CN102899402A - Vibrio shilonii multiple virulence factor GeXP rapid detection kit and detection method thereof - Google Patents
Vibrio shilonii multiple virulence factor GeXP rapid detection kit and detection method thereof Download PDFInfo
- Publication number
- CN102899402A CN102899402A CN2012103285511A CN201210328551A CN102899402A CN 102899402 A CN102899402 A CN 102899402A CN 2012103285511 A CN2012103285511 A CN 2012103285511A CN 201210328551 A CN201210328551 A CN 201210328551A CN 102899402 A CN102899402 A CN 102899402A
- Authority
- CN
- China
- Prior art keywords
- primer
- design
- virulence gene
- virulence
- vibrio shilonii
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The present invention discloses a Vibrio shilonii multiple virulence factor GeXP rapid detection kit and a detection method thereof. According to the present invention, genome DNA of Vibrio shilonii is extracted and is adopted as a template, 13 pairs of multi-gene PCR primers and a pair of universal primers are adopted to carry out multiplex PCR amplification to obtain multiplex PCR reaction products, and a GenomeLab GeXP genetic analysis system is adopted to carry out detection analysis. With the present invention, the special primers are designed based on the 13 Vibrio shilonii virulence genes, a single-tube reaction is performed to rapidly and efficiently detect the 13 genes in one time so as to obtain the following results, the detection coverage is wide, and the Vibrio shilonii detection accuracy can be substantially improved, wherein the results comprise whether the detected sample contains the virulence carrying gene and the Vibrio shilonii having the potentially pathogenic ability. In addition, a certain theory basis is provided for coral bleaching phenomenon prevention and control, and important practical significances are provided for further coral island protection in our country and further degradation prevention.
Description
Technical field:
The present invention relates to biological technical field, be specifically related to a kind of pathogenic vibrio that can cause coral generation albinism-execute quick detection kit and detection method of Luo Shi vibrios (Vibrio shilonii) of being exclusively used in.
Background technology:
Executing Luo Shi vibrios (Vibrio shilonii) is a kind of vibrio marinopraesens, can infect coral, causes the bacillary albefaction of coral.At present, the detection method of executing the Luo Shi vibrios mainly is traditional microorganism classification authentication method and the detection method that depends on round pcr.Traditional microorganism classification and authentication method mainly be with characteristics such as the morphology of microorganism and Physiology and biochemistries as basis for estimation, although the credible result degree is high, loaded down with trivial details and time-consuming.Present stage is adopted maximum or molecular biological method, and it mainly depends on round pcr some specific gene is increased.All there is certain defective in these methods: (1) is detected consuming time, and process is loaded down with trivial details; (2) detection sensitivity is low, falls ill late period often when detecting pathogenic bacteria; (3) target gene that detects is too single, and is undetected because the different strains of the same race that environmental difference causes can not react the potential pathogenic of this kind pathogenic bacteria comprehensively easily.Therefore, when the detection of doing pathogenetic bacteria, only have and detect simultaneously specific gene as much as possible, just can make detected result more have reliability, more accurate to the evaluation of pathogenetic bacteria.
Summary of the invention:
First purpose of the present invention provide a kind of estimate more rapidly and accurately execute Luo Shi vibrios (Vibrio shilonii) pathogenic execute the multiple virulence factor GeXP of Luo Shi vibrios quick detection kit.
