CN102911872A

CN102911872A - Scenedesmus sp. strain and application thereof

Info

Publication number: CN102911872A
Application number: CN2012103186291A
Authority: CN
Inventors: 罗少敬; 邓平; 李青; 吴洪; 王冰
Original assignee: ENN Science and Technology Development Co Ltd
Current assignee: ENN Science and Technology Development Co Ltd
Priority date: 2012-08-31
Filing date: 2012-08-31
Publication date: 2013-02-06
Anticipated expiration: 2032-08-31
Also published as: CN102911872B

Abstract

The invention discloses a scenedesmus sp. strain and application thereof. The scenedesmus sp. strain has the advantages of high growth speed, high grease accumulation speed, high oil content, capability of effectively removing nitrogen containing compounds in water, and the like, contains partially beneficial pigments, and can be used in production of biodiesel and production of foods, health care products, feeds, aquatic product baits, medicines, cosmetics and pigments.

Description

The algae strain of grid algae and application thereof

Technical field

The present invention relates to microorganism field, relate in particular to a kind of grid algae ENN33 (Scenedesmus sp.) and application thereof.

Background technology

Along with the progressively exhaustion of world's fossil fuel capacity, the continuous increase of CO2 emissions and global climate day by day become warm, human survival and development situation has faced unprecedented challenge.Therefore; therefore, countries in the world all positive searching can the petroleum replacing product renewable energy source, wherein; biofuel is exactly a kind of important bioenergy; yet common cultivation periods such as corn and soybean of oil crops is longer, takies the farmland more; can produce " striving grain with the people; strive ground with grain " problem, thereby cause the awkward result of " solved energy dilemma, crisis in food but occurred ".

Little algae be a class on land, the ocean is widely distributed, nutritious, growth cycle is short, photosynthetic availability high with the energy-producing lower plant of photoautotrophy, be the nature origin the earliest, the biomass resource of the widest, the kind of distributing and quantity maximum.Many little algaes can accumulate storage property triacylglycerol (little algae oil) (being similar to vegetables oil) in a large number in cell under certain condition, and its high-content can reach more than 50% of dry cell weight.Compare with high Lu Sheng oil crops, the unit surface oil yield of little algae is the decades of times of oilseed plant oil yield, through biological smelting can the production biofuel etc. multiple biofuel, be considered to the most potential most possible biomass resource that becomes oil substitutes.

Except oil yield is very high, little algae is rich in proteins, fat, carbohydrate, each seed amino acid, VITAMIN, microbiotic, high unsaturated fatty acid and other various bioactivators also, therefore, has too good DEVELOPMENT PROSPECT in fields such as protective foods, medicine and feeds, for example, be used for foodstuff and pharmaceutical sector (nutritional supplement of humans and animals: VITAMIN, protein, lipid acid, polysaccharide etc.); Extract chemical industry such as makeup, fine chemical product etc.; Produce biogas, fuel as the energy; Be used for bait and feed industry (bait of the aquatic animals such as fishes and shrimps, crustacean, poultry feed etc.); On the agricultural as soil redeposition, fertilizer etc.

In addition, the adaptive capacity to environment of little algae is very strong, and is also very simple to the requirement of nutrition, can grow under various harsh environment.For example, little algae can absorb by photosynthesis the organism such as nitrogen phosphorus synthesizing amino acid, protein, phosphatide of the inorganic salt such as nitrate in the sewage, nitrite, ammonium salt, phosphoric acid salt, form microalgae cell, thereby the nitrogen and phosphorus content in the reduction water body, therefore little algae can be used for removing the nitrogen phosphorus in the sewage.Little algae also can utilize the CO in the industrial gaseous waste ₂, reduce CO ₂Discharging.Therefore little algae is being aspect the industry environmental protection or also all there is good application prospect the city environmental protection aspect.Also have one slightly algae can be grown in the water body of high salt, high alkali environment, can take full advantage of the soil that beach, saltings, desert etc. are not suitable for cultivating and carry out large scale culturing, also can utilize the non-agricultural waters such as seawater, saline-alkali water, trade effluent to cultivate, be described as " green oilfield " capable of circulation, therefore develop little algae cultivation and related industries thereof and also be fit to very much especially cultivated land resource China relatively in short supply of soil.

