CN102618551A - Method for using brewer's yeast to express antibacterial peptide G13 - Google Patents
Method for using brewer's yeast to express antibacterial peptide G13 Download PDFInfo
- Publication number
- CN102618551A CN102618551A CN2012100730679A CN201210073067A CN102618551A CN 102618551 A CN102618551 A CN 102618551A CN 2012100730679 A CN2012100730679 A CN 2012100730679A CN 201210073067 A CN201210073067 A CN 201210073067A CN 102618551 A CN102618551 A CN 102618551A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- saccharomyces cerevisiae
- yeast
- peptide
- express
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for using brewer's yeast to express antibacterial peptide G13, which includes the steps: a, providing the antibacterial peptide G13 gene and alpha signal peptide gene; b, constructing a recombinant plasmid pYES2-alpha-G13 expressing the antibacterial peptide G23 in a yeast cell; c, using the recombinant plasmid pYES2-alpha-G13 to convert the brewer's yeast INVSC1 cells; d, screening converted bacteria and identifying the bacteria; e, culturing the converted bacteria to obtain the antibacterial peptide G13; and f, identifying the antibacterial peptide G13. The antibacterial peptide G13 is obtained by secretory expression of the brewer's yeast, and the expressed antibacterial peptide has an evident inhibitory effect on escherichia coli DH5 alpha. Using a yeast expression system has the advantages of fast prokaryote growth speed and simplicity in operation and the advantage that a eukaryote translates proteins prior to finishing. Genetic background of the brewer's yeast is clear, and the method has significance of researching eukaryotic expression of the escherichia coli antibacterial peptide.
Description
Technical field
The invention belongs to biotechnology and gene engineering technology field, relate to a kind of method of utilizing yeast saccharomyces cerevisiae to express antibacterial peptide G13 specifically.
Background technology
At present, because a large amount of use of microbiotic quilt in clinical, so produced serious resistance problem.A kind of novel medicament of human urgent need replaces microbiotic, and antibacterial peptide is the amphipathic polypeptide of small molecule, and length is generally less than 50 amino acid.Derive from various bacteriums, the plant and animal of occurring in nature, distribute extensively.Because of the uniqueness of its antibiotic mechanism, thus resistance be difficult for to be produced, and have advantages such as good water solubility, thermostability are strong, has a broad antifungal spectrum, be expected to become traditional antibiotic substitute.Particle cleavage of peptide (Granulysin) is a kind of cationic antibacterial peptide that contains in the particle of cytotoxic lymphocyte CTL and natural killer cell NK; The structural domain of G13 is the peptide section that wherein contains an a-spiral and loop structure, is made up of 19 amino-acid residues, can suppress the activity of bacterium; And to not influence of zooblast; So in medical treatment, herding, fields such as food have vast potential for future development.
The expression system of antibacterial peptide has following source at present, though the natural antibacterial peptide wide material sources, output is little in vivo, is difficult to separation and purification, and cost is high.Though the chemosynthesis antibacterial peptide cycle is short, quantities is little, ability arbitrary combination amino-acid residue, have the racemization problem, and production cost is expensive.Genetic engineering technique is mainly through prokaryotic expression and eukaryotic expression approach, has simple to operately, be easy to separate and purifying, and characteristics such as production cost is low, make it have the potentiality of mass-producing, industrialization production, become research focus in the last few years.
Prokaryotic expression system is main with coli expression system, is to grasp the most sophisticated expression system at present, and its advantage is that growth cycle is short, and it is higher to express output, and cost is cheap relatively.But express antibacterial peptide and have following shortcoming: prokaryotic expression needs smudge cells to discharge antibacterial peptide, has increased the difficulty of production cost and separation and purification; Its continuous expression may produce toxic action to host cell, can reduce toxicity though add a fusion amalgamation and expression, needs cutting to merge head, complex steps; Prokaryotic expression system translation post-treatment is modified the system imperfection, and the biological activity of expression product is lower.
Summary of the invention
The present invention provides a kind of method of utilizing yeast saccharomyces cerevisiae to express antibacterial peptide G13 in order to overcome the deficiency that prior art exists.
