CN102911886A - Method for preparing anti-tumor medicine composition through pichia pastoris gene-regulation direct-fermentation - Google Patents

Abstract

The invention relates to a novel method for preparing an anti-tumor medicine composition through pichia pastoris gene-regulation direct-fermentation. The method comprises the steps that: recombinant plasmid pGAPZalphaA-tnf [capable of constitutively expressing tumor necrosis factor (TNF-alpha)] and pPICZalphaA-ph20 [capable of inducibly expressing recombinant human hyaluronidase (HAase)] are respectively used for converting yeast cells, such that genetic engineering bacteria TNF-PH20 is obtained. During a later-stage fermentation process, through different gene regulation and induction methods, the yeast engineering bacteria TNF-PH20 is used for producing a target product which is a medicine composition of TNF-alpha and HAase. TNF-alpha is a commonly used anti-tumor medicine. When HAase and TNF-alpha are used in combination, TNF-alpha can reach a target site faster, and effects can be performed. Also, medicine TNF-alpha absorption is accelerated, such that medicine efficacy is improved. With the method, coupling of a content ratio of TNF-alpha and HAase of the anti-tumor composition and a gene regulation method is realized, and anti-tumor compositions with different content ratios can be prepared according to requirements.

Description

Utilize the direct fermentation of pichia spp gene regulating to prepare a kind of method of antitumour drug complex

Technical field

The present invention relates to genetically engineered and biological fermentation field, specifically is to utilize the direct fermentation of recombinant yeast pichia pastoris gene regulating to prepare a kind of method of antitumour drug complex.

Background technology

Tumour necrosis factor (tumor necrosis factor, TNF-α) is a kind of monokine, is mainly produced by monocyte and scavenger cell.TNF-α diverse in function, major function for kill and wound, inhibition tumor cell.TNF-α in vivo, externally all can kill some tumour cell or inhibition tumor cell propagation.Therefore adopted in recent years the tumor disease clinical effectiveness such as TNF-α treatment melanoma remarkable.

Unidasa (hyaluronidase, HAase) be the enzyme that a class extensively exists in animal tissues and microorganism, can and be hydrolyzed into HA or the oligosaccharides of low relative molecular mass with hyaluronic acid (hyaluronic acid, HA) depolymerization, weaken glutinousness and the lubrication of HA.HAase is as a kind of medicinal compound, and its function is: HA is the main component of matrix between the human inner cell, and macromolecular HA moves the arrival target site to medicine the inhibition inhibition; HA in the HAase degradable body disintegrates the HA network and reduces its glutinousness, is beneficial to medicine and arrives target site and play a role.

TNF-α and HAase are used as a kind of antitumour drug complex, major advantage is: when HAase and TNF-α share the treatment disease, can make antitumor drug TNF-α accelerate to arrive target site and play a role, and accelerate TNF-α absorption, improve curative effect of medication.

Summary of the invention

The present invention directly utilizes Pichia anomala expression TNF-α and HAase, and during the fermentation by the controlled fermentation condition, obtains the antitumour drug complex of different content proportioning.The method has realized containing TNF-α and the antitumour drug complex of HAase and the coupling of gene regulating mode of different content proportioning, can prepare as required the antitumour drug complex of different content proportioning, method safety, easy, effective.

The objective of the invention is to obtain a kind of novel method that directly generates the antitumour drug complex of different content proportioning by gene regulating.

The invention provides a kind of recombinant yeast pichia pastoris genetic engineering bacterium TNF-PH20, building process is: the recombinant plasmid pGAPZ α A-tnf with the constitutive expression tumour necrosis factor transforms pichia spp first, obtains recombination microzyme TNF; The induction type recombinant plasmid pPICZ alpha A-ph20 that will express again the recombinant human Unidasa transforms recombination microzyme TNF, obtains aimed strain TNF-PH20.

The invention provides a kind ofly in fermentor tank, yeast gene engineering bacteria TNF-PH20 adds TNF-α and the antitumour drug complex of HAase different content proportioning in next life time by the miscarriage of regulating glycerine and methyl alcohol.

The fermentation manufacturing technique of the antitumour drug complex of pichia yeast genetic engineering bacteria TNF-PH20 provided by the invention and different content proportioning has solved the problems such as the unsatisfactory curative effect, the curative ratio that exist in the present antitumor drug are low.

