding is complementary mutually, this end is the front end of rear class carrier segments, another end is flush end or the end processed through the dephosphorylation enzyme, and this end is the rear end of rear class carrier segments;

2) according to step 1) the front class carrier segments of design construction, rear class carrier segments and goal gene fragment;

3) with step 2) the front class carrier segments, rear class carrier segments and the goal gene fragment that make up directly adopt ligase enzyme to connect to obtain successively continuous linear dsdna expression vector of front class carrier segments, goal gene fragment and rear class carrier segments.

Step 1) in, described 5 ' redundant sticky end refers to 5 ' outstanding sticky end; Described redundant base refers to the strand base of 5 ' protuberance in 5 ' the redundant sticky end.

The redundant base of two 5 ' redundant sticky ends of described goal gene is selected from three kinds at the most among A, T, C and the G, and arbitrary redundant base is all different from the complementary base of the first base of arbitrary single stranded DNA 3 ' end in the goal gene fragment.For instance, namely meet afore mentioned rules such as following fragment:

In the above-mentioned fragment, underscore partly is redundant base, is the complementary base of the first base of single stranded DNA 3 ' end with the base of square frame.In fragment (1), redundant base kind is A, T and G, and the complementary base of two first bases of single stranded DNA 3 ' end is C, and the arbitrary redundant base all complementary base from the first base of two single stranded DNAs, 3 ' end is different; In fragment (2), redundant base kind is T and G, and the complementary base of two first bases of single stranded DNA 3 ' end is respectively C and A, and the arbitrary redundant base all complementary base from the first base of two single stranded DNAs, 3 ' end is different.

Design and meet step 1) after the front class carrier segments, rear class carrier segments and the goal gene fragment that require, front class carrier segments and rear class carrier segments plasmid vector contains required end with preparation class carrier segments can be implemented in, the pcr amplification product of goal gene the goal gene fragment that contains required end can be processed to prepare with T4 archaeal dna polymerase enzyme.

Described step 3) in, ligase enzyme can be selected from T4 dna ligase or intestinal bacteria ligase enzyme.

Among the present invention, three segment DNAs successively linked enzyme connect to produce in the ligation of linearized vector fragment (i.e. front class carrier segments, goal gene fragment and rear class carrier segments successively continuous linear dsdna expression vector) of " front class carrier-goal gene-rear class carrier ", only has the ligation of the front end of the rear end of front class carrier segments and goal gene fragment, and the ligation of the rear end of the front end of rear class carrier segments and goal gene fragment expects, and the ligation between other ends all is unexpected.

For the rear end of the front end of guaranteeing front class carrier segments or rear class carrier segments does not participate in any ligation as much as possible, it is flat terminal that optimized mode is that the rear end of the front end of front class carrier segments or rear class carrier segments is, and selects the intestinal bacteria ligase enzyme.Be flat terminal restriction enzyme after flat terminal generation can adopt enzyme to cut, the sticky end after also can cutting enzyme through the single-chain nucleic acid excision enzyme scabble process obtain flat terminal or through archaeal dna polymerase fill process obtain flat terminal.

Better, the structure of goal gene fragment comprises the following steps:

A. design the pcr amplification product that the primer amplification goal gene obtains goal gene;

B. behind the pcr amplification product purifying with goal gene, utilize the T4DNA polysaccharase to produce 5 ' redundant sticky end.

Primer described in the steps A comprises a upstream primer and downstream to primer, and the polynucleotide joint sequence that 5 ' end of described upstream primer and downstream primer all adds 1-10 base is with corresponding with the redundant base section of designed 5 ' redundant sticky end.

Among the above-mentioned steps B, the method of utilizing the T4DNA polysaccharase to produce 5 ' redundant sticky end is: with the pcr amplification product of the goal gene of purifying in the reaction system that has the base substrate to exist, process with the T4 archaeal dna polymerase, the final goal gene fragment that obtains with 5 ' redundant sticky end, described base substrate is selected from dATP, dCTP, dGTP and dTTP, and must contain the corresponding base substrate of first base of two single stranded DNAs, the 3 ' end that remains to be made up goal gene, and must not contain the corresponding base substrate of complementary base of arbitrary redundant base in the goal gene fragment that remains to be made up.

Described base substrate and must containing remains to be made up the corresponding base substrate of first base of two single stranded DNAs, the 3 ' end of goal gene, and must not contain the corresponding base substrate of complementary base of arbitrary redundant base in the goal gene fragment that remains to be made up.For instance, as follows if intend the goal gene fragment of structure:

For fragment (1), the redundant base kind of this fragment is A, T and G, their complementary base is T, A and C just, corresponding base substrate is exactly dTTP, dATP and dCTP respectively, article two, the first base of single stranded DNA 3 ' end is G, corresponding base substrate is exactly dGTP, and the used base substrate of step B must contain dGTP so, and must not contain dTTP, dATP and dCTP.

For fragment (2), the redundant base kind of this fragment is T and G, their complementary base is A and C just, corresponding base substrate is exactly dATP and dCTP respectively, article two, the first base of single stranded DNA 3 ' end is G and T, corresponding base substrate is exactly dGTP and dTTP, and the used base substrate of step B must contain dGTP and dTTP so, and must not contain dATP and dCTP.

The principle that adopts aforesaid method to make up the goal gene fragment is to have utilized the degrading activity of T4 archaeal dna polymerase 3 ' → 5 ' end to obtain 5 ' redundant sticky end.This terminal construction process not only overcome multiple clone site in the various plasmid vectors restriction enzyme select the restriction that is subjected to the goal gene sequence and restriction endonuclease sites the time the be everlasting aminoterminal of expression product stay several amino acid whose shortcomings, and make front class carrier segments and rear class carrier segments that very strong versatility be arranged, be that identical front class carrier segments and rear class carrier segments can be used for the not expression of homotactic goal gene, be easy to higher flux and commercialization.