Especially it is in the exploitation of bioenergy application facet all to have actively developed at present both at home and abroad exploitation for little algae, and this is wherein in the majority with the research to chlorella.CN101460609 discloses a kind of new Chlorella (CHLORELLA) species and has used CN101565675 and discloses a kind of chlorella and cultural method and its application in production of biodiesel; CN101824386 discloses a chlorella, and is producing microalgae grease and fixation of C O ₂In application; CN102093955 discloses a chlorella and the application in utilizing sewage cultivation and biofuel transformation system thereof; CN102229889 discloses a chlorella and cultural method thereof and at CO ₂Fixing, the purification of waste water, the production application of the biomass such as grease, protein, pigment, starch, polysaccharide, nucleic acid.

The grid algae is planktonic microalgae common in the fresh water, and utmost point happiness is bred in nutritious hydrostatic.Numerous species has stronger patience to organic pollutant, can be used as indicator organism in water quality assessment, and in self purification of water body and sewage purification certain effect is arranged, and is the dominant species in the organic sewage oxidation pond biophase.It can be attached in the water on the organism fragment and other waterplant bodies simultaneously with bacterium, forms gelatinous layer, adsorb organic compound.When the grid algae carries out photosynthesis, produce oxygen on the one hand for the needs of bacterial degradation organic matter, also can directly utilize on the other hand organicly as Carbon and nitrogen sources, organism is degraded rapidly, thus purifying water body.The grid frustule contains rich in protein and VITAMIN, is the good feeds of fish, as utilizes the organic sewage oxidation pond to breed fish, and can obtain high yield.Prolific frond also can be made the feed of poultry.Domestic and international exploitation for the grid algae also is not a lot of at present, CN101565674 discloses the low nutrition grid algae of a strain and the application in advanced treatment of wastewater thereof, this grid algae algae strain can be grown in low nutrient environment, therefore the nitrogen phosphorus in the secondary effluent can be removed to very low level; CN102083957 discloses a kind of little algae of the distinctive plush copper shape of the efficient removal carbonic acid gas former mutation of grid algae and uses thereof that has, little algae of the former mutation of plush copper shape grid algae that especially the carbon dioxide fixation rate is high and uses thereof; CN102250773 discloses a strain grid algae and cultural method thereof and at CO ₂Fixing, the purification of waste water, the application in the fields such as production of the biomass such as grease, protein, pigment, starch, polysaccharide, nucleic acid; The people such as Ji Xiang, Wang Jinrong (screening of a strain scenedesmus obliquus and the optimization of growth conditions [J].Aquatic science and technology information, 2010:37 (6)) obtained that a strain oil-containing is relatively high, preferably algae kind grid algae algae strain of growing way.

Although little algae has the DEVELOPMENT PROSPECT such as the very good energy, environment protection even medicine, and also gradually expansion of relevant research work, present known little algae, especially grid algae, oleaginousness is usually below 40%, to CO ₂The performance of the aspect such as processing power, extreme environment tolerance on also generally on the low side.Therefore need the exploitation performance better, be more suitable for the algae kind of industrial application.

Summary of the invention

The object of the present invention is to provide a kind of by force to adaptive capacity to environment, fat content is high, to CO ₂The strong grid algae that more is suitable for industrial application of processing power.

For reaching this purpose, the present invention by the following technical solutions:

In first aspect, the invention provides a kind of grid algae ENN33 (Scenedesmus sp.), be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC), preservation date is on 07 13rd, 2012, and preserving number is CGMCC No.6347.

The content of lipid acid in the algae powder can be preferably more than 50% dry weight greater than 40% dry weight among the grid algae ENN33 provided by the invention, is 56% ~ 60% dry weight more preferably, is most preferably 58%.

Grid algae ENN33 provided by the invention contains astaxanthin, β-carotene, xenthophylls, zeaxanthin and canthaxanthin.

The tolerable temperature of grid algae ENN33 provided by the invention can be-10 ℃ to 44 ℃, preferably 6 ℃ to 40 ℃, and more preferably 8 ℃ to 30 ℃, also more preferably 10 ℃ to 20 ℃, most preferably 15 ℃.

Grid algae ENN33 provided by the invention can be at-10 ℃,-9 ℃,-8 ℃,-7 ℃,-6 ℃,-5 ℃,-4 ℃,-3 ℃,-2 ℃,-1 ℃, 0 ℃, 1 ℃, 2 ℃, 3 ℃, 4 ℃, 5 ℃, 6 ℃, 7 ℃, 8 ℃, 9 ℃, 10 ℃, 11 ℃, 12 ℃, 13 ℃, 14 ℃, 15 ℃, 16 ℃, 17 ℃, 18 ℃, 19 ℃, 20 ℃, 21 ℃, 22 ℃, 23 ℃, 24 ℃, 25 ℃, 26 ℃, 27 ℃, 28 ℃, 29 ℃, 30 ℃, 31 ℃, 32 ℃, 33 ℃, 34 ℃, 35 ℃, 36 ℃, 37 ℃, 38 ℃, 39 ℃, 40 ℃, 41 ℃, 42 ℃, 46,43 ℃ or 44 ℃ of lower growths.