The multiple virulence factor GeXP quick detection kit of Luo Shi vibrios (Vibrio shilonii) of executing of the present invention, comprise the PCR reaction reagent, polygene PCR primer and GeXP multiplex amplification reaction reagent, it is characterized in that, described polygene PCR primer comprises 13 pairs of polygene PCR primers and a pair of universal primer, and is specific as follows:
Contain fluorescently-labeled universal primer to sequence, technology is added to fluorescent mark on the following universal primer sequence routinely, and described fluorescent mark is preferably the CY5 fluorescent mark:
TY-F:5’-AGGTGACACTATAGAATA-3’
TY-B:5’-GTACGACTCACTATAGGGA-3’
Be the primer of virulence gene sod (NCBI Reference Sequence:NZ_ABCH01000140.1) design, the amplified fragments size is about 110bp:
sod-F：AGGTGACACTATAGAATA?CCGTTCATGTAGTCTGGACG
sod-R：GTACGACTCACTATAGGGA?GCAGCGACTCCACTAACAGA
Be the primer of virulence gene fldA (NCBI Reference Sequence:NZ_ABCH01000151.1) design, the amplified fragments size is about 117bp:
fldA-F：AGGTGACACTATAGAATA?ACGTGACATCGTTGAAGCAA
fldA-R：GTACGACTCACTATAGGGA?AGGCCAACGAATTGTGACTC
Be the primer of virulence gene ompUL (GenBank:EU727214.1) design, the amplified fragments size is about 124bp:
ompUL-F：AGGTGACACTATAGAATA?TTGGTGCGGGTTATCAGCTA
ompUL-R：GTACGACTCACTATAGGGA?CGAATACGGTCTGTTAGGTCG
Be the primer of virulence gene toxS (GenBank:EU727211.1) design, the amplified fragments size is about 131bp:
toxS-F：AGGTGACACTATAGAATA?CGCGGATATATTCACCACCT
toxS-R：GTACGACTCACTATAGGGA?CAATGAATGGCAATCCAACA
Be the primer of virulence gene Bcp (NCBI Reference Sequence:NZ_ABCH01000011.1) design, the amplified fragments size is about 138bp:
Bcp-F：AGGTGACACTATAGAATA?AACGTTGTGAGCGTCAAGC
Bcp-R：GTACGACTCACTATAGGGA?GGCAACACCGTCACACTACA
Be the primer of virulence gene dnaJ (GenBank:AB263067.1) design, the clip size of amplification is about 145bp:
dnaJ-F：AGGTGACACTATAGAATA?ATTCGGTGATATCTTTGGCG
dnaJ-R：GTACGACTCACTATAGGGA?CTCAACGAGCGTTGGAACTT
Be the primer of virulence gene mshA (GenBank:NZ_ABCH01000011.1) design, the amplified fragments size is about 152bp:
mshA-F：AGGTGACACTATAGAATA?CTGAGCGACGGTTATCAACA
mshA-R：GTACGACTCACTATAGGGA?ATGGTCACGTTAGTTTGCCC
Be the primer of virulence gene z2z3 (GenBank:AF009900.1) design, the amplified fragments size is about 159bp:
z2z3-F：AGGTGACACTATAGAATA?CTCTCATTGGTTAGCCCTCG
z2z3-R：GTACGACTCACTATAGGGA?ATCATCGGAAGATCAGCGTC
Be the primer of virulence gene fimA (NCBI Reference Sequence:NZ_ABCH01000010.1) design, the amplified fragments size is about 166bp:
fimA-F：AGGTGACACTATAGAATA?AGCTGTGGTTGATTGGCTCT
fimA-R：GTACGACTCACTATAGGGA?TACCGTTACTGGTGGTGCAA
Be the primer of virulence gene pyrH (GenBank:JN039147.1) design, the amplified fragments size is about 173bp:
pyrH-F：AGGTGACACTATAGAATA?GACCGTATGGCACAAGAGGT
pyrH-R：GTACGACTCACTATAGGGA?CGCATAGCTAGGCCATTCAT
Be the primer of virulence gene toxRL (GenBank:EU727208.1) design, the amplified fragments size is about 180bp:
toxRL-F：AGGTGACACTATAGAATA?ACTACGACCATTGCCCAAAC
toxRL-R：GTACGACTCACTATAGGGA?TAGTGTTGAGCGCTCTGTGC
Be the primer of virulence gene rpoA (GenBank:AJ842695.1) design, the amplified fragments size is about 187bp:
rpoA-F：AGGTGACACTATAGAATA?ACGTGTTGAGCAGCGTACTG
rpoA-R：GTACGACTCACTATAGGGA?AATAGGATCGAACTCCGGCT
Be the primer of virulence gene recA (GenBank:AJ580887.1) design, the amplified fragments size is about 195bp:
recA-F：AGGTGACACTATAGAATA?ACCATGGACGTTGAAACCAT
recA-R：GTACGACTCACTATAGGGA?GGCATGTTCTGCATCGATAA。
Second purpose of the present invention provides executes the multiple virulence factor GeXP method for quick of Luo Shi vibrios (Vibrio shilonii), it is characterized in that, may further comprise the steps:
The genomic dna of Luo Shi vibrios (Vibrio shilonii) is executed in extraction, with it as template, carry out the multiplex PCR amplification with above-mentioned 13 pairs of polygene PCR primers and 1 pair of universal primer and obtain the multi-PRC reaction product, utilize GenomeLab GeXP genetic analysis systems that the multi-PRC reaction product is detected analysis.To corresponding PCR product, prove then that this executes the Luo Shi vibrios and have corresponding virulence gene if can increase.