Front class carrier segments rear end and rear class carrier segments front end be respectively with the sticky end of two 5 ' redundant sticky end complementations of goal gene fragment, also be 5 ' cohesive end, base kind, number and sequence determine by the cohesive end of goal gene.The cohesive end of considering front class carrier segments rear end and rear class carrier segments front end must easily produce and have the requirement of 5 ' phosphorylation, and front class carrier segments and rear class carrier segments (afterwards all referred to as the class carrier segments) be preparation easily, after designing the class carrier segments, add the polynucleotide joint at its 4 ends respectively, after the class carrier segments of preparation with the polynucleotide joint, it is cloned in the cyclic plasmid carrier (such as pUC18, the common carrier such as pBR322) in or transform more existing plasmid vectors (such as pPIC9K, the common carrier such as pPIC3.5K), it can copy in intestinal bacteria, extract plasmid, pass through restriction enzyme, the polynucleotide joint that a series of toolenzymes such as nuclease and polysaccharase are processed in the carrier can obtain to meet step 1) described end, concrete and better, described polynucleotide joint with toolenzyme processing class carrier segments end selects one of following methods to produce:

Method one: utilize the polynucleotide joint of digestion with restriction enzyme class carrier segments end, directly obtain end and just meet step 1) front class carrier segments and the rear class carrier segments of tip designs requirement.Cut polynucleotide joint (5 ' GCGGCCGC 3 ') and restriction enzyme Cpo I enzyme and cut the 5 ' cohesive end that polynucleotide joint (5 ' CGGACCG 3 ') produces and can be used as the rear end of front class carrier and the front end of rear class carrier as cut polynucleotide joint (5 ' GTCTAC 3 '), restriction enzyme Not I enzyme with restriction enzyme A cc I enzyme; With restriction enzyme SnaB I and EcoR V respectively enzyme cut the rear end that flat end that polynucleotide joint (5 ' TACGTA 3 ' and 5 ' GATATC 3 ') produces can be used as front end and the rear class carrier of front class carrier.

Method two: utilize and fail to obtain end behind the polynucleotide joint of digestion with restriction enzyme class carrier segments end and just meet step 1) when the front class carrier segments that requires of tip designs and rear class carrier segments, also need again to comprise with various nucleases, archaeal dna polymerase that end that T4DNA polysaccharase treatment limits restriction endonuclease produces could produce and meet step 1) cohesive end of tip designs requirement, it is the individual 5 ' cohesive end that does not wait of 0-10 that the method can produce redundant base number.Cut polynucleotide joint (5 ' CXGGTACC 3 ' such as restriction enzyme Kpn I enzyme, wherein CX is than the inboard of the more close class carrier of Kpn I end, X can be 0-9 even more bases, can be any base among base A, T, the G) after, can produce step 1 with the T4DNA polysaccharase base 5 ' XGGTAC 3 ' that under base substrate dCTP existence condition, degrades successively again) rear end of desired front class carrier and the front end of rear class carrier, can produce 5 ' cohesive end according to the difference of X base and be exemplified below: 3 ' AC 5 '; 3 ' ACC 5 '; 3 ' ATCC 5 '; 3 ' ACTATC 5 '; 3 ' CACTCAAC 5 '; 3 ' CACTCAACAC 5 '.After cutting polynucleotide joint (5 ' CTGCAG 3 ') such as restriction enzyme Pst I enzyme, can produce flatly terminal with the T4DNA polysaccharase base 5 ' TGCA 3 ' that under base substrate dCTP existence condition, degrades successively again, can be used as the rear end of front end and the rear class carrier of front class carrier.

For guarantee goal gene can be in host living beings stably express, contain the element that is necessary among the linear expression vector of " front class carrier-goal gene-rear class carrier " that the present invention is constructed (i.e. front class carrier segments, goal gene fragment and rear class carrier segments link to each other successively linear dsdna expression vector), comprise homologous recombination sequence, screening-gene, promotor and terminator, the albumen that also optionally comprises enhanser, signal peptide and merge with the goal gene product.

The homologous recombination sequence is one section sequence with host living beings genome homology, the fragment of " front class carrier-goal gene-rear class carrier " is incorporated in host's the karyomit(e), thereby makes stable the going down to posterity of goal gene.Screening-gene is the screening for positive colony, and two kinds of the auxotrophic gene of covering and antibiotics resistance genes are arranged.If selecting the expression strain of host living beings is the auxotrophic strain of the synthetic gene disappearances such as an amino acid or Nucleotide, screening-gene can be this synthetic gene, auxotrophic strain can not be grown in the substratum of the compound that does not add this gene product generation, and transform positive colony of goal gene owing to carrying this gene, can self produce corresponding compound, can in the substratum of the compound that does not add this gene product generation, grow, reach the purpose of screening.In yeast and mammalian cell conversion, use very extensive to antibiotics resistance gene, such as bleomycin (Zeocin) etc., be subject to unlike above-mentioned auxotroph one class in the use and have or not corresponding bacterial strain, positive colony that only transforms goal gene can be grown in adding the antibiotic substratum of this kind, thereby reaches the purpose of screening.Enhanser generally uses in mammalian cell expression vector, mainly is the expression that strengthens goal gene.Expression for a gene, after selecting a kind of host living beings, its selectable promotor, terminator, enhanser, signal peptide, homologous recombination sequence and screening-gene generally can find from this kind host's commercialization expression vector or expression vector commonly used, and be identical with the function of respective element in existing commercialization carrier or the expression vector commonly used in the use.