In second aspect, the invention provides the cultural method such as the described grid algae of first aspect ENN33, described method comprises grid algae algae strain ENN 33 green cells is seeded in the BG11 substratum, wherein intensity of illumination 50-500 μ mol/m ².s, preferred 100-450 μ mol/m ².s, more preferably 150-400 μ mol/m ².s, more preferably 200-350 μ mol/m also ².s, 250-300 μ mol/m most preferably ².s, pH value 7-9, preferred 7.5-8.5, more preferably 8, temperature 15-35 ℃, preferred 20-30 ℃, more preferably 25 ℃.

In the cultural method of grid algae ENN33 of the present invention, intensity of illumination can be 50 μ mol/m ².s, 80 μ mol/m ².s, 100 μ mol/m ².s, 120 μ mol/m ².s, 150 μ mol/m ².s, 180 μ mol/m ².s, 200 μ mol/m ².s, 220 μ mol/m ².s, 250 μ mol/m ².s, 280 μ mol/m ².s, 300 μ mol/m ².s, 320 μ mol/m ².s, 350 μ mol/m ².s, 380 μ mol/m ².s, 400 μ mol/m ².s, 420 μ mol/m ².s, 450 μ mol/m ².s, 480 μ mol/m ².s or 500 μ mol/m ².s; The pH value can be 7,7.2,7.5,7.8,8,8.2,8.5,8.8 or 9; Temperature can be 15 ℃, 16 ℃, 17 ℃, 18 ℃, 19 ℃, 20 ℃, 21 ℃, 22 ℃, 23 ℃, 24 ℃, 25 ℃, 26 ℃, 27 ℃, 28 ℃, 29 ℃, 30 ℃, 31 ℃, 32 ℃, 33 ℃, 34 ℃ or 35 ℃.

In the third aspect, the invention provides the application in lipid acid is produced such as the described grid algae of first aspect ENN33, preferably, described lipid acid is tetradecanoic acid, palmitinic acid, Zoomeric acid, stearic acid, octadecenoic acid, octadecadienoic acid, therapic acid, alpha-linolenic acid, gamma-linolenic acid and/or timnodonic acid.

In fourth aspect, the invention provides the application in biofuel is produced such as the described grid algae of first aspect ENN33, preferably, described biofuel is biofuel or bio-ethanol.

Aspect the 5th, the invention provides the application in environment protection such as the described grid algae of first aspect ENN33, preferably described environment protection is sewage disposal or CO ₂Reduce discharging, described sewage disposal comprises denitrogenation, dephosphorization, the organic matter degradation and/or heavy metal ion adsorbed of sewage.

Aspect the 6th, the invention provides the purposes in the preparation of the medicine that comprises tetradecanoic acid, palmitinic acid, Zoomeric acid, stearic acid, octadecenoic acid, linolic acid, therapic acid, alpha-linolenic acid, gamma-linolenic acid, eicosanoic acid, behenic acid, timnodonic acid, astaxanthin, β-carotene, xenthophylls, zeaxanthin and/or canthaxanthin such as the described grid algae of first aspect ENN33.

Aspect the 7th, the invention provides the purposes in the food that comprises tetradecanoic acid, palmitinic acid, Zoomeric acid, stearic acid, octadecenoic acid, linolic acid, therapic acid, alpha-linolenic acid, gamma-linolenic acid, eicosanoic acid, behenic acid, timnodonic acid, astaxanthin, β-carotene, xenthophylls, zeaxanthin and/or canthaxanthin, healthcare products, feed and/or fishery products bait are produced such as the described grid algae of first aspect ENN33.

In eight aspect, the invention provides the application in the cosmetics production that comprises tetradecanoic acid, palmitinic acid, Zoomeric acid, stearic acid, octadecenoic acid, linolic acid, therapic acid, alpha-linolenic acid, gamma-linolenic acid, eicosanoic acid, behenic acid, timnodonic acid, astaxanthin, β-carotene, xenthophylls, zeaxanthin and/or canthaxanthin such as the described grid algae of first aspect ENN33.

In the present invention, the BG11 substratum is algae media the most frequently used in this area, and its concrete component sees below.