The multiple virulence factor GeXP method for quick of Luo Shi vibrios (Vibrio shilonii) of executing of the present invention is for non-diagnostic purpose.
Described with the genomic dna of executing Luo Shi vibrios (Vibrio shilonii) as template, carrying out the multiplex PCR amplification with above-mentioned 13 pairs of polygene PCR primers and the 1 pair of universal primer, to obtain the multi-PRC reaction product be to execute the genomic dna of Luo Shi vibrios (Vibrio shilonii) as template, mix with above-mentioned 13 pairs of polygene PCR primer equal proportions, each primer final concentration is 0.2-2 μ M, add again universal primer pair, final concentration is 1-20 μ M, mix and be the primer premixed liquid, its reaction system and program are preferably: the PCR reaction system of 20 ~ 50 μ L, comprise: 10 * PCR Buffer, 2 ~ 5 μ L, 10mM dNTP1.6 ~ 4 μ L, TaqE 0.2 ~ 0.5 μ L of 5 Μ/μ L, primer premixed liquid 0.2 ~ 0.5 μ L, template DNA 0.8 ~ 2 μ L, ddH
2O15 ~ 37.5 μ L; Response procedures is: 94 ℃ of 3min; 94 ℃ of 30s, 59 ~ 62 ℃ of 50 ~ 60s, 72 ℃ of 100s, 25 ~ 35 circulations; 72 ℃ of 7min.
The present invention is directed to known 13 virulence genes of executing Luo Shi vibrios (Vibrio shilonii), the design Auele Specific Primer, utilize detection kit of the present invention, according to method of the present invention, can react by single tube, disposable quick, detect simultaneously efficiently 13 kinds of genes, and learn to detect whether to contain in sample or the environment and carry these virulence associated genes, what have potential pathogenecity executes Luo Shi vibrios (Vibrio shilonii), it detects broad covered area, can greatly improve the accuracy of executing Luo Shi vibrios (Vibrio shilonii) Evaluation of Pathogenicity, provide more efficiently detection means for executing Luo Shi vibrios (Vibrio shilonii) Evaluation of Pathogenicity, in the monitoring to coral polyp albefaction disease, preventing and treating the aspect is significant.
Description of drawings:
Fig. 1 is the detected result figure of embodiment 1;
Fig. 2 is the detected result figure of embodiment 2.
Embodiment:
Following examples are to further specify of the present invention, rather than limitation of the present invention.
Embodiment 1:
(1) extracts the genomic dna of executing Luo Shi vibrios (Vibrio shilonii)
At first the Luo Shi vibrios (Vibrio shilonii) of executing in the coral sample is carried out dull and stereotyped purifies and separates, cultivate again and execute Luo Shi vibrios (Vibrio shilonii).
1. in centrifuge tube, add the aseptic Chelex-100 solution of 50 μ L10% (w/v);
2. from executing on Luo Shi vibrios (Vibrio shilonii) culture plate, picking list bacterium colony is to above-mentioned Chelex-100 solution;
3. centrifuge tube is placed on and fully shakes 10s on the turbine mixer, boiling water bath 10min is cooled to room temperature, fully shakes 10s again;
4. the centrifugal 2min of 12000r/min, supernatant liquor is executes Luo Shi vibrios (Vibrio shilonii) genomic dna, places-20 ℃ of refrigerators for subsequent use.