In the fragment of " front class carrier-goal gene-rear class carrier ", goal gene next-door neighbour's promotor and terminator also form with it the expression cassette of correct reading frame, correct transcription and translation, the both sides that the homologous recombination sequence is positioned at fragment are beneficial to restructuring, assist to express or need fusion rotein if need signal peptide, then it is between promotor and goal gene, and be connected into the formation that will guarantee equally proper reading frame, other element is positioned at the middle part of two class carrier segments (front class carrier segments and rear class carrier segments) as enhanser and screening-gene.

Thereby key of the present invention be by for the tip designs of front class carrier segments, goal gene fragment and rear class carrier segments so that the connection of efficiently and accurately be achieved.Adopt method of the present invention can make up the cyclic plasmid carrier and the direct construction linearized vector.The be everlasting aminoterminal of expression product of the restriction that is subjected to the goal gene sequence and selected restriction endonuclease sites of selecting that the production method of target gene 5 ' cohesive end has overcome the restriction enzyme of multiple clone site in the various plasmid vectors among the present invention stays several amino acid whose shortcomings, thereby make the class carrier segments that very strong versatility be arranged, namely identical class carrier segments can be used for the not expression of homotactic goal gene.Linear expression vector by direct construction " front class carrier-goal gene-rear class carrier " among the present invention obtains to clone the method for son and greatly simplifies work, pick up speed, be easy to simultaneously higher flux and implement, such as in the yeast two-hybrid experiment, extraordinary application prospect being arranged.

According to the principle of design of aforesaid method, the present invention also provides a kind of class carrier segments for making up the linearizing expression vector, comprises front class carrier segments and rear class carrier segments, and described front class carrier segments and rear class carrier segments satisfy following requirement:

The rear end of front class carrier segments is 5 ' redundant sticky end, and front end is flush end; The front end of rear class carrier segments is 5 ' redundant sticky end, and the rear end is flush end; 5 ' redundant sticky end of described front class carrier segments and rear class carrier segments satisfies following requirement simultaneously:

A. the redundant base number of 5 ' redundant sticky end of the rear end of front class carrier segments is 2, and the redundant base number of 5 ' redundant sticky end of the front end of rear class carrier segments is 3;

B. described two 5 ' redundant sticky ends are without palindrome symmetric sequences;

The base number of matching continuously between C. described two 5 ' redundant sticky ends self reach is less than 2.

Further, described front class carrier segments and rear class carrier segments contain the element of necessity of conventional expression vector, comprise homologous recombination sequence, screening-gene, promotor and terminator.

Further, be equipped with the homologous recombination sequence on front class carrier segments and the rear class carrier segments, described homologous recombination sequence is positioned near the front end of front class carrier segments or the front end and near the rear end or rear end of rear class carrier segments, is the AOX1 gene.

Further, described promotor is positioned near the rear end or rear end of front class carrier segments, is the AOX1 promotor, and described terminator is positioned at the front end of rear class carrier, is the AOX1 terminator.

Further, described screening-gene is positioned at the middle part of front class carrier segments and rear class carrier segments, is HIS4 and Kan.

The use of above-mentioned class carrier segments can by after adding the polynucleotide joint and use the T4DNA polysaccharase to process the goal gene fragment that obtains two ends and front class carrier segments rear end and the complementation of rear class carrier segments front end in the design PCR primer, adopt ligase enzyme to connect the acquisition linear expression vector.

According to above-mentioned principle of design, the embodiment of the invention specifically discloses a kind of class carrier segments for making up the linearizing expression vector, the redundant base sequence of 5 ' redundant sticky end of prepared front class carrier segments is " 3 '-GA 5 ' ", another end is flush end, the redundant base sequence of 5 ' redundant sticky end of rear class carrier segments is " 5 ' GAC-3 ' ", and another end is flush end.Front class carrier segments is included among the sequence SEQ ID NO:1, two ends are contained restriction enzyme site SnaB I and Acc I and namely are described ends through the end that two enzyme enzymes are cut generation, rear class carrier segments is included among the sequence SEQ ID NO:2, and two ends are contained restriction enzyme site SnaB I and Cpo I and namely are described ends through the end that two enzyme enzymes are cut generation.Described class carrier confirms that it can be used for making up the linearizing expression vector.

Use the method for class carrier segments of the present invention, can comprise the following steps:

1) structure of goal gene fragment:

A. design the pcr amplification product that obtains goal gene with the PCR primer amplification goal gene of polynucleotide joint; The polynucleotide joint of design should satisfy so that pcr amplification product all produces 5 ' redundant sticky end in two ends after the T4DNA polysaccharase is processed, and rear end 5 ' the redundant sticky end of 5 ' the redundant sticky end that coding strand 5 ' end is corresponding and the front class carrier segments of described class carrier segments is complementary, and front end 5 ' the redundant sticky end of 5 ' the redundant sticky end that coding strand 3 ' end is corresponding and the rear class carrier segments of described class carrier segments is complementary;

The requirement of general design of primers is satisfied in other designs of PCR primer.

B. behind the pcr amplification product purifying with goal gene, utilize the processing of T4DNA polysaccharase or toolenzyme enzyme to cut and produce 5 ' redundant sticky end;

2) the goal gene fragment is connected with described class carrier segments.Connecting product is that the linear dsdna fragment can be used for transforming expressive host.