Useful technique effect of the present invention is:

1, this algae kind fast growth, CO ₂Utilization ratio is high, and cell settlement is good, is convenient to collect, and is suitable for high-density breeding, is fit to Industry Promotion

2, this algae kind oil and fat accumulation is fast, and oleaginousness is high, is fit to the production biofuel

3, this algae kind can effectively be removed the nitrogen in the water, is suitable for wastewater treatment

4, this algae of this algae kind kind temperature tolerance range is extensive, is fit to annual cultivation.

Description of drawings

Fig. 1 is that grid algae ENN33 of the present invention is at the microscopy picture of microscopically.

Fig. 2 shows the ITS of grid algae ENN33 of the present invention and the 5.8S partial nucleotide sequence is carried out the BLAST comparison in the GenBank database result.

Fig. 3 is the phylogenetic evolution tree of adopting the grid algae ENN33 of continuous (Neighbor-joining) algorithm structure in ortho position.

Fig. 4 is the indoor culture growth curve of grid algae ENN33 of the present invention.

Fig. 5 is the growth curve of grid algae ENN33 of the present invention under hot conditions.

Fig. 6 is the growth curve () of grid algae ENN33 of the present invention under cold condition.

Fig. 7 is the growth curve (two) under the cold condition of grid algae ENN33 of the present invention.

Fig. 8 is the waste water and gas cultivation growth curve of grid algae ENN33 of the present invention.

Fig. 9 is the pigment percentage composition figure of grid algae ENN33 of the present invention.

Embodiment

Further specify technical scheme of the present invention below in conjunction with accompanying drawing and by embodiment.

Embodiment 1 screening produce oil grid algae algae strain

Get the soil of fetching from Wulanchabu League after the sterilized water dilution dissolving, after 400 power microscopes are observed, approximately cell concn is 800-1200/ml, gets the algae liquid of about 1 μ l with kapillary, is inoculated in 48 holes and is equipped with in the culture plate of BG11 substratum, be to cultivate in the 50 μ mol/m2.s situations at 25 ℃, intensity of illumination, when reaching certain cell concn, microscopic examination, selection only has the hole of single algae strain, being diluted to cell concn is to pave plate behind the 1000-3000/ml, obtains single algae strain.Repeat this process, until obtain the algae strain of pure culture, among the present invention its numbering is called " ENN33 ".

Embodiment 2 identifies algae kind and the classification on evolutionary tree thereof.

The method of taking identification of morphology and Molecular Identification to combine is identified in the algae strain.

1. shape is identified (seeing Fig. 1): the above-mentioned algae strain ENN33 that separates is observed at 1000 power microscopes, frond is unicellular or typing colony form exists, typing colony is comprised of 2 or 4 cells, and colony's cell straight line arranged side by side becomes row or arranges slightly alternately; The cell fusiform, two ends taper gradually up and down, cell walls is level and smooth.The wide 12-34 μ m of the colony of 4 cells, the long 10-20 μ of cell m, wide 3-9 μ m.Chromatoplast Zhousheng, sheet, one piece of tool pyrenoids.Vegetative propagation produces autospore.Retrieval " CHINESE FRESHWATER algae--system, classification and ecology ", find this algae form classification identical be Chlorophyta (Chlorophyta), Chlorophyceae (Chlorophyceae), Chlorococcale (Chlorococcales), grid algae section (Scenedesmaceae), Scenedesmus (Scenedesmus).

2. Molecular Identification:

A, A is from the chlamydomonas that separates increase its ITS and 5.8S partial nucleotide sequence

Extract the ENN33 algae genomic dna of cultivating 4 days with the CTAB method.Get a certain amount of cell, add the addition of C TAB damping fluid after the milled processed, homogenate, add isopyknic phenol: the chloroform extracting, the equal-volume isopropanol precipitating is dissolved in the certain volume sterilization distilled water its concentration of UV spectrophotometer measuring and purity after 75% washing with alcohol.

The ITS sequence amplification adopts eukaryote ITS amplification universal primer (primer is synthetic synthetic by the living worker in Shanghai bio-engineering corporation).