(2) design of polygene PCR primer is with synthetic
Be the primer of virulence gene sod (NCBI Reference Sequence:NZ_ABCH01000140.1) design, the amplified fragments size is about 110bp:
sod-F：AGGTGACACTATAGAATA?CCGTTCATGTAGTCTGGACG
sod-R：GTACGACTCACTATAGGGA?GCAGCGACTCCACTAACAGA
Be the primer of virulence gene fldA (NCBI Reference Sequence:NZ_ABCH01000151.1) design, the amplified fragments size is about 117bp:
fldA-F：AGGTGACACTATAGAATA?ACGTGACATCGTTGAAGCAA
fldA-R：GTACGACTCACTATAGGGA?AGGCCAACGAATTGTGACTC
Be the primer of virulence gene ompUL (GenBank:EU727214.1) design, the amplified fragments size is about 124bp:
ompUL-F：AGGTGACACTATAGAATA?TTGGTGCGGGTTATCAGCTA
ompUL-R：GTACGACTCACTATAGGGA?CGAATACGGTCTGTTAGGTCG
Be the primer of virulence gene toxS (GenBank:EU727211.1) design, the amplified fragments size is about 131bp:
toxS-F：AGGTGACACTATAGAATA?CGCGGATATATTCACCACCT
toxS-R：GTACGACTCACTATAGGGA?CAATGAATGGCAATCCAACA
Be the primer of virulence gene Bcp (NCBI Reference Sequence:NZ_ABCH01000011.1) design, the amplified fragments size is about 138bp:
Bcp-F：AGGTGACACTATAGAATA?AACGTTGTGAGCGTCAAGC
Bcp-R：GTACGACTCACTATAGGGA?GGCAACACCGTCACACTACA
Be the primer of virulence gene dnaJ (GenBank:AB263067.1) design, the clip size of amplification is about 145bp:
dnaJ-F：AGGTGACACTATAGAATA?ATTCGGTGATATCTTTGGCG
dnaJ-R：GTACGACTCACTATAGGGA?CTCAACGAGCGTTGGAACTT
Be the primer of virulence gene mshA (GenBank:NZ_ABCH01000011.1) design, the amplified fragments size is about 152bp:
mshA-F：AGGTGACACTATAGAATA?CTGAGCGACGGTTATCAACA
mshA-R：GTACGACTCACTATAGGGA?ATGGTCACGTTAGTTTGCCC
Be the primer of virulence gene z2z3 (GenBank:AF009900.1) design, the amplified fragments size is about 159bp:
z2z3-F：AGGTGACACTATAGAATA?CTCTCATTGGTTAGCCCTCG
z2z3-R：GTACGACTCACTATAGGGA?ATCATCGGAAGATCAGCGTC
Be the primer of virulence gene fimA (NCBI Reference Sequence:NZ_ABCH01000010.1) design, the amplified fragments size is about 166bp:
fimA-F：AGGTGACACTATAGAATA?AGCTGTGGTTGATTGGCTCT
fimA-R：GTACGACTCACTATAGGGA?TACCGTTACTGGTGGTGCAA
Be the primer of virulence gene pyrH (GenBank:JN039147.1) design, the amplified fragments size is about 173bp:
pyrH-F：AGGTGACACTATAGAATA?GACCGTATGGCACAAGAGGT
pyrH-R：GTACGACTCACTATAGGGA?CGCATAGCTAGGCCATTCAT
Be the primer of virulence gene toxRL (GenBank:EU727208.1) design, the amplified fragments size is about 180bp:
toxRL-F：AGGTGACACTATAGAATA?ACTACGACCATTGCCCAAAC
toxRL-R：GTACGACTCACTATAGGGA?TAGTGTTGAGCGCTCTGTGC
Be the primer of virulence gene rpoA (GenBank:AJ842695.1) design, the amplified fragments size is about 187bp:
rpoA-F：AGGTGACACTATAGAATA?ACGTGTTGAGCAGCGTACTG
rpoA-R：GTACGACTCACTATAGGGA?AATAGGATCGAACTCCGGCT
Be the primer of virulence gene recA (GenBank:AJ580887.1) design, the amplified fragments size is about 195bp:
recA-F：AGGTGACACTATAGAATA?ACCATGGACGTTGAAACCAT
recA-R：GTACGACTCACTATAGGGA?GGCATGTTCTGCATCGATAA
With the fluorescently-labeled universal primer sequence of CY5, technology is added to the CY5 fluorescent mark on the universal primer sequence routinely:
TY-F:5’-AGGTGACACTATAGAATA-3’
TY-B:5’-GTACGACTCACTATAGGGA-3’
(3) multiplex PCR amplification (XP-PCR)
With the genomic dna of executing Luo Shi vibrios (Vibrio shilonii) template as multi-PRC reaction, mix with above-mentioned 13 pairs of polygene PCR primer equal proportions, each primer final concentration is 0.2 μ M, add again universal primer pair, final concentration is 1 μ M, mixes to be the primer premixed liquid, prepares the PCR reaction system of 25 μ L, comprise: 10 * PCR Buffer, 2.5 μ L, 10mM dNTP 2 μ L, the TaqE 0.25 μ L of 5 Μ/μ L, primer premixed liquid 0.25 μ L, template DNA 1 μ L, ddH
2O19 μ L.