The present invention realizes through following technical scheme: a kind of method of utilizing yeast saccharomyces cerevisiae to express antibacterial peptide G13, and it may further comprise the steps:
A, antibacterial peptide G13 gene and signal peptide gene are provided; The gene order of said antibacterial peptide G13 is: CAAAGATCTGTTTCTAATGCTGCTACTAGAGTTTGTAGAACTGGTAGAACTGGTAG ATCTAGATGGTAA; Utilize the method for PCR to obtain the masterplate and the primer of synthetic G13 sequence: said signal peptide gene sequence is to be masterplate with the signal peptide among the plasmid pPICZ α A, utilizes the method for PCR to obtain the signal peptide fragment;
Express recombinant plasmid pYES2-α-G13 of antibacterial peptide G13 in b, the structure yeast cell;
C, with recombinant plasmid pYES2-α-G13 transformed saccharomyces cerevisiae INVSC1 cell, the method for transformation of said recombinant plasmid is an electrotransformation, adopts the preset PIC program of Bio-red company electricity conversion instrument;
D, screening transformed bacteria, and identify that the method for said screening transformed bacteria is for utilizing dull and stereotyped cultivation of the minimum synthetic medium of yeast uridylic defective type;
E, at 30 ℃, the culture transformation bacterium is 7～9 days under the condition of 200rpm/min, obtains antibacterial peptide G13, said antibacterial peptide G13 is present in the bacterium liquid supernatant of culturing yeast bacterium INVSC1;
F, antibacterial peptide G13 is identified that said antibacterial peptide G13 adopts Tricine-SDS-PAGE as authentication method.
The invention has the beneficial effects as follows: the present invention obtains antibacterial peptide G13 through the yeast saccharomyces cerevisiae secreting, expressing, and the antibacterial peptide of expression has tangible fungistatic effect to bacillus coli DH 5 alpha.Adopt the existing prokaryotic organism growth of yeast expression system advantage fast, simple to operate, the advantage that has eukaryote that protein is carried out posttranslational modification again, yeast saccharomyces cerevisiae genetic background is clear, and is easy to operate; Yeast saccharomyces cerevisiae and daily life are close, and safety non-toxic is plain, can not constitute a threat to biological and environment; Can carry out the protein translation post-treatment; Can carry out secreting, expressing, have advantages such as the simple and cost of the purifying of being easy to, technology is lower, method of the present invention is significant to the eukaryotic expression research of antibacterial peptide.
Description of drawings
Fig. 1 is the building process synoptic diagram of recombinant plasmid pYES2-α-G13;
Fig. 2 is the electrophorogram of the PCR product of α-factor gene;
Fig. 3 is the electrophorogram of the PCR product of antibacterial peptide G13 gene;
Fig. 4 induces supernatant Tricine-SDS-PAGE electrophorogram for engineering bacteria;
Fig. 5 induces supernatant to the active detection figure of intestinal bacteria for engineering bacteria;
In Fig. 2, swimming lane M is DNA Marker D (2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp), and swimming lane 1 is the PCR product of α-factor.
In Fig. 3, swimming lane M is DNA Marker D (2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp), and swimming lane 1 is the PCR product of antibacterial peptide G13.
In Fig. 4, swimming lane M be Protein Marker (66kDa, 45kDa, 35kDa, 27kDa, 20kDa, 14.4kDa, 9.5kDa, 6.5kDa, 4.1kDa), swimming lane 1 is for inducing supernatant 65ul, swimming lane 2 is not for inducing supernatant 100ul, swimming lane 3 is for inducing supernatant 35ul.
In Fig. 5,1 induces 216h 200ul supernatant for engineering bacteria, and 2 is sterilized water 200ul, and 3 is the 10ug penbritin, and 4.5 induce 96h 200ul supernatant for engineering bacteria, and 6 do not induce 216h 200ul supernatant for engineering bacteria.
Embodiment
Below in conjunction with accompanying drawing the present invention is described in detail.