Enumerate step 1 such as embodiment) primer of pcr amplification goal gene of design satisfies following condition; 5 ' end of primer adds the polynucleotide joint, and goal gene front end primer is front 3 joints that base is CTA of 5 ' end of upstream primer, and goal gene rear end primer is front 4 joints that base is GTCA of 5 ' end of downstream primer; Pcr amplification product with these 2 polynucleotide joints produces 5 ' redundant sticky end after the T4 archaeal dna polymerase is processed when base substrate dTTP exists, and rear end 5 ' the redundant sticky end of 5 ' the redundant sticky end that coding strand 5 ' end is corresponding and the front class carrier segments of described class carrier segments is complementary, and front end 5 ' the redundant sticky end of 5 ' the redundant sticky end that coding strand 3 ' end is corresponding and the rear class carrier segments of described class carrier segments is complementary;

According to principle of design of the present invention, those skilled in the art can also design front class carrier segments and the rear class carrier segments that much meets the above-mentioned end requirement, particularly the transposing of and Expression element terminal for described front and back class carrier is or/and replacing, these changes can produce numerous class carrier segments, be applied to the biological linear carrier structures such as multiple yeast, and be not limited to recombinant expressed step, after Replacement is become the yeast two-hybrid carrier element, but fast high-flux carries out related experiment, and is very convenient.

Find after deliberation, do not participate in expecting the rear end of the front end of front class carrier segments of ligation and rear class carrier segments most economical effectively should be flat terminal, participating in the rear end of front class carrier segments of expection ligation and the front end of rear class carrier segments is 5 ' cohesive end.The palindrome symmetric sequences of cohesive end can cause terminal certainly connection, produce false positive and reduce the fragment service efficiency, so palindrome symmetric sequences does not appear in two cohesive ends of the present invention's design.In addition, goal gene fragment end can prepare by the mode that increases the primer jointing and degrade with the T4DNA ligase enzyme easily, need to adopt restriction enzyme to prepare the goal gene sticky end unlike the conventional expression vector of majority, can connect preparation linearized vector fragment from different goal gene thereby make with a pair of class carrier segments.The present invention prepares similar linearized vector fragment by the ligation of efficiently and accurately, avoided obtaining by loaded down with trivial details cyclic plasmid Vector construction consuming time the process of linearized vector fragment, the simultaneously generation of goal gene end is not subjected to the restriction of its sequence can greatly simplify the operation, reduce cost and shorten experimental period, has good application prospect in yeast expression system.

Description of drawings

Fig. 1: linearizing expression vector establishment method and technology route schematic diagram of the present invention

Fig. 2: the recombination and expression techniques route map of finishing formula yeast GS115 and carrier pPIC9K expressing green fluorescent protein GFP

Fig. 3: the recombinant expressed Technology Roadmap of finishing formula yeast GS115 and class vector expression green fluorescent protein GFP

Fig. 4: class carrier segments schematic diagram of the present invention

Fig. 5: ligation liquid agarose gel electrophoresis result

Fig. 6: thalline PCR proof diagram

Fig. 7: fluorescent microscope detects the GFP expression

Embodiment

Term used in the present invention is general molecular biology and Biochemical Nomenclature.

The present invention specifically sets forth this working of an invention as an example of the bacterial strain GS115 that finishes formula yeast (Pichia pastoris) and homemade class carrier segments expressing green fluorescent protein GFP example.Should understand example is not for restriction protection scope of the present invention.

Embodiment 1

Class carrier segments before and after the preparation

For class carrier segments before and after the convenient preparation, first it is implemented in plasmid vector in the embodiment of the invention, cut and the step such as recovery can obtain front and back class carrier segments for subsequent use by purification plasmid, enzyme.

The sequence SEQ ID NO:1 that will contain front class carrier segments is structured in the plasmid pUC18, method is as follows: 1) with primer (5 ' ATGCGGATCCTACGTAAACATCCAAAGACGAAAGG 3 ' (SEQ ID NO:3), 5 ' ATGCCTGCAGGTAGACTCGATCCTTCGAATAATTAG 3 ' (SEQ ID NO:4)) sequence of the approximately 7bp-944bp of amplification plasmid pPIC9K, glue reclaims amplified production and uses restriction enzyme BamH I and Pst I double digestion, and enzyme is cut product glue and reclaimed for subsequent use; 2) plasmid pUC18 is used restriction enzyme BamH I and Pst I double digestion and glue reclaim for subsequent use; 3) enzyme of preparation in above-mentioned two steps is cut carrier and be connected with fragment, and will connect product conversion bacillus coli DH 5 alpha, obtain plasmid pUC18-seq1 by screening, contain sequence SEQ ID NO:1 through nucleotide sequencing plasmid pUC18-seq1.Plasmid pUC18-seq1 is cut with restriction enzyme SnaB I and Acc I enzyme and glue reclaims approximately that the 0.95kb fragment namely is front class carrier segments, the fragment that namely is equivalent to sequence and is SEQ ID NO:1 is cut through restriction enzyme SnaB I and Acc I enzyme and is produced two ends, and end sequence is:

The sequence SEQ ID NO:2 that will contain rear class carrier segments is structured in the plasmid pPIC9K, the approximately 1234bp-6879bp of plasmid pPIC9K is required sequence, after its two ends add restriction enzyme Cpo I and SnaB I site, it namely is sequence shown in the sequence SEQ ID NO:2, the method of transforming plasmid pPIC9K is as follows: 1) with primer (5 ' GTACGGATCCGGATCCAAACGATGAGATT 3 ' (SEQ ID NO:5), 5 ' GTACGCGGCCGCCGGTCCGCCTAGGGAATTCTACGTAAGC 3 ' (SEQ ID NO:6)) sequence of the approximately 938bp-1233bp of amplification plasmid pPIC9K, glue reclaims amplified production and uses restriction enzyme BamH I and Not I double digestion, and enzyme is cut product glue and reclaimed for subsequent use; 2) plasmid pPIC9K is used restriction enzyme BamH I and Not I double digestion and glue reclaim for subsequent use; 3) enzyme of preparation in above-mentioned two steps is cut carrier and be connected with fragment, and will connect product conversion bacillus coli DH 5 alpha, obtain plasmid pPIC9K-seq2-1 by screening, this is for adding Cpo I site process; 4) with primer (5 ' ATGCAGATCTTACGTACTGCCTCGCGCGTTTCGGTGATGAC 3 ' (SEQ ID NO:7), 5 ' AGTCAGATCTCGAATAATAACTGTTATTTTTCAG 3 ' (SEQ ID NO:8)) sequence of the approximately 6880bp-9276bp of amplification plasmid pPIC9K, glue reclaims amplified production and cuts with restriction enzyme Bgl II enzyme, and enzyme is cut product glue and reclaimed for subsequent use; 2) cutting also with Bgl II enzyme plasmid pPIC9K-seq2-1, glue reclaims for subsequent use; 3) enzyme of preparation in above-mentioned two steps being cut carrier is connected with fragment, and will connect product conversion bacillus coli DH 5 alpha, obtain plasmid pPIC9K-seq2 by screening, this contains sequence SEQ ID NO:2 for adding SnaB I site process through nucleotide sequencing plasmid pPIC9K-seq2.Plasmid pPIC9K-seq2 is cut with restriction enzyme SnaB I and Cpo I enzyme and glue reclaims approximately that the 5.65kb fragment namely is rear class carrier segments, the fragment that namely is equivalent to sequence and is SEQ ID NO:2 is cut through restriction enzyme SnaB I and Cpo I enzyme and is produced two ends, and end sequence is:

The object of condition of above-mentioned pcr amplification is: 10 * Pyrobest DNA Polymorase Buffer, 5 μ L; DNTP (10mM), 4 μ L; Primer (20 μ M), each 1 μ L; Plasmid template, 1ng; Pyrobest DNA Polymerase (TaKaRaCode DR005A), 0.5-1U; Mend distilled water to cumulative volume 50 μ L.The PCR cycling condition is: 94 ℃ of 5min; 94 ℃ of 1min, 50-55 ℃ of 1min, 72 ℃ of 1.5-3min, 30 circulations; 72 ℃ of 10min.Described plasmid extraction requires according to test kit (QIAGENPlasmid Mini Kit Cat.No.12123) specification sheets and replaces TE damping fluid dissolving plasmid with sterile distilled water.It is that Acc I (TaKaRa Code D1001A), SnaB I (TaKaRaCode D1179A), Cpo I (TaKaRa Code D1035A), BamH I (TaKaRa Code D1010A), Pst I (TaKaRaCode D1073A), Not I (TaKaRa Code D1166A) and Bgl II (TaKaRa Code D1021A) etc. all use to specifications that the enzyme of described plasmid and carrier is cut used restriction enzyme.It is for subsequent use after glue reclaims test kit (QIAGEN MinElute Gel Extraction Kit Cat.No.28604) recovery that PCR product and enzyme are cut product, and operation is undertaken by the test kit specification sheets.Described ligation and embodiment 3.Described connection product transforms, clone's screens and microbial culture etc. is basic molecular biology operation, and used plasmid construction, the bacterial strain that copies and preserve are bacillus coli DH 5 alpha.The plasmid of class carrier segments is correct through the order-checking contained SEQ ID NO:1 of proof and SEQID NO:2 sequence before and after containing.

SEQ?ID?NO：1

TACGTAAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCCACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGCCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAGGATCGAGTCTAC

SEQ?ID?NO：2

CGGACCGGCGGCCGCGAATTAATTCGCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTTATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCTATCGAATCTAAATGTAAGTTAAAATCTCTAAATAATTAAATAAGTCCCAGTTTCTCCATACGAACCTTAACAGCATTGCGGTGAGCATCTAGACCTTCAACAGCAGCCAGATCCATCACTGCTTGGCCAATATGTTTCAGTCCCTCAGGAGTTACGTCTTGTGAAGTGATGAACTTCTGGAAGGTTGCAGTGTTAACTCCGCTGTATTGACGGGCATATCCGTACGTTGGCAAAGTGTGGTTGGTACCGGAGGAGTAATCTCCACAACTCTCTGGAGAGTAGGCACCAACAAACACAGATCCAGCGTGTTGTACTTGATCAACATAAGAAGAAGCATTCTCGATTTGCAGGATCAAGTGTTCAGGAGCGTACTGATTGGACATTTCCAAAGCCTGCTCGTAGGTTGCAACCGATAGGGTTGTAGAGTGTGCAATACACTTGCGTACAATTTCAACCCTTGGCAACTGCACAGCTTGGTTGTGAACAGCATCTTCAATTCTGGCAAGCTCCTTGTCTGTCATATCGACAGCCAACAGAATCACCTGGGAATCAATACCATGTTCAGCTTGAGACAGAAGGTCTGAGGCAACGAAATCTGGATCAGCGTATTTATCAGCAATAACTAGAACTTCAGAAGGCCCAGCAGGCATGTCAATACTACACAGGGCTGATGTGTCATTTTGAACCATCATCTTGGCAGCAGTAACGAACTGGTTTCCTGGACCAAATATTTTGTCACACTTAGGAACAGTTTCTGTTCCGTAAGCCATAGCAGCTACTGCCTGGGCGCCTCCTGCTAGCACGATACACTTAGCACCAACCTTGTGGGCAACGTAGATGACTTCTGGGGTAAGGGTACCATCCTTCTTAGGTGGAGATGCAAAAACAATTTCTTTGCAACCAGCAACTTTGGCAGGAACACCCAGCATCAGGGAAGTGGAAGGCAGAATTGCGGTTCCACCAGGAATATAGAGGCCAACTTTCTCAATAGGTCTTGCAAAACGAGAGCAGACTACACCAGGGCAAGTCTCAACTTGCAACGTCTCCGTTAGTTGAGCTTCATGGAATTTCCTGACGTTATCTATAGAGAGATCAATGGCTCTCTTAACGTTATCTGGCAATTGCATAAGTTCCTCTGGGAAAGGAGCTTCTAACACAGGTGTCTTCAAAGCGACTCCATCAAACTTGGCAGTTAGTTCTAAAAGGGCTTTGTCACCATTTTGACGAACATTGTCGACAATTGGTTTGACTAATTCCATAATCTGTTCCGTTTTCTGGATAGGACGACGAAGGGCATCTTCAATTTCTTGTGAGGAGGCCTTAGAAACGTCAATTTTGCACAATTCAATACGACCTTCAGAAGGGACTTCTTTAGGTTTGGATTCTTCTTTAGGTTGTTCCTTGGTGTATCCTGGCTTGGCATCTCCTTTCCTTCTAGTGACCTTTAGGGACTTCATATCCAGGTTTCTCTCCACCTCGTCCAACGTCACACCGTACTTGGCACATCTAACTAATGCAAAATAAAATAAGTCAGCACATTCCCAGGCTATATCTTCCTTGGATTTAGCTTCTGCAAGTTCATCAGCTTCCTCCCTAATTTTAGCGTTCAACAAAACTTCGTCGTCAAATAACCGTTTGGTATAAGAACCTTCTGGAGCATTGCTCTTACGATCCCACAAGGTGGCTTCCATGGCTCTAAGACCCTTTGATTGGCCAAAACAGGAAGTGCGTTCCAAGTGACAGAAACCAACACCTGTTTGTTCAACCACAAATTTCAAGCAGTCTCCATCACAATCCAATTCGATACCCAGCAACTTTTGAGTTGCTCCAGATGTAGCACCTTTATACCACAAACCGTGACGACGAGATTGGTAGACTCCAGTTTGTGTCCTTATAGCCTCCGGAATAGACTTTTTGGACGAGTACACCAGGCCCAACGAGTAATTAGAAGAGTCAGCCACCAAAGTAGTGAATAGACCATCGGGGCGGTCAGTAGTCAAAGACGCCAACAAAATTTCACTGACAGGGAACTTTTTGACATCTTCAGAAAGTTCGTATTCAGTAGTCAATTGCCGAGCATCAATAATGGGGATTATACCAGAAGCAACAGTGGAAGTCACATCTACCAACTTTGCGGTCTCAGAAAAAGCATAAACAGTTCTACTACCGCCATTAGTGAAACTTTTCAAATCGCCCAGTGGAGAAGAAAAAGGCACAGCGATACTAGCATTAGCGGGCAAGGATGCAACTTTATCAACCAGGGTCCTATAGATAACCCTAGCGCCTGGGATCATCCTTTGGACAACTCTTTCTGCCAAATCTAGGTCCAAAATCACTTCATTGATACCATTATTGTACAACTTGAGCAAGTTGTCGATCAGCTCCTCAAATTGGTCCTCTGTAACGGATGACTCAACTTGCACATTAACTTGAAGCTCAGTCGATTGAGTGAACTTGATCAGGTTGTGCAGCTGGTCAGCAGCATAGGGAAACACGGCTTTTCCTACCAAACTCAAGGAATTATCAAACTCTGCAACACTTGCGTATGCAGGTAGCAAGGGAAATGTCATACTTGAAGTCGGACAGTGAGTGTAGTCTTGAGAAATTCTGAAGCCGTATTTTTATTATCAGTGAGTCAGTCATCAGGAGATCCTCTACGCCGGACGCATCGTGGCCGACCTGCAGGGGGGGGGGGGGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGAGGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTTTCCCCCCCCCCCCTGCAGGTCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGAGTATCTATGATTGGAAGTATGGGAATGGTGATACCCGCATTCTTCAGTGTCTTGAGGTCTCCTATCAGATTATGCCCAACTAAAGCAACCGGAGGAGGAGATTTCATGGTAAATTTCTCTGACTTTTGGTCATCAGTAGACTCGAACTGTGAGACTATCTCGGTTATGACAGCAGAAATGTCCTTCTTGGAGACAGTAAATGAAGTCCCACCAATAAAGAAATCCTTGTTATCAGGAACAAACTTCTTGTTTCGAACTTTTTCGGTGCCTTGAACTATAAAATGTAGAGTGGATATGTCGGGTAGGAATGGAGCGGGCAAATGCTTACCTTCTGGACCTTCAAGAGGTATGTAGGGTTTGTAGATACTGATGCCAACTTCAGTGACAACGTTGCTATTTCGTTCAAACCATTCCGAATCCAGAGAAATCAAAGTTGTTTGTCTACTATTGATCCAAGCCAGTGCGGTCTTGAAACTGACAATAGTGTGCTCGTGTTTTGAGGTCATCTTTGTATGAATAAATCTAGTCTTTGATCTAAATAATCTTGACGAGCCAAGGCGATAAATACCCAAATCTAAAACTCTTTTAAAACGTTAAAAGGACAAGTATGTCTGCCTGTATTAAACCCCAAATCAGCTCGTAGTCTGATCCTCATCAACTTGAGGGGCACTATCTTGTTTTAGAGAAATTTGCGGAGATGCGATATCGAGAAAAAGGTACGCTGATTTTAAACGTGAAATTTATCTCAAGATCTTACGTA