Behind the reactant mixing, be placed in the PCR instrument, increase by following reaction cycle:
Obtain the XP-PCR product.
(4) product detects
Utilize Beckman GenomeLab GeXP genetic analysis systems that the product of XP-PCR is detected analysis, concrete operations are as follows:
1. GeXP loading
A, preparation SLS/DSS mixed solution: get DSS 400 (mark-400 in the molecular weight), adds 80 times of volume SLS (sample-loading buffer, methane amide), shake 30S or for subsequent use with rifle head mixing 10 times at the vortex oscillator;
B adds 40 μ l SLS/DSS mixed solutions in each sample aperture, add 0.01 μ l XP-PCR product to GeXP sample panel (bubble not occurring) again, adds a dropstone wax oil and covers sample;
C, the dissociating buffer of adding 3/4 volume in damping fluid plate and sample plane corresponding aperture;
D enters Set Μ p program, and input sample name is specified the Freg-3 separation method to each sample, the GeXP analytical procedure of specify default, and sample brings into operation.
2. GeXP system operation program
A. adjust the GeXP system:
1 ' installs kapillary and gel.
2 ' is adjusted to 50 ° of C with capillary temperature.
3 ' according to the 0.4ml gel, repeats 3 patterns and carries out elementary flushing of pipeline.
4 ' carries out kapillary fills glue, repeats 3 times.
5 ' carries out light path focuses on.
6 ' monitoring instrument baseline is lower than 4000RF Μ.
B. input sample information:
1 ' input sample name.
2 ' to each sample appointment Freg-3 separation method, the GeXP analytical procedure of specify default.
3 ' preserves sample information.
The c.GeXP sample analysis:
1 ' uses the distilled water cleaning sink.
2 ' puts into sample plane and damping fluid plate.
3 ' the sample that brings into operation.
D. check the fragment analysis result:
1 ' opens snippet analysis module;
2 ' uses the rear result (Analyzed Data) of analysis to set up a new analysis (St μ dy).
3 ' sets filtration parameter in fragment list (Fragments) window, filter non-D4 dyestuff peak and other non-product peaks.
4 ' confirms that existing analytical results is correct.
5 ' checks the fragment analysis result.
6 ' reference standard collection of illustrative plates can sentence read result, each peak represents a gene, and the result has 13 peaks as shown in Figure 1 among Fig. 1, judge gene according to X-coordinate size nt numerical values recited, from left to right be respectively sod 110bp, fldA 117bp, ompUL 124bp, toxS 131bp, bcp 138bp, dnaJ 145bp, mshA 152bp, z2z3 159bp, fimA 166bp, pyrH 173bp, toxRL 180bp, rpoA 187bp, recA 195bp shows that thus sample executes the Luo Shi vibrios and contain this 13 virulence factors, and it is identical according to the virulence factor that ordinary method checks out that this result and the sample of present embodiment are executed the Luo Shi vibrios.As seen method provided by the present invention can detect 13 kinds of virulence factors executing Luo Shi vibrios (Vibrio shilonii) rapidly and accurately, and to execute Luo Shi vibrios (Vibrio shilonii) pathogenic thereby can estimate fast and accurately.
Embodiment 2:
(1) extracts the genomic dna of executing Luo Shi vibrios (Vibrio shilonii)
At first the Luo Shi vibrios (Vibrio shilonii) of executing in the coral sample is carried out dull and stereotyped purifies and separates, cultivate again and execute Luo Shi vibrios (Vibrio shilonii).
1. in centrifuge tube, add the aseptic Chelex-100 solution of 50 μ L 10% (w/v);
2. from executing on Luo Shi vibrios (Vibrio shilonii) culture plate, picking list bacterium colony is to above-mentioned Chelex-100 solution;
3. centrifuge tube is placed on and fully shakes 10s on the turbine mixer, boiling water bath 10min is cooled to room temperature, fully shakes 10s again;
4. the centrifugal 2min of 12000r/min, supernatant liquor is executes Luo Shi vibrios (Vibrio shilonii) genomic dna, places-20 ℃ of refrigerators for subsequent use.