As shown in Figure 1, a kind of method of utilizing yeast saccharomyces cerevisiae to express antibacterial peptide G13, it may further comprise the steps:
A, antibacterial peptide G13 gene and signal peptide gene are provided; The gene order of antibacterial peptide G13 is: CAAAGATCTGTTTCTAATGCTGCTACTAGAGTTTGTAGAACTGGTAGAACTGGTAG ATCTAGATGGTAA; Utilize the method for PCR to obtain the masterplate and the primer of synthetic G13 sequence: signal peptide gene sequence is to be masterplate with the signal peptide among the plasmid pPICZ α A, utilizes the method for PCR to obtain the signal peptide fragment;
Express recombinant plasmid pYES2-α-G13 of antibacterial peptide G13 in b, the structure yeast cell;
C, with recombinant plasmid pYES2-α-G13 transformed saccharomyces cerevisiae INVSC1 cell, the method for transformation of said recombinant plasmid is an electrotransformation, adopts the preset PIC program of Bio-red company electricity conversion instrument;
D, screening transformed bacteria, and identify that the method for said screening transformed bacteria is for utilizing dull and stereotyped cultivation of the minimum synthetic medium of yeast uridylic defective type;
E, at 30 ℃, the culture transformation bacterium is 7～9 days under the condition of 200rpm/min, obtains antibacterial peptide G13, said antibacterial peptide G13 is present in the bacterium liquid supernatant of culturing yeast bacterium INVSC1;
F, antibacterial peptide G13 is identified that said antibacterial peptide G13 adopts Tricine-SDS-PAGE as authentication method.
A kind of specific operation process of utilizing yeast saccharomyces cerevisiae to express the method for antibacterial peptide G13 of the present invention is:
(1), the acquisition of antibacterial peptide G13 sequence:
Antibacterial peptide G13 aminoacid sequence is: QRSVSNAATRVCRTGRSRW, and according to the yeast saccharomyces cerevisiae codon preference, the base sequence after the optimization is:
CAAAGATCTGTTTCTAATGCTGCTACTAGAGTTTGTAGAACTGGTAGATCTAGATG G, design template and upstream and downstream primer.
Primer and template sequence are following:
G13?F1：5’CCGCTCGAGAAAAGACAAAGATCTGT3’
G13?R1：3’GGAATTCTTACCATCTAGATCTACCAGTTCTACAAAC5’
The G13 template:
5’AAAAGACAAAGATCTGTTTCTAATGCTGCTACTAGAGTTTGTAGAACTGGTAG3’
Xho I restriction enzyme site is introduced at the upper reaches, and EcoR I restriction enzyme site is introduced in downstream.
Pcr amplification antibacterial peptide G13 gene, PCR reaction conditions: 94 ℃ of 5min, 94 ℃ 30s-60 ℃ 30s-72 ℃ of 1min, 30 circulations, 72 ℃ of 10min.1.5% agarose gel electrophoresis is identified amplified production, and amplified production-20 ℃ of preservations after reclaiming purifying are subsequent use.
(2), the acquisition of signal peptide sequence:
The pPICZ α A plasmid of preserving with this laboratory is a template, design upstream and downstream primer;
F2：5′CCCAAGCTTACGATGAGATTTCCTTCAAT3′
R2：5′GCTCTAGA?GAATTC?AGCTTCAGCCTCTCTT3′
Hind III restriction enzyme site is introduced at the upper reaches, and Xba I and EcoR I restriction enzyme site are introduced in the downstream part, cuts incomplete phenomenon for fear of signal peptide simultaneously and occurs, and has removed the Ste13 cleavage site, only keeps the Kex2 cleavage site.
Pcr amplification signal peptide: PCR reaction conditions: 94 ℃ of 5min, 94 ℃ 30s-60 ℃ 30s-72 ℃ of 1min, 30 circulations, 72 ℃ of 10min.1% agarose gel electrophoresis is identified amplified production, and amplified production-20 ℃ of preservations after reclaiming purifying are subsequent use.
(3), the structure of secretion expression carrier pYES2-α:
The signal peptide that reclaims behind pYES2 plasmid and the pcr amplification is carried out Hind III and the reaction of Xba I double digestion; Product is cut glue and is reclaimed behind 1% agarose gel electrophoresis; The T4 ligase enzyme; After 16 ℃ of 1h carried out ligation, transformed into escherichia coli DH5 α bacterial strain transformed bacterium colony order-checking after bacterium liquid PCR identifies.
(4), the structure of secreting, expressing type recombinant plasmid pYES2-α-G13:
Antibacterial peptide G13PCR recovery product and pYES2-alpha expression carrier are carried out Xho I and the reaction of EcoR I double digestion; Product is cut glue and is reclaimed behind 1% agarose gel electrophoresis; The T4 ligase enzyme; After 16 ℃ of 1h carried out ligation, transformed into escherichia coli DH5 α bacterial strain transformed bacterium colony order-checking after bacterium liquid PCR identifies.