Primer 15 ' GGAAGTAAAAGTCGTAACAAGG 3 '

Primer 25 ' GCATATCAATAAGCGGAGGA 3 '

Getting the total DNA of 1 μ l is template.Amplification condition is as follows: 94 ℃ of sex change 5min, 94 ℃ of 40s then, 56 ℃ of 40s, 30 circulations of 72 ℃ of 2min, last 72 ℃ of 10min.1.0% agarose gel electrophoresis detects its amplified production, and pcr amplification obtains approximately 750bp segment.Sequence following (underscore partly is primer sequence):

GGAAGTAAAAATCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGAATTATAAAAACCACAATGTGAACCTCAACGTTCCGTGCCTCTGCTGCCAGCGGGGCAACGGGCTTTCAGCTCGTTGCTACTTGCAGCTGGCATCGGCATTGCTGCCGTTGCCAGTGGCGCTTTGGCATGACCTTACACCAGTCTAACCACTGTAAAAACCAAAATCTGAAGCTCTGACTGCTATTAACTGGCGGTCTTAACCAAAGACAACTCTCAACAACGGATATCTTGGCTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCCGTGAACCATCGAATCTTTGAACGCATATTGCGCTCGAGCCCTCGGGCAAGAGCATGTCTGCCTCAGCGTCGGTTTACACCCTCACCCCTCCCTCCTTGTGTGGGTCGGTTGGCTTGCTAGCCAGCCTTAGGGGTGGATCTGGCTTCCCCAAACTGCTCCGGCAGGTTGGGTTGGCTGAAGTTTAGAGGCTTAAACAAGGACCCGATATGGGCTTCAACTGGATAGGTAGCACCGGCTTCTGCCGACTACACGAAGTTGTGGCTTGTGGACTTTGTTAGGGGCCAAGCAGGAAACATGCTCTGCATGTTCTAAACTTTCGACCTGAGCTCAGGCAAGGCTACCCGCTGAACTTAAACATATCAAAAACCGGAGGAAAGAGAA TCCTCCGCTTATTGATATGC。

B, the nucleotide sequence homology of cloning search

ITS sequence and the 5.8S partial sequence login GenBank database of the ENN33 that obtains are carried out the BLAST comparison, and the result shows that having higher similarity with the ACCESSION number sequence for the Internal Transcribed Spacer 1,5.8S ribosomal RNA gene and the Internal Transcribed Spacer 2 of the Scenedesmus.sp of AM419228.1 reaches 93% (Fig. 2).

C makes evolutionary tree according to above-mentioned sequence.

Utilize the BLAST instrument in the ncbi database that the ITS partial sequence of algae strain ENN33 is carried out the sequence similarity analysis.The ITS partial sequence of selected part homologous sequence and this algae strain utilizes the clustaLx software package to carry out sequence homology evolution comparison, forms a multiple sequence coupling permutation matrix.Then, use Mega4.0 software, adopt the continuous algorithm in ortho position, the data set bootstraps value of bootstrapping is that 1000 constructing systems are grown evolutionary tree.See Fig. 3.

According to the result of form and ITS blast, restriction ENN33 is Scenedesmus (Scenedesmus).

The contriver has been preserved in described algae strain China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC is called for short in No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City) on 07 13rd, 2012, its preserving number is CGMCC No.6347.

Indoor culture and the oil and fat accumulation of embodiment 3 ENN 33 algaes

The grid algae algae strain ENN 33 green swarm cells that will be in logarithmic phase are seeded in the BG11 substratum (prescription sees Table 1) for preparing, and making cell density reach OD750 is between the 0.2-0.8.The culturing process intensity of illumination is controlled at 50-500 μ mol/m2.s, in incubation period, by passing into the carbonic acid gas of 1.5-2% and the mixed gas of air in nutrient solution, the pH value of substratum is adjusted between the 7-9, and temperature adjusting is in 15-35 ℃ of scope.Cultivate the column reactor that employed reactor is 40mm internal diameter, length 600mm.In the culturing process, timing sampling is measured dry weight, the results are shown in Figure 4.Cultivation proceeds to the 16th day, during algae liquid its colour changed into yellow, algae liquid is collected, and the method acquisition algae mud by centrifugal or natural subsidence is carrying out vacuum lyophilization with algae mud.

Table 1BG11 culture medium prescription

NaNO ₃	1.5g/l
		K ₂HPO ₄·3H ₂O	0.04g/l

MgSO ₄·7H ₂O	0.075g/l
		CaCl ₂·2H ₂O	0.036g/l
Citric acid	0.006g/l
		FeCl ₃·6H ₂O	0.00315g/l
Na ₂EDTA·2H ₂O	0.00436g/l
		Na ₂CO ₃	0.02g/l
A5 trace element *	1ml

* A ₅The moiety of trace element

Be added in the 1000ml deionized water

H ₃BO ₃	2.86g
		MnCl ₂·H ₂O	1.81g
ZnSO ₄·7H ₂O	0.222g
		CuSO ₄·5H ₂O	0.079g
Na ₂MoO ₄·2H ₂O	0.390g
		Co(NO ₃) ₂·6H ₂O	0.0494g