Description of drawings

Fig. 1: tumour necrosis factor Yeast expression carrier pGAPZ α A-tnf building process figure.

Fig. 2: recombinant human Unidasa Yeast expression carrier pPICZ α A-ph20 building process figure.

Fig. 3: the SDS-PAGE analysis chart of the TNF-α sample of process separation and purification.M:Page ruler; 1: the TNF-α sample behind the purifying

Fig. 4: the SDS-PAGE analysis chart of the HAase sample of process separation and purification.M:Pageruler; 1-3: the HAase sample behind the purifying

Embodiment

Embodiment 1: the structure of recombinant plasmid pGAPZ α A-tnf and pPICZ α A-ph20 and pichia spp transform the structure of a recombinant plasmid pGAPZ α A-tnf

1 full gene synthesizes tumour necrosis factor gene tnf, and tnf has the base sequence (seeing Table 2) in the tumour necrosis factor base sequence table, and it is carried out the PCR clonal expansion, and the PCR primer sequence is as follows:

Forward: 5 '-CCGCTCGAGGCTTCAAAGGAGGTTCCAA-3 '

Oppositely: 5 '-CATTTCTAGAAATTAACTGGCGGATTACCGGCA-3 '

The PCR reaction conditions:

94 ℃ of denaturation 5min; 94 ℃ of sex change 1min, 53 ℃ of annealing 1min, 72 ℃ are extended 1.5min, 30 circulations; 72 ℃ are extended 10min, 4 ℃ of insulations.

The structure of 2 recombinant plasmids

Agarose electrophoresis by 0.7% detects, and reclaims size and is about the PCR product of 0.8kb for clonal expression.Connect construction recombination plasmid pGAPZ α A-tnf after this PCR recovery product and pGAPZ α A carrier are cut by restriction enzyme Xho I, Xba I enzyme, and transform intestinal bacteria TOP10 competent cell.

The structure of two recombinant plasmid pPICZ alpha A-ph20

1 ph20 gene order is optimized

According to pichia spp codon preference optimization design ph20 gene order: on people's Unidasa gene (gene ID6677) basis, signal peptide and Sac I restriction enzyme site have been deleted, again according to the pichia spp codon usage proline(Pro) of will encoding, aspartic acid, L-Ala, amino acid whose most of codons such as Serine replace to CCA, GAA, GCA, UCA; Revised altogether 18 bases and obtained aim sequence ph20, the ph20 gene order after the optimization has the base sequence (seeing Table 3) in the restructuring Unidasa base sequence table.

2 full genes synthesize the recombinant human Unidasa gene ph20 that had optimized, and it is carried out the PCR clonal expansion; The PCR primer sequence is as follows:

Forward: 5 '-GTATCTCTCGAGAAAAGATTGAACTTCAGAGCA-3 '

Oppositely: 5 '-CAAATCTAGAGGACCTGATCAGTGAAAACAATTC-3 '

The PCR reaction conditions:

94 ℃ of denaturation 5min; 94 ℃ of sex change 1min, 55 ℃ of annealing 1min, 72 ℃ are extended 2.5min, 30 circulations; 72 ℃ are extended 10min, 4 ℃ of insulations.

The structure of 3 recombinant plasmids

Agarose electrophoresis by 0.7% detects, and reclaims size and is about the PCR product of 1.4kb for clonal expression.Connect construction recombination plasmid pPICZ α A-ph20 after this PCR recovery product and pPICZ α A carrier are cut by restriction enzyme Xho I, Xba I enzyme, and transform intestinal bacteria TOP10 competent cell.