(5), recombinant plasmid pYES2-α-G13 transformed saccharomyces cerevisiae INVSc1:
1, preparation yeast saccharomyces cerevisiae INVSc1 competent cell:
1. inoculate the frozen glycerol stock of 30 μ l yeast saccharomyces cerevisiae INVSc1 to 3ml YPD liquid nutrient medium, 30 ℃, 200rpm, the concussion activation of spending the night.
2. the 500 μ l that transfer spend the night activatory yeast saccharomyces cerevisiae INVSc1 bacterium liquid in the 50mlYPD liquid nutrient medium, and 30 ℃, 200rpm, it is about 1.1 that concussion is cultured to OD600.
3. 4 ℃, 1500g, 5min, centrifugal collecting cell is with the sterilized water of 50ml precooling pressure-vaccum suspension cell gently.
4. 4 ℃, 1500g, 5min, centrifugal, with the sterilized water suspension cell of 25ml precooling.
5. 4 ℃, 1500g, 5min, centrifugal, with the sorbyl alcohol of 25ml precooling pressure-vaccum suspension cell gently.
6. 4 ℃, 1500g, 5min, centrifugal, with the sorbyl alcohol suspension cell of 2ml precooling.
7. 4 ℃, 1500g, 5min, centrifugal, with the sorbyl alcohol suspension cell of 200 μ l precoolings, divide in the EP pipe that installs to two pipe 2ml every pipe 100 μ l.
2, transform pYES2-α-G13 plasmid plasmid in yeast saccharomyces cerevisiae INVSc1 competent cell:
1. draw 10 μ l pYES2-α-G13 plasmids and join in the 100 μ l yeast saccharomyces cerevisiae INVSc1 competent cells, mix, add in the electric shock cup of precooling.
2. place 5min on ice.
The yeast saccharomyces cerevisiae parameter of 3. recommending according to the electric shock appearance is provided with, and clicks.
4. in the electric shock cup, add the Sorbitol Solution USP of 500 μ l precoolings immediately, mix.
5. all sucking-off evenly is applied to the SC-U flat board.
6. place 30 ℃ of constant incubators, until growing mono-clonal.
3, the positive bacterium colony of bacterium colony PCR reaction screening.Select 5 single bacterium colonies to do the numbering mark from the SC-U flat board, be added in the PCR system PCR reaction conditions with the rifle choicest thalline that takes a morsel: 94 ℃ of 5min, 94 ℃ 30s-60 ℃ 30s-72 ℃ of 1min, 30 circulations, 72 ℃ of 10min.1.5% agarose gel electrophoresis is identified amplified production, filters out positive bacterium colony.
(6), the expression of antibacterial peptide G13 saccharomyces cerevisiae engineered yeast:
1, induce engineering bacterium expression reorganization G13 structural domain, concrete steps are following:
1. transfer 200 μ l antibacterial peptide G13 saccharomyces cerevisiae engineered yeasts to 20ml SC-U liquid nutrient medium, 30 ℃, 200rpm, the activation of spending the night.
2. measure the OD600 value (Y) of bacterium liquid, X=(Y*20)/0.4 by formula calculates OD600 with bacterium liquid and is diluted to 0.4 required SC-U inducing culture base unit weight (X).
3. 4 ℃, 1500 * g, centrifugal 5min are abandoned supernatant, add the SC-U inducing culture by the X value that calculates in second step, and the pressure-vaccum suspension mixes.
4. 30 ℃, 200rpm, shaking culture 7-9 days.Get 1ml bacterium liquid, 4 ℃, 1500 * g, centrifugal 5min stay supernatant.
2, acetone precipitation concentrates reorganization G13 structural domain, and concrete steps are following:
1. get the acetone that the 1ml supernatant adds 5ml-20 ℃ of precooling.
2. leave standstill 2h in-20 ℃ of refrigerators.
3. 4 ℃, 12000rpm, centrifugal 10min, supernatant discarded gently.
4. deposition places the ventilation natural air drying.
3, Tricine-SDS-PAGE electrophoresis detection expression of results.
(7), the activity of antibacterial peptide G13 structural domain detects:
E.coli DH5 α is in 37 ℃, 180rpm, incubated overnight.Survey the OD600 value of bacterium liquid, it is diluted to 0.5 Maxwell unit (1.5 * 108CFU/ml).
Draw 200 μ l bacterium liquid, evenly coating does not have to place the Oxford cup gently on the antibiotic LB flat board.