After drying is finished, measure its oil component content such as following table 2, analytical procedure is as follows:

1) lipid acid extracts:

Getting the volume that 50mg or 100mg freeze-dried algae powder be placed on tool Telfnon bottle screw cap is in the phial of 15-20ml, place again a little magnetic bar, add 2-4ml 10%DMSO-methanol solution, 40 ℃ of sand baths (beaker of containing sand is placed on the constant-temperature heating magnetic stirring apparatus) 5 minutes; Then stir extracting 30 minutes at 4 ℃ of lower magnetic forces, 3500 leave the heart, shift supernatant liquor in another bottle.4 ℃ of lower magnetic forces of ether, normal hexane 4-8ml that remaining algae-residue adds 1:1 again stir extracting 1 hour, and 3500 leave the heart, shift supernatant liquor in an above-mentioned bottle.Said process can be repeated until algae-residue bleaches.Adding pure water in above-mentioned merging extract, to make four (water, DMSO-Methanol, ether, normal hexane) volume ratio be 1:1:1:1, the concussion phase-splitting, pipetting organic phase transfers in another phial, in stink cupboard, blow to becoming concentrated solution with nitrogen, then transfer in the 1.5ml plastic centrifuge tube of weighing in advance, dry up to constant weight with nitrogen again.

2) fatty acid analysis:

After extracting according to top method, use n-hexane dissolution, (chromatographic condition is carrier gas: nitrogen flow 1ml/min, hydrogen flowing quantity 30ml/min, air flow quantity 300ml/min to use Agilent 6820 gas chromatographs to carry out gas chromatographic analysis, injector temperature: 280 ℃, detector temperature: 280 ℃, detector type: FID, chromatographic column: DB-5 capillary chromatographic column (30m * 0.25mm, 0.25 μ m), splitting ratio: 4:1.Analytical procedure: marker method (gas-chromatography is done carrier gas with nitrogen, is equivalent to the moving phase of liquid chromatography).

The total fat component of the sample of table 2 gas Chromatographic Determination table

Grid algae algae strain ENN33 has been carried out repeatedly grown cultures and fatty acid analysis measuring, and its fatty acid content can reach 56% ~ 60% dry weight.

Embodiment 4ENN 33 high temperature tolerances

The green swarm cell of grid algae algae strain ENN33 that will be in logarithmic phase is seeded in the BG11 substratum (prescription sees Table 1) for preparing, and makes cell density reach OD ₇₅₀Between 1.2-2.0.The culturing process intensity of illumination is controlled at 400-1200 μ mol/m ².s, in incubation period, by in nutrient solution, passing into the carbonic acid gas of 1.5-2% and the mixed gas of air, the pH value of substratum is adjusted between the 7-9.Cultivating employed reactor is the 600*5cm column reactor.Cultivate and began to carry out hyperthermic treatment on the 4th day, the 1st day of processing is 40-43 ℃ of 2h, is 40-44 ℃ of 6h afterwards, about 25 ℃ of all the other time constant temperature.In the culturing process, timing sampling is measured dry weight, the results are shown in Figure 5.

ENN33 can keep certain speed growth under hot conditions, dry weight reaches about 3.7g/L in the time of final 15 days, and 40-44 ℃ of 6h high temperature does not almost have much affect to the growth of ENN33.But 40 ℃ of high temperature are possible cause dead temperature for other algae strains.

Embodiment 5 ENN33 cold tolerances

The green swarm cell of grid algae algae strain ENN33 that (one) will be in logarithmic phase is seeded in the BG11 substratum (prescription sees Table 1) for preparing, and makes cell density reach OD ₇₅₀Between 1.2-2.0.The culturing process intensity of illumination is controlled at 600-1500 μ mol/m2/s, in incubation period, by passing into the carbonic acid gas of 1.5-2% and the mixed gas of air in nutrient solution, the pH value of substratum is adjusted between the 6.5-8.Cultivating employed reactor is the 0.5*0.03*0.5m plate-type reactor.Two experimental group are set: first group cultivates at normal temperature laboratory (algae liquid temp variation range is 15-30 ℃), second group of daytime, (outdoor algae liquid temp variation range was 6-20 ℃ at outdoor low temperature, most time maintains between 10-15 ℃, and outdoor environment temperature is many between-10 ℃ to 8 ℃), move into indoor the cultivation night.In the culturing process, timing sampling is measured dry weight, the results are shown in Figure 6.

Although the growth of ENN33 low temperature group is compared certain gap with the normal temperature group, under cold condition, also can keep the certain speed growth, and basic identical to later stage and normal temperature group dry weight in cultivation, dry weight reaches about 3.8g/L in the time of final 20 days.