Three pichia spp transform

At first linearizing recombinant plasmid pGAPZ α A-tnf is changed in the yeast, obtain recombination yeast TNF, change linearizing recombinant plasmid pPICZ alpha A-ph20 over to recombination yeast TNF again, namely obtain purpose recombination yeast TNF-PH20.Concrete yeast conversion step is as follows:

(1) picking yeast list bacterium colony is seeded in the 50mL triangular flask that contains 5mL YPD substratum 30 ℃ of overnight incubation;

(2) culture of getting 0.2mL is seeded in the 2L triangle shaking flask that contains the 500mL fresh culture, and overnight growth is to OD ₆₀₀Reach 1.3～1.5;

(3) at 4 ℃, the centrifugal 5min collecting cell of 1500g is with the aqua sterilisa suspension cell of 500mL precooling; Similarity condition is centrifugal, with the aqua sterilisa suspension cell of 250mL precooling;

(4) centrifugal by step 3, with the 1mol/L sorbyl alcohol suspension cell of 20mL precooling; As above centrifugal, with the 1mol/L sorbyl alcohol suspension cell of 1mL precooling; 80 μ L packing;

(5) the linearizing DNA with 5～20 μ g is dissolved in 5～10 μ L TE solution, and with the yeast competent cell mixing of 80 μ L, the electricity that goes to the precooling of 0.2cm ice transforms in the cup;

(6) place 5min on ice, the yeast parameter of recommending according to institute's using appts shocks by electricity; Add immediately the 1mol/L sorbyl alcohol of 1mL precooling to cup, content is gone in the sterilization centrifuge tube;

(7) the thalline suspension is coated contained on an amount of antibiotic YPDS flat board per 600 μ L spread plates; Flat board is placed 30 ℃ of cultivations, until single bacterium colony occurs.

Embodiment 2: the method for the antitumour drug complex of Yeast engineering bacteria TNF-PH20 fermentative production different content proportioning

In 1 liter of fermentor tank, but the antitumour drug complex of Yeast engineering bacteria TNF-PH20 direct production different content proportioning.Under 30 ℃ of conditions, utilize the YPD substratum with recombination microzyme TNF-PH20 activation culture 18～24 hours; Yeast after ratio in 0.5%～2% will activate is transferred in the YPD seed culture medium, and upper tank fermentation process is as follows:

(1) the yeast culture stage: leavening temperature is set as 28～30 ℃, utilize 28% ammoniacal liquor that the pH value of fermention medium is transferred to 5.0～6.0, then by 5%～10% inoculum size seed culture medium is inoculated that (prescription is: 85% phosphoric acid 26.7mL/L in the tank substratum on the Basal Salts, calcium sulfate 0.93g/L, vitriolate of tartar 18.2g/L, sal epsom 14.9g/L, potassium hydroxide 4.13g/L, glycerine 40g/L), (prescription is: copper sulfate 6g/L, sodium iodide 0.08g/L to add simultaneously 4.37mL PTM1 salts solution, sal epsom 3.0g/L, Sodium orthomolybdate 0.2g/L, boric acid 0.02g/L, cobalt chloride 0.5g/L, zinc chloride 20.0g/L, ferrous sulfate 20.0g/L, vitamin H 0.2g/L, sulfuric acid 5mL/L).Aeration-agitation 18～24 hours;

(2) the glycerine feed supplement stage (tumour necrosis factor constitutive expression stage): stream adds 30%～50% glycerine, and the stream dosage is 10～20mL/hr/L, cultivates about 24～48 hours, and dissolved oxygen amount is greater than 20% in the whole process.This process is to be that the thalline weight in wet base rolls up the stage in the yeast growth stage, also is the tumour necrosis factor constitutive expression stage, and TNF-α is by Rapid Accumulation in this process;

(3) the methanol induction stage (recombinant human Unidasa inducible expression stage): the stream glycerol adding stops stream to the certain hour and adds, replacing methyl alcohol is carbon source, flow acceleration is 4～8mL/hr/L, continues to cultivate 24～48 hours, and dissolved oxygen amount is greater than 20% in the whole process.This process flow adds methyl alcohol can induce the effect of AOX1 promotor and begin to express the recombinant human Unidasa, can add by the stream of regulating and control respectively glycerine and methyl alcohol the antitumour drug complex that the time obtains TNF-α and HAase different content proportioning in this process.

(4) fermented liquid that obtains is centrifugal, get supernatant, select the ultra-filtration membrane of different size to carry out ultrafiltration, the TNF-α and the molecular weight that obtain respectively molecular weight and be 32kDa are the HAase of 55kDa.Carry out at last gel chromatography, purity 90%.Pass through glycerine and the control of methanol feeding time and later stage purifying during the fermentation, the content proportioning of the antitumour drug complex that finally obtains sees Table 1.