Absorption induces supernatant 200ul to add in the cup of Oxford, contrasts to sterilized water, SC-U inducing culture, does not induce supernatant, AMP, places 37 ℃ of constant incubator incubated overnight, observes fungistatic effect next day.
Wherein: yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) INVSc1 is available from Invitrogen company; The pYES2 expression vector is available from Invitrogen company; PPICZ α A expression vector is available from Invitrogen company; Intestinal bacteria (Escherichia coli) DH5 α can buy on the market easily.
Should be noted that at last; Above content is only in order to explain technical scheme of the present invention; But not to the restriction of protection domain of the present invention; The simple modification that those of ordinary skill in the art carries out technical scheme of the present invention perhaps is equal to replacement, does not all break away from the essence and the scope of technical scheme of the present invention.
Claims (7)
1. method of utilizing yeast saccharomyces cerevisiae to express antibacterial peptide G13 is characterized in that: said method comprising the steps of:
A, antibacterial peptide G13 gene and signal peptide gene are provided;
Express recombinant plasmid pYES2-α-G13 of antibacterial peptide G13 in b, the structure yeast cell;
C, with recombinant plasmid pYES2-α-G13 transformed saccharomyces cerevisiae INVSC1 cell;
D, screening transformed bacteria, and identify;
E, at 30 ℃, the culture transformation bacterium is 7～9 days under the condition of 200rpm/min, obtains antibacterial peptide G13;
F, antibacterial peptide G13 is identified.
2. a kind of method of utilizing yeast saccharomyces cerevisiae to express antibacterial peptide G13 according to claim 1, it is characterized in that: the gene order at antibacterial peptide G13 described in the said step a is:
CAAAGATCTGTTTCTAATGCTGCTACTAGAGTTTGTAGAACTGGTAGAACTGGTAG ATCTAGATGGTAA utilizes the method for PCR to obtain to synthesize the masterplate and the primer of G13 sequence.
3. a kind of method of utilizing yeast saccharomyces cerevisiae to express antibacterial peptide G13 according to claim 1; It is characterized in that: in the gene of signal peptide described in step a sequence is to be masterplate with the signal peptide among the plasmid pPICZ α A, utilizes the method for PCR to obtain the signal peptide fragment.
4. a kind of method of utilizing yeast saccharomyces cerevisiae to express antibacterial peptide G13 according to claim 1, it is characterized in that: the method for transformation at recombinant plasmid described in the step c is an electrotransformation, adopts the preset PIC program of Bio-red company electricity conversion instrument.
5. a kind of method of utilizing yeast saccharomyces cerevisiae to express antibacterial peptide G13 according to claim 1 is characterized in that: the method at the transformed bacteria of screening described in the steps d is cultivated for utilizing the minimum synthetic medium flat board of yeast uridylic defective type.
6. a kind of method of utilizing yeast saccharomyces cerevisiae to express antibacterial peptide G13 according to claim 1 is characterized in that: be present in the bacterium liquid supernatant of culturing yeast bacterium INVSC1 at antibacterial peptide G13 described in the step e.
7. a kind of method of utilizing yeast saccharomyces cerevisiae to express antibacterial peptide G13 according to claim 1 is characterized in that: adopt Tricine-SDS-PAGE as authentication method at antibacterial peptide G13 described in the step f.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100730679A CN102618551A (en) | 2012-03-15 | 2012-03-15 | Method for using brewer's yeast to express antibacterial peptide G13 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100730679A CN102618551A (en) | 2012-03-15 | 2012-03-15 | Method for using brewer's yeast to express antibacterial peptide G13 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102618551A true CN102618551A (en) | 2012-08-01 |
Family
ID=46558760
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012100730679A Pending CN102618551A (en) | 2012-03-15 | 2012-03-15 | Method for using brewer's yeast to express antibacterial peptide G13 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102618551A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103088043A (en) * | 2013-01-07 | 2013-05-08 | 安徽希普生物科技有限公司 | Construction method of colon bacillus genetic engineering strain for secretory expression of Metchnikowin antibacterial peptide |