(2) design of polygene PCR primer is with synthetic
Be the primer of virulence gene sod (NCBI Reference Sequence:NZ_ABCH01000140.1) design, the amplified fragments size is about 110bp:
sod-F：AGGTGACACTATAGAATA?CCGTTCATGTAGTCTGGACG
sod-R：GTACGACTCACTATAGGGA?GCAGCGACTCCACTAACAGA
Be the primer of virulence gene fldA (NCBI Reference Sequence:NZ_ABCH01000151.1) design, the amplified fragments size is about 117bp:
fldA-F：AGGTGACACTATAGAATA?ACGTGACATCGTTGAAGCAA
fldA-R：GTACGACTCACTATAGGGA?AGGCCAACGAATTGTGACTC
Be the primer of virulence gene ompUL (GenBank:EU727214.1) design, the amplified fragments size is about 124bp:
ompUL-F：AGGTGACACTATAGAATA?TTGGTGCGGGTTATCAGCTA
ompUL-R：GTACGACTCACTATAGGGA?CGAATACGGTCTGTTAGGTCG
Be the primer of virulence gene toxS (GenBank:EU727211.1) design, the amplified fragments size is about 131bp:
toxS-F：AGGTGACACTATAGAATA?CGCGGATATATTCACCACCT
toxS-R：GTACGACTCACTATAGGGA?CAATGAATGGCAATCCAACA
Be the primer of virulence gene Bcp (NCBI Reference Sequenc e:NZ_ABCH01000011.1) design, the amplified fragments size is about 138bp:
Bcp-F：AGGTGACACTATAGAATA?AACGTTGTGAGCGTCAAGC
Bcp-R：GTACGACTCACTATAGGGA?GGCAACACCGTCACACTACA
Be the primer of virulence gene dnaJ (GenBank:AB263067.1) design, the clip size of amplification is about 145bp:
dnaJ-F：AGGTGACACTATAGAATA?ATTCGGTGATATCTTTGGCG
dnaJ-R：GTACGACTCACTATAGGGA?CTCAACGAGCGTTGGAACTT
Be the primer of virulence gene mshA (GenBank:NZ_ABCH01000011.1) design, the amplified fragments size is about 152bp:
mshA-F：AGGTGACACTATAGAATA?CTGAGCGACGGTTATCAACA
mshA-R：GTACGACTCACTATAGGGA?ATGGTCACGTTAGTTTGCCC
Be the primer of virulence gene z2z3 (GenBank:AF009900.1) design, the amplified fragments size is about 159bp:
z2z3-F：AGGTGACACTATAGAATA?CTCTCATTGGTTAGCCCTCG
z2z3-R：GTACGACTCACTATAGGGA?ATCATCGGAAGATCAGCGTC
Be the primer of virulence gene fimA (NCBI Reference Sequence:NZ_ABCH01000010.1) design, the amplified fragments size is about 166bp:
fimA-F：AGGTGACACTATAGAATA?AGCTGTGGTTGATTGGCTCT
fimA-R：GTACGACTCACTATAGGGA?TACCGTTACTGGTGGTGCAA
Be the primer of virulence gene pyrH (GenBank:JN039147.1) design, the amplified fragments size is about 173bp:
pyrH-F：AGGTGACACTATAGAATA?GACCGTATGGCACAAGAGGT
pyrH-R：GTACGACTCACTATAGGGA?CGCATAGCTAGGCCATTCAT
Be the primer of virulence gene toxRL (GenBank:EU727208.1) design, the amplified fragments size is about 180bp:
toxRL-F：AGGTGACACTATAGAATA?ACTACGACCATTGCCCAAAC
toxRL-R：GTACGACTCACTATAGGGA?TAGTGTTGAGCGCTCTGTGC
Be the primer of virulence gene rpoA (GenBank:AJ842695.1) design, the amplified fragments size is about 187bp:
rpoA-F：AGGTGACACTATAGAATA?ACGTGTTGAGCAGCGTACTG
rpoA-R：GTACGACTCACTATAGGGA?AATAGGATCGAACTCCGGCT
Be the primer of virulence gene recA (GenBank:AJ580887.1) design, the amplified fragments size is about 195bp:
recA-F：AGGTGACACTATAGAATA?ACCATGGACGTTGAAACCAT
recA-R：GTACGACTCACTATAGGGA?GGCATGTTCTGCATCGATAA
With the fluorescently-labeled universal primer sequence of CY5, technology is added to the CY5 fluorescent mark on the universal primer sequence routinely:
TY-F:5’-AGGTGACACTATAGAATA-3’
TY-B:5’-GTACGACTCACTATAGGGA-3’
(3) multiplex PCR amplification (XP-PCR)
With the genomic dna of executing Luo Shi vibrios (Vibrio shilonii) template as multi-PRC reaction, mix with above-mentioned 13 pairs of polygene PCR primer equal proportions, each primer final concentration is 2 μ M, add again universal primer pair, final concentration is 20 μ M, mixes to be the primer premixed liquid, prepares the PCR reaction system of 25 μ L, comprise: 10 * PCR Buffer, 2.5 μ L, 10mM dNTP 2 μ L, the TaqE 0.25 μ L of 5 Μ/μ L, primer premixed liquid 0.25 μ L, template DNA 1 μ L, ddH
2O19 μ L.