The green swarm cell of grid algae algae strain ENN33 that (two) will be in logarithmic phase is seeded in the BG11 substratum (prescription sees Table 1) for preparing, and makes cell density reach OD ₇₅₀Between 1.2-2.0.The culturing process intensity of illumination is controlled at 600-1500 μ mol/m2/s, in incubation period, by passing into the carbonic acid gas of 1.5-2% and the mixed gas of air in nutrient solution, the pH value of substratum is adjusted between the 6.5-8.Cultivating employed reactor is the 0.5*0.03*0.5m plate-type reactor.Two experimental group are set: first group of 24h cultivates at normal temperature laboratory (algae liquid temp variation range is 15-30 ℃), (algae liquid temp variation range is 6-20 ℃ of daytime to second group of 24h at outdoor low temperature, most time maintains between 10-15 ℃, and occur freezing night) cultivate.In the culturing process, timing sampling is measured dry weight, the results are shown in Figure 7.

It is little that ENN33 low temperature group growth and normal temperature group are compared gap, and basic identical with normal temperature group dry weight in whole culturing process, dry weight reaches about 3.8g/L in the time of final 19 days.

The settleability of embodiment 6 ENN33

With the ENN33 standing over night of cultivating 19 days among the embodiment 5, to observe to second day, supernatant is comparatively limpid, and nearly all frustule all is deposited to reactor bottom, ENN33 is described through the sedimentation of spending the night, and collecting effect is good.

The waste water and gas cultivation of embodiment 7 ENN 33

The algae kind that will be in logarithmic phase is seeded in the 50*10*50cm plate-type reactor, and two experimental group are set: first group is used tap water to cultivate according to table 1 preparation BG11 substratum, and second group is used chemical plant wastewater to add 1.5g/L NaNO ₃, 0.04g/L K ₂HPO ₄3H ₂O preparation substratum cultivates, and the ionic concn of two groups of substratum sees Table 3.

The ionic concn measurement result of two kinds of substratum of table 3

Annotate: each ion component is the chromatography of ions measuring result in the chemical plant wastewater, and each constituent concentration of BG11 substratum is calculated value

Utilize natural condition to carry out grown cultures, natural condition are as follows between incubation period: culture cycle is 11 days, and mainly between 20-45 ℃, the continuous high temperature time on daytime is 3-5h to the range of temperature of 9:00-17:00.Daytime, two-sided total quantity of illumination fine day reached 10000 μ mol/m ²More than/the s, the cloudy day, total quantity of illumination was less than 5000 μ mol/m ²/ s, whole culturing process only has two day cloudy day.Pass into a certain proportion of CO ₂(CO ₂Derive from the chemical plant, purity is more than 95%), the control pH value is between 7.5-8.5.Be interrupted sampling and measuring dry weight (the results are shown in Figure 8) in the culturing process.

Be cultured to algae strain in the 5th day and certain death occurs, but have subsequently whole length to rise.Compare with tap water cultivation, the waste water cultivation slightly has decline cultivating mid-term, but the later stage have and grow, to cultivate difference little with tap water.Cultivating for 11 the Heavenly Stems weighs about 2g/L.

Embodiment 8 ENN 33 pigment contents are measured

1, the extraction of pigment in the frustule: get the frustule of certain centrifugal collection, soak with methyl alcohol and extract for several times, merge methanol extract liquid, remove methyl alcohol with rotary vacuum evaporator, enriched material is again with the CCl4 dissolving, and is to be measured.

2, the preparation of pigment standardized solution: take by weighing a certain amount of astaxanthin, xenthophylls, zeaxanthin, canthaxanthin, β-carotene standard substance, with the standard operation liquid of methyl alcohol preparation different mass concentration.

3, upper liquid chromatography, color atlas and the typical curve of drafting pigment

4, by external standard method, with the pigment standard substance, quantitative Analysis goes out the content (see Table 4, Fig. 9) of pigment

The sample colour component table of table 4 liquid chromatogram measuring

The pigment title	Account for algae powder percentage composition
		Astaxanthin	0.0039%
Xenthophylls	0.0021%
		Zeaxanthin	0.0366%
Canthaxanthin	0.0106%
		β-carotene	0.0548%

The astaxanthin chemical name is 3,3 '-dihydroxyl-4,4 '-diketo-β, β '-carotene can be with protein bound blue or green, blue in vivo.Anti-oxidant, anti-ageing, antitumor, prevention cardiovascular and cerebrovascular diseases effect is arranged;

Xenthophylls has another name called " Lutein ", is the main pigment that consists of human eye retina's macular region, and the protection eyes are arranged, and delays eyes aging and prevent pathology and antioxygenation;

Zeaxanthin is the isomer of xenthophylls, the effect that has particularly important to keeping eye health;

Canthaxanthin (food additive international numbering: INS161g) mainly as animal feedstuff additive, also can be used for the foods such as jam, candy, syrup, sauce, carbonated beverage, as tinting material.