Embodiment 2

Preparation goal gene fragment

Design two primers and be used for amplification green fluorescent protein GFP gene, 5 ' end at upstream primer adds base CTA (attention: because first amino acid is the ATG coding, for guaranteeing that reading frame is correct, first base of GFP gene A is replaced by the A in the CTA base), 5 ' end of downstream primer adds bases G TCA and terminator codon, and the sequence of primer is as follows:

Upstream primer 5 ' CTATGGTGAGCAAGG 3 ' (SEQ ID NO:9)

Downstream primer 5 ' GTCATTATACTTGTACAGC 3 ' (SEQ ID NO:10)

The object of condition of pcr amplification is: 10 * Pyrobest DNA Polymorase Buffer, 5 μ L; DNTP (10mM), 4 μ L; Upstream primer (20 μ M), 1 μ L; Downstream primer (20 μ M), 1 μ L; The plasmid pEGFP-C1 (GenBank Accession #:U55763) that contains the GFP gene, 1ng; Pyrobest DNA Polymerase (TaKaRa Code DR005A), 0.5-1U; Mend distilled water to cumulative volume 50 μ L.The PCR cycling condition is: 94 ℃ of 5min; 94 ℃ of 1min, 55 ℃ of 1min, 72 ℃ of 1.5min, 30 circulations; 72 ℃ of 10min.Product is for subsequent use after PCR product purification test kit (QIAGEN MinElute PCRPurification Kit Cat.No.28004) purifying is measured concentration by agarose gel electrophoresis, and purification process is undertaken by the test kit specification sheets.

The PCR product that purifying obtains is processed with T4 DNA Polymerase (TaKaRa Code D2040), and reaction system is: 10 * T4 DNA Polymorase Buffer, 5 μ L; DTTP (2.5mM), 4 μ L; Pcr amplification GFP product, 10nmol; T4 DNA Polymerase, 4U; Mend distilled water to cumulative volume 50 μ L, 37 ℃ of reaction 0.5h.The vortex termination reaction, for subsequent use.

Above-mentioned prepared goal gene fragment is about 0.73kb, and end sequence is respectively at above-mentioned class carrier segments end sequence coupling, and its end sequence is:

Embodiment 3

Be connected the intestinal bacteria ligase enzyme to connect (E.coli DNA Ligase, TaKaRa Code D2160A) with the goal gene fragment class carrier segments of above-mentioned preparation, reaction system is: class carrier segments, each 10pmol; The goal gene fragment, 10pmol; 10 * E.coli DNA Ligase Buffer, 10 μ L; 10 * BSA (0.05%) 10 μ L; E.coli DNA Ligase, 3U; Mend distilled water to cumulative volume 100 μ L, 16 ℃ of reaction 3h, (result such as Fig. 5: swimming lane 3 is as connecting the 3h detected result take the monitoring of 0.8-1% agarose gel electrophoresis in reaction, swimming lane 2 is not for adding the control group of ligase enzyme), and the dna fragmentation of glue recovery 7.3kb is for subsequent use, and this fragment is the linearization plasmid carrier segments of " class carrier behind front class carrier-GFP-".Can find out very efficiently and accurately of joint efficiency from electrophoresis result, substantially see the band of few incorrect link, the 5.65kb fragment is found to have to be higher than 80% fragment generation ligation by densitometric scan.If any not junction fragment existence, obviously reclaim junction fragment and be better than directly transforming the connection product for transforming.

Embodiment 4

Transform host living beings and screening positive clone

The above-mentioned linearized vector fragment that builds is transformed complete formula yeast (Pichia pastoris) bacterial strain GS115, operate the method that transforms according to shocking by electricity in the complete formula yeast expression handbook of Invitrogen company fully and in solid MD flat board, screen acquisition positive colony.Confirm that by bacterium colony thalline PCR two bacterium colonies contain the GFP gene, the thalline PCR method is consistent with PCR method in above-described embodiment 2, only template is changed into the yeast thalline and replace the Pyrobest archaeal dna polymerase with Taq archaeal dna polymerase (TaKaRa Code DR001A), the results are shown in Figure 6.

Picking thalline PCR checking contains the positive colony of GFP gene, complete formula yeast expression handbook according to Invitrogen company is induced the GFP protein expression, and with inverted fluorescence microscope Axiovert 200 observation GFP protein expression situations, see Fig. 7, Fig. 7 A is for inducing rear white light passage observations, and thalline is high-visible, and Fig. 7 B is for inducing rear bacterium colony GFP passage observations, background is black, thalline clear-cut visible (bacterium colony that does not turn the GFP gene is invisible at this passage).

Claims

1. a linearizing expression vector establishment method comprises the following steps:

A) the redundant base number of single 5 ' redundant sticky end is 1-10;

An end of described front class carrier segments is 5 ' redundant sticky end, and with described goal gene fragment in, 5 ' the redundant sticky end that coding strand 5 ' end is corresponding is complementary mutually, another end is flush end or through the end of dephosphorylation enzyme processing;

An end of described rear class carrier segments is 5 ' redundant sticky end, and with described goal gene fragment in, 5 ' the redundant sticky end that coding strand 3 ' end is corresponding is complementary mutually, another end is flush end or through the end of dephosphorylation enzyme processing;

3) with step 2) the front class carrier segments that makes up, rear class carrier segments and goal gene fragment adopt ligase enzyme to connect to obtain successively continuous linear dsdna expression vector of front class carrier segments, goal gene fragment and rear class carrier segments.