Behind the reactant mixing, be placed in the PCR instrument, increase by following reaction cycle:
Obtain the XP-PCR product.
(4) product detects
Utilize Beckman GenomeLab GeXP genetic analysis systems that the product of XP-PCR is detected analysis, concrete operations are as follows:
The GeXP loading
A, preparation SLS/DSS mixed solution: get DSS 400 (mark-400 in the molecular weight), adds 80 times of volume SLS (sample-loading buffer, methane amide), shake 30S or for subsequent use with rifle head mixing 10 times at the vortex oscillator;
B adds 40 μ l SLS/DSS mixed solutions in each sample aperture, add 0.01 μ l XP-PCR product to GeXP sample panel (bubble not occurring) again, adds a dropstone wax oil and covers sample;
C, the dissociating buffer of adding 3/4 volume in damping fluid plate and sample plane corresponding aperture;
D enters Set Μ p program, and input sample name is specified the Freg-3 separation method to each sample, the GeXP analytical procedure of specify default, and sample brings into operation.
GeXP system operation program
A. adjust the GeXP system:
1 ' installs kapillary and gel.
2 ' is adjusted to 50 ° of C with capillary temperature.
3 ' according to the 0.4ml gel, repeats 3 patterns and carries out elementary flushing of pipeline.
4 ' carries out kapillary fills glue, repeats 3 times.
5 ' carries out light path focuses on.
6 ' monitoring instrument baseline is lower than 4000RF Μ.
B. input sample information:
1 ' input sample name.
2 ' to each sample appointment Freg-3 separation method, the GeXP analytical procedure of specify default.
3 ' preserves sample information.
The c.GeXP sample analysis:
1 ' uses the distilled water cleaning sink.
2 ' puts into sample plane and damping fluid plate.
3 ' the sample that brings into operation.
D. check the fragment analysis result:
1 ' opens snippet analysis module;
2 ' uses the rear result (Analyzed Data) of analysis to set up a new analysis (St μ dy).
3 ' sets filtration parameter in fragment list (Fragments) window, filter non-D4 dyestuff peak and other non-product peaks.
4 ' confirms that existing analytical results is correct.
5 ' checks the fragment analysis result.
6 ' reference standard collection of illustrative plates can sentence read result, each peak represents a gene, and the result has 13 peaks as shown in Figure 2 among Fig. 2, judge gene according to X-coordinate size nt numerical values recited, from left to right be respectively sod 110bp, fldA 117bp, ompUL 124bp, toxS 131bp, bcp 138bp, dnaJ 145bp, mshA 152bp, z2z3159bp, fimA 166bp, pyrH 173bp, toxRL 180bp, rpoA 187bp, recA 195bp shows that thus sample executes the Luo Shi vibrios and contain this 13 virulence factors, and it is identical according to the virulence factor that ordinary method checks out that this result and the sample of present embodiment are executed the Luo Shi vibrios.As seen method provided by the present invention can detect 13 kinds of virulence factors executing Luo Shi vibrios (Vibrio shilonii) rapidly and accurately, and to execute Luo Shi vibrios (Vibrio shilonii) pathogenic thereby can estimate fast and accurately.