The content proportioning of table 1 antitumour drug complex

Table 2 tumour necrosis factor base sequence

ATGGAGGGGTATGCGATGACACCTGAAGACATGGAGAGGGGCCCTGTGTACAACACA

ACGGTGACAGCTGTCGCTGAGGGAAAGGCCTCCAGAGGTTGGCTATGGAGGCTGTGTG

GGGTCCTCTTAATAGCAGGTCTATGTGCGGCAGCAGCCCTACTCTTTGCATGGTGTCAG

CATGGAAGACCGTCAACGATGCAGGATGAAATTGAGCCTCAACTGGAGATACTCATTG

GTGCAAAAGATACCCACCATACATTGAAGCAGATTGCCGGCAATGCAAAAGCAGCCAT

CCATTTAGAGGGTGAATACAATCCTAATCTTTCCGCTGACACCGTGCAGTGGAGAAAG

GATGACGGCCAGGCTTTTTCCCAGGGCGGGTTCGAGCTACAGGGGAACCAAATCCTCA

TCCCACACACTGGGCTCTTCTTCGTTTACAGCCAGGCTTCGTTTAGGGTCAAGTGCAAT

AGCCCGGGCGAGCATACCACTCCTCTGAGTCACATTATTTGGCGCTATTCGGACTCCAT

CGGGGTTAATGCTAATCTTCTTAGCGGGGTAAGGTCAGTTTGTCAACAAAACTACGGT

GATGCTGAGTCCGAAATTGGCGAAGGCTGGTACAATGCAGTTTACCTTGGTGCAGTGT

TCCAGCTGAACGAAGGGGACAAACTGTGGACTGAGACCAATCGACTGACCGACGTGG

AGCCAGAGCAGGGCAAGAACTTCTTTGGTGTGTTTGCACTATGA

Table 3 recombinant human Unidasa base sequence

TTGAACTTCAGAGCTCCACCTGTTATTCCAAACGTCCCATTCTTGTGGGCCTGGAATGC

ACCTTCTGAGTTCTGTTTGGGAAAGTTCGATGAGCCACTTGACATGTCATTGTTTAGTTT

CATTGGATCTCCTAGAATCAATGCTACTGGTCAAGGAGTTACCATTTTCTACGTCGATA

GATTGGGTTACTATCCTTACATTGACTCAATCACTGGAGTTACAGTCAACGGTGGAATT

CCACAGAAGATCAGTCTTCAAGATCATTTGGACAAGGCTAAGAAAGACATCACTTTCT

ACATGCCAGTTGATAACTTGGGTATGGCAGTCATCGACTGGGAAGAGTGGAGACCAAC

ATGGGCTAGAAACTGGAAGCCTAAGGATGTTTACAAGAACAGATCTATCGAATTGGTT

CAACAGCAAAACGTCCAGCTGTCCTTGACCGAAGCAACTGAGAAGGCTAAACAAGAA

TTTGAGAAGGCTGGAAAGGATTTCCTTGTTGAGACTATCAAGTTGGGTAAACTGCTTAG

ACCAAACCACTTATGGGGATACTATTTGTTCCCTGACTGTTACAATCATCACTATAAGA

AACCAGGTTACAACGGATCCTGCTTCAATGTTGAAATCAAGAGAAACGATGACCTGTC

CTGGTTGTGGAATGAGTCAACTGCTCTTTACCCTAGTATCTATTTGAACACTCAGCAAT

CACCAGTTGCTGCCACATTGTATGTTAGAAATAGAGTCAGAGAAGCCATTAGAGTTTCT

AAGATCCCTGATGCTAAATCCCCATTGCCTGTCTTTGCCTACACCAGAATTGTTTTCACT

GATCAGGTCCTTAAGTTTTTGTCTCAAGACGAATTGGTTTATACATTTGGAGAGACCGT

CGCTCTGGGTGCCTCAGGAATTGTTATCTGGGGAACTTTGAGTATCATGAGATCTATGA

AGTCCTGTTTGCTTCTGGATAACTACATGGAAACCATCCTTAACCCATACATCATCAAT

GTTACTTTGGCAGCTAAGATGTGTTCTCAAGTTCTGTGCCAGGAGCAAGGTGTCTGCAT

TAGAAAGAACTGGAATTCTTCCGACTACCTTCATTTGAACCCTGATAACTTCGCTATCC

AGTTGGAAAAGGGTGGAAAGTTCACAGTTAGAGGAAAGCCAACCCTTGAAGATTTGG

AGCAATTTTCCGAAAAGTTCTACTGTTCATGCTACAGTACATTGTCTTGTAAGGAGAAA

GCCGACGTTAAGGATACCGACGCCGTTGATGTCTGTATTGCAGACGGTGTTTGCATCGA

TGCATTCTTGAAACCACCTATGGAAACTGAAGAGCCACAAATCTTCTACAAT

Claims (7)