B-carotene is a kind of antioxidant, has detoxification, be to safeguard the indispensable nutrient substance of HUMAN HEALTH, in anticancer, preventing cardiovascular disease, cataract and anti-oxidant significant function arranged, and and then prevent the aging and old and feeble multiple degenerative disorders that causes.

Applicant's statement, the present invention illustrates detailed structure feature of the present invention and method by above-described embodiment, but the present invention is not limited to above-mentioned detailed structure feature and method, does not mean that namely the present invention must rely on above-mentioned detailed structure feature and method could be implemented.The person of ordinary skill in the field should understand, any improvement in the present invention to the increase of the equivalence replacement of the selected parts of the present invention and accessory, the selection of concrete mode etc., all drops within protection scope of the present invention and the open scope.

Claims

1. a grid algae ENN33 (Scenedesmus sp.) is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC), and preservation date is on 07 13rd, 2012, and deposit number is CGMCC No.6347.

2. grid algae ENN33 according to claim 1 is characterized in that, the content of lipid acid is greater than 40% dry weight among the described grid algae ENN33, is preferably more than 50% dry weight, is 56% ~ 60% dry weight more preferably, is most preferably 58%.

3. grid algae ENN33 according to claim 1 is characterized in that, the tolerable temperature of described grid algae ENN33 is-10 ℃ to 44 ℃, preferably 6 ℃ to 40 ℃, and more preferably 8 ℃ to 30 ℃, also more preferably 10 ℃ to 20 ℃, most preferably 15 ℃.

4. grid algae ENN33 according to claim 1 is characterized in that, described grid algae ENN33 contains astaxanthin, β-carotene, xenthophylls, zeaxanthin and canthaxanthin.

5. such as the cultural method of each described grid algae ENN33 in the claim 1 to 4, described method comprises grid algae algae strain ENN33 green cell is seeded in the BG11 substratum, wherein intensity of illumination 50-500 μ mol/m ².s, preferred 100-450 μ mol/m ².s, more preferably 150-400 μ mol/m ².s, more preferably 200-350 μ mol/m also ².s, 250-300 μ mol/m most preferably ².s, pH value 7-9, preferred 7.5-8.5, more preferably 8, temperature 15-35 ℃, preferred 20-30 ℃, more preferably 25 ℃.

6. such as the application of each described grid algae ENN33 in the claim 1 to 4 in lipid acid is produced, preferably, described lipid acid is tetradecanoic acid, palmitinic acid, Zoomeric acid, stearic acid, octadecenoic acid, linolic acid, therapic acid, alpha-linolenic acid, gamma-linolenic acid, eicosanoic acid, behenic acid and/or timnodonic acid.

7. such as the application of each described grid algae ENN33 in the claim 1 to 4 in biofuel is produced, preferably, described biofuel is biofuel or bio-ethanol.

8. such as each described grid algae ENN33 application in environment protection in the claim 1 to 4, preferably described environment protection is sewage disposal or CO ₂Reduce discharging, described sewage disposal comprises denitrogenation, dephosphorization, the organic matter degradation and/or heavy metal ion adsorbed of sewage.

9. comprise application in the medicine of tetradecanoic acid, palmitinic acid, Zoomeric acid, stearic acid, octadecenoic acid, linolic acid, therapic acid, alpha-linolenic acid, gamma-linolenic acid, eicosanoic acid, behenic acid, timnodonic acid, astaxanthin, β-carotene, xenthophylls, zeaxanthin and/or canthaxanthin such as each described grid algae ENN33 in the claim 1 to 4 in preparation.

10. such as the purposes of each described grid algae ENN33 in the food that comprises tetradecanoic acid, palmitinic acid, Zoomeric acid, stearic acid, octadecenoic acid, linolic acid, therapic acid, alpha-linolenic acid, gamma-linolenic acid, eicosanoic acid, behenic acid, timnodonic acid, astaxanthin, β-carotene, xenthophylls, zeaxanthin and/or canthaxanthin, healthcare products, feed, fishery products bait, makeup and/or pigment production in the claim 1 to 4.