2. linearizing expression vector establishment method as claimed in claim 1 is characterized in that described step 1) in, 5 ' redundant sticky end of described goal gene fragment also satisfies in the following requirement at least one:

C) only have at the most a 5 ' redundant sticky end to contain palindrome symmetric sequences in two 5 ' redundant sticky ends;

D) matching rate of base is low between two 5 ' redundant sticky ends.

3. linearizing expression vector establishment method as claimed in claim 2 is characterized in that the described c of requirement) be: two 5 ' redundant sticky ends all do not have palindrome symmetric sequences; The described d of requirement) be specially: the base number of maximum continuous pairings is not more than half of redundant base number of any 5 ' redundant sticky end between two 5 ' redundant sticky ends, and when the continuous pairing at a plurality of intervals occurring, the total number of the base of coupling is less than the total number of unmatched base.

4. linearizing expression vector establishment method as claimed in claim 1 is characterized in that, requires a) to be: the redundant base number of single 5 ' redundant sticky end is 2-4;

5. linearizing expression vector establishment method as claimed in claim 1 is characterized in that described step 3) in, ligase enzyme is selected from T4 dna ligase or intestinal bacteria ligase enzyme.

6. linearizing expression vector establishment method as claimed in claim 1 is characterized in that step 2) in, the structure of goal gene fragment comprises the following steps:

7. linearizing expression vector establishment method as claimed in claim 6, it is characterized in that, among the described step B, the method of utilizing the T4DNA polysaccharase to produce 5 ' redundant sticky end is: with the pcr amplification product of the goal gene of purifying in the reaction system that has the base substrate to exist, process with the T4 archaeal dna polymerase, the final goal gene fragment that obtains with 5 ' redundant sticky end, described base substrate is selected from dATP, dCTP, dGTP and dTTP, and must contain the corresponding base substrate of first base of two single stranded DNAs, the 3 ' end that remains to be made up the goal gene fragment, and must not contain the corresponding base substrate of complementary base of arbitrary redundant base in the goal gene fragment that remains to be made up.

8. linearizing expression vector establishment method as claimed in claim 1, it is characterized in that, step 2) in, the preparation method of described front class carrier segments and rear class carrier segments is: 4 ends in the class carrier segments that designs add the polynucleotide joint, after the class carrier segments of preparation with the polynucleotide joint, be cloned in it in cyclic plasmid carrier or transform more existing plasmid vectors, then described plasmid vector is copied in intestinal bacteria, extract plasmid, process the polynucleotide joint by toolenzyme and obtain to meet step 1) end of described requirement.

9. linearizing expression vector establishment method as claimed in claim 8 is characterized in that, describedly processes the polynucleotide joint with toolenzyme and obtains to meet step 1) end of described requirement, select one of following methods:

Method one: utilize the polynucleotide joint of digestion with restriction enzyme class carrier segments end, directly obtain end and just meet step 1) front class carrier segments and the rear class carrier segments of tip designs requirement;

Method two: utilize first the polynucleotide joint of digestion with restriction enzyme class carrier segments end, the end that produces with nuclease, archaeal dna polymerase treatment limits restriction endonuclease again meets step 1 with generation) cohesive end that requires of tip designs.

10. linearizing expression vector establishment method as claimed in claim 1, it is characterized in that, in the linear dsdna expression vector that described front class carrier segments, goal gene fragment and rear class carrier segments link to each other successively, contain homologous recombination sequence, screening-gene, promotor and terminator.

11. linearizing expression vector establishment method as claimed in claim 10, it is characterized in that, also contain enhanser, signal peptide in the linear dsdna expression vector that described front class carrier segments, goal gene fragment and rear class carrier segments link to each other successively and the albumen that merges with the goal gene product at least a.

12. a class carrier segments that is used for making up the linearizing expression vector comprises front class carrier segments and rear class carrier segments, the rear end of described front class carrier-pellet degree is 5 ' redundant sticky end, and front end is flush end; The front end of rear class carrier segments is 5 ' redundant sticky end, and the rear end is flush end; 5 ' redundant sticky end of described front class carrier-pellet degree and rear class carrier segments satisfies following requirement simultaneously:

13. be used for making up as claimed in claim 12 the class carrier segments of linearizing expression vector, it is characterized in that, described front class carrier segments and rear class carrier segments contain homologous recombination sequence, screening-gene, promotor and terminator.

14. be used for making up as claimed in claim 12 the class carrier segments of linearizing expression vector, it is characterized in that, the redundant base sequence of rear end 5 ' the redundant sticky end of described front class carrier segments is 3 '-GA 5 ', another end is flush end; The redundant base sequence of front end 5 ' the redundant sticky end of rear class carrier segments is 5 ' GAC-3 ', and another end is flush end.

15. be used for making up as claimed in claim 14 the class carrier segments of linearizing expression vector, it is characterized in that, described front class carrier segments is included in the fragment that sequence is SEQ ID NO:1, two ends are cut through SnaB I and Acc I enzyme and are namely produced described end, described rear class carrier segments is included in the fragment that sequence is SEQ ID NO:2, and two ends are cut through SnaB I and Cpo I enzyme and namely produced described end.

16. the using method such as class carrier segments as described in claim 12 or 13 comprises the following steps:

1) structure of goal gene fragment:

2) the goal gene fragment is connected with described class carrier segments.

17. using method as claimed in claim 16, it is characterized in that, step 1) in the described PCR primer with the polynucleotide joint, the upstream primer of goal gene is with 5 ' CTA-3 ' joint, the downstream primer of goal gene is with 3 '-ACTG5 ' joint, adopt the amplified production behind the described PCR primer amplification, in the presence of base substrate dTTP, after processing, produce 5 ' redundant sticky end through the T4 archaeal dna polymerase; Step 2) described class carrier segments is the described class carrier segments of claims 14 or 15.