1. pichia yeast genetic engineering bacteria HAS-PH20 by gene regulating direct production antitumour drug complex.

2. pichia spp claimed in claim 1, it is characterized in that: this yeast cell is pichia spp KM71 or SMD1168.

3. yeast gene engineering bacteria TNF-PH20 claimed in claim 1 is characterized in that: first recombinant plasmid pGAPZ α A-tnf is transformed pichia spp, obtain recombination microzyme TNF; With recombinant plasmid pPICZ alpha A-ph20 transformed yeast bacterium TNF, obtain aimed strain TNF-PH20 again.

4. recombinant plasmid pGAPZ α A-tnf claimed in claim 3, it is characterized in that: under the regulation and control of GAP constitutive promoter, this recombinant plasmid can be expressed TNF-α, and described tumour necrosis factor gene tnf has the base sequence in the tumour necrosis factor base sequence table.

5. recombinant plasmid pPICZ alpha A-ph20 claimed in claim 3, it is characterized in that: under the regulation and control of AOX1 inducible promoter, this recombinant plasmid can be expressed HAase; Recombinant human Unidasa gene ph20 is the dna molecular according to the design of pichia spp Preference, and the amino acid that the nucleotide sequence of this molecule is coded is identical with the amino acid that people's Unidasa gene (gene ID6677) is coded.

6. ph20 gene order claimed in claim 5, it is characterized in that: the ph20 gene order is on people's Unidasa gene (gene ID6677) basis, signal peptide and Sac I restriction enzyme site have been deleted, again according to the pichia spp codon usage proline(Pro) of will encoding, aspartic acid, L-Ala, the amino acid whose codon such as Serine replaces to CCA, GAA, GCA, UCA; Revised altogether 18 bases and obtained aim sequence ph20, described ph20 gene order has the base sequence in the recombinant human Unidasa base sequence table.

7. the method for pichia yeast genetic engineering bacteria TNF-PH20 fermentative production antitumour drug complex in the claim 1 is characterized in that:

Under 30 ℃ of conditions, utilize the YPD substratum with recombination microzyme TNF-PH20 activation culture 18～24 hours; Yeast after ratio in 0.5%～2% will activate is transferred in the YPD seed culture medium, and upper tank fermentation process is as follows:

(1) the yeast culture stage: leavening temperature is set as 28～30 ℃, utilize 28% ammoniacal liquor that the pH value of fermention medium is transferred to 5.0～6.0, then by 5%～10% inoculum size seed culture medium is inoculated on the Basal Salts in the tank substratum, added simultaneously 4.37mL PTM1 salts solution.Aeration-agitation 18～24 hours;

(2) the glycerine feed supplement stage (tumour necrosis factor constitutive expression stage): stream adds 30%～50% glycerine, and the stream dosage is 10～20mL/hr/L, cultivates about 24～48 hours, and dissolved oxygen amount is greater than 20% in the whole process.This process is to be that the thalline weight in wet base increases the stage in the yeast growth stage, also is the tumour necrosis factor constitutive expression stage, and TNF-α is by Rapid Accumulation in this process;

(3) the methanol induction stage (recombinant human Unidasa inducible expression stage): the stream glycerol adding stops stream to the certain hour and adds, replacing methyl alcohol is carbon source, flow acceleration is 4～8mL/hr/L, continues to cultivate 24～48 hours, and dissolved oxygen amount is greater than 20% in the whole process.This process flow adds methyl alcohol can induce the effect of AOX1 promotor and begin to express the recombinant human Unidasa, can add by the stream of regulating and control respectively glycerine and methyl alcohol the antitumour drug complex that the time obtains TNF-α and HAase different content proportioning in this process.

Images