| CN103555756A (en) * | 2013-10-29 | 2014-02-05 | 湖北希普生物科技有限公司 | Method for secretory expression of antibacterial peptide LfcinB by use of saccharomyces cerevisiae |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1557960A (en) * | 2004-01-16 | 2004-12-29 | 刘秋云 | Method for separating antibiotic peptide and separated antibiotic peptide |
| CN1763081A (en) * | 2005-09-16 | 2006-04-26 | 中山大学 | Antibiotic dipeptide and its chemical modifier, its preparation method and uses |
| CN102212541A (en) * | 2011-03-28 | 2011-10-12 | 广东希普生物科技股份有限公司 | Construction of gene engineering bacteria for expressing recombinant cationic antimicrobial peptides (AMPs) G13 escherichia coli |
-
2012
- 2012-03-15 CN CN2012100730679A patent/CN102618551A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1557960A (en) * | 2004-01-16 | 2004-12-29 | 刘秋云 | Method for separating antibiotic peptide and separated antibiotic peptide |
| CN1763081A (en) * | 2005-09-16 | 2006-04-26 | 中山大学 | Antibiotic dipeptide and its chemical modifier, its preparation method and uses |
| CN102212541A (en) * | 2011-03-28 | 2011-10-12 | 广东希普生物科技股份有限公司 | Construction of gene engineering bacteria for expressing recombinant cationic antimicrobial peptides (AMPs) G13 escherichia coli |
Non-Patent Citations (1)
| Title |
|---|
| 胡亚冬等: "一种酿酒酵母附加型分泌表达载体pYES2 /CT /A-factor的构建及鉴定", 《中国生物工程杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103088043A (en) * | 2013-01-07 | 2013-05-08 | 安徽希普生物科技有限公司 | Construction method of colon bacillus genetic engineering strain for secretory expression of Metchnikowin antibacterial peptide |
| CN103555756A (en) * | 2013-10-29 | 2014-02-05 | 湖北希普生物科技有限公司 | Method for secretory expression of antibacterial peptide LfcinB by use of saccharomyces cerevisiae |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103555756A (en) | Method for secretory expression of antibacterial peptide LfcinB by use of saccharomyces cerevisiae | |
| CN106554410B (en) | A kind of recombination human source collagen and its encoding gene and preparation method | |
| CN102146135A (en) | Recombinant human-like collagen and production method thereof | |
| CN102146426A (en) | Method for producing recombinant human-like collagen by expression by Pichia pastoris | |
| CN104402975B (en) | Anti-aging small peptide and preparation method thereof | |
| CN101906165B (en) | Expression product in series of two fish antibacterial peptide genes and expression method thereof | |
| CN101845454B (en) | Method for expressing pseudoplectania nigrella mature peptide in recombinant pichia pastoris | |
| CN103898153A (en) | Multi-copy metallothionein recombinant expression vector and method thereof for high-efficiency expression of metallothionein | |
| CN103621795A (en) | Application of hybrid antibacterial peptide as the feed supplement | |
| CN102731641A (en) | Modification of echinococcus granulosus EG95 protein, and expression thereof in yeast | |
| CN103320461A (en) | Method for constitutive expression of target antibacterial peptide AgPlectasin in Pichia pastoris | |
| CN102796200B (en) | Hybrid peptide bursin adjuvant and preparation method and application thereof | |
| CN104263709A (en) | Egg-white lysozyme and preparation method thereof | |
| CN102618551A (en) | Method for using brewer's yeast to express antibacterial peptide G13 | |
| CN104988170B (en) | One kind fusion antibacterial peptide and its preparation method and application | |
| CN102586256A (en) | Method for expressing human beta-defensin 3 in yeast expression system | |
| CN103981209A (en) | Preparation method of cattle beta-defensin 5 mature peptide, its recombinant bacteria and application thereof | |
| CN101864372A (en) | Preparation method of antibacterial peptide gene engineering strain | |
| CN101892168A (en) | Pichiapastoris expression strain for recombinant duck interleukin 2 and construction method and application thereof | |
| CN105018407A (en) | Bacillus subtilis of secretory expression proline aminopeptidase and application thereof | |
| CN105671069B (en) | A kind of bee peptide expression vector and its construction method and application | |
| CN102242129A (en) | Optimized sequence of pseudosciaena crocea growth hormone (pcGH) gene and application of optimized sequence | |
| CN104163865A (en) | Optimized DNA sequences of recombinant human bone morphogenetic protein-2 and coded protein thereof | |
| CN102010867A (en) | Yeast expression method for recombining major protein AccMRJP1 of apis cerana royal jelly and product application | |
| CN103014058A (en) | Method for industrially producing grouper growth hormone recombination gene protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20120801 |