Claims (4)
1. execute the multiple virulence factor GeXP quick detection kit of Luo Shi vibrios (Vibrio shilonii) for one kind, comprise the PCR reaction reagent, polygene PCR primer and GeXP multiplex amplification reaction reagent, it is characterized in that, described polygene PCR primer comprises 13 pairs of polygene PCR primers and a pair of universal primer, is specially:
Primer for virulence gene sod design
sod-F：AGGTGACACTATAGAATA?CCGTTCATGTAGTCTGGACG
sod-R：GTACGACTCACTATAGGGA?GCAGCGACTCCACTAACAGA
Primer for virulence gene fldA design
fldA-F：AGGTGACACTATAGAATA?ACGTGACATCGTTGAAGCAA
fldA-R：GTACGACTCACTATAGGGA?AGGCCAACGAATTGTGACTC
Primer for virulence gene ompUL design
ompUL-F：AGGTGACACTATAGAATA?TTGGTGCGGGTTATCAGCTA
ompUL-R：GTACGACTCACTATAGGGA?CGAATACGGTCTGTTAGGTCG
Primer for virulence gene toxS design
toxS-F：AGGTGACACTATAGAATA?CGCGGATATATTCACCACCT
toxS-R：GTACGACTCACTATAGGGA?CAATGAATGGCAATCCAACA
Primer for virulence gene Bcp design
Bcp-F：AGGTGACACTATAGAATA?AACGTTGTGAGCGTCAAGC
Bcp-R：GTACGACTCACTATAGGGA?GGCAACACCGTCACACTACA
Primer for virulence gene dnaJ design
dnaJ-F：AGGTGACACTATAGAATA?ATTCGGTGATATCTTTGGCG
dnaJ-R：GTACGACTCACTATAGGGA?CTCAACGAGCGTTGGAACTT
Primer for virulence gene mshA design
mshA-F：AGGTGACACTATAGAATA?CTGAGCGACGGTTATCAACA
mshA-R：GTACGACTCACTATAGGGA?ATGGTCACGTTAGTTTGCCC
Primer for virulence gene z2z3 design
z2z3-F：AGGTGACACTATAGAATA?CTCTCATTGGTTAGCCCTCG
z2z3-R：GTACGACTCACTATAGGGA?ATCATCGGAAGATCAGCGTC
Primer for virulence gene fimA design
fimA-F：AGGTGACACTATAGAATA?AGCTGTGGTTGATTGGCTCT
fimA-R：GTACGACTCACTATAGGGA?TACCGTTACTGGTGGTGCAA
Primer for virulence gene pyrH design
pyrH-F：AGGTGACACTATAGAATA?GACCGTATGGCACAAGAGGT
pyrH-R：GTACGACTCACTATAGGGA?CGCATAGCTAGGCCATTCAT
Primer for virulence gene toxRL design
toxRL-F：AGGTGACACTATAGAATA?ACTACGACCATTGCCCAAAC
toxRL-R：GTACGACTCACTATAGGGA?TAGTGTTGAGCGCTCTGTGC
Primer for virulence gene rpoA design
rpoA-F：AGGTGACACTATAGAATA?ACGTGTTGAGCAGCGTACTG
rpoA-R：GTACGACTCACTATAGGGA?AATAGGATCGAACTCCGGCT
Primer for virulence gene recA design
recA-F：AGGTGACACTATAGAATA?ACCATGGACGTTGAAACCAT
recA-R：GTACGACTCACTATAGGGA?GGCATGTTCTGCATCGATAA
Contain fluorescently-labeled universal primer to sequence, technology is added to fluorescent mark on the universal primer sequence routinely:
TY-F:5’-AGGTGACACTATAGAATA-3’
TY-B:5’-GTACGACTCACTATAGGGA-3’。
2. the multiple virulence factor GeXP quick detection kit of Luo Shi vibrios (Vibrio shilonii) of executing according to claim 1, its spy is being that described fluorescent mark is the CY5 fluorescent mark.
3. execute the multiple virulence factor GeXP method for quick of Luo Shi vibrios (Vibrio shilonii) for one kind, it is characterized in that, may further comprise the steps: extract the genomic dna of executing Luo Shi vibrios (Vibrio shilonii), with it as template, carry out the multiplex PCR amplification with 13 pairs of polygene PCR primers claimed in claim 1 and a pair of universal primer and obtain the multi-PRC reaction product, utilize GenomeLab GeXP genetic analysis systems that the multi-PRC reaction product is detected analysis.
4. the multiple virulence factor GeXP method for quick of Luo Shi vibrios (Vibrio shilonii) of executing as claimed in claim 3, it is characterized in that, described with the genomic dna of executing Luo Shi vibrios (Vibrio shilonii) as template, carrying out multiplex PCR amplification with 13 pairs of polygene PCR primers claimed in claim 1 and a pair of universal primer, to obtain the multi-PRC reaction product be to execute the genomic dna of Luo Shi vibrios (Vibrio shilonii) as template, mix with 13 pairs of polygene PCR primer equal proportions claimed in claim 1, each primer final concentration is 0.2 ~ 2 μ M, add again universal primer pair, final concentration is 1-20 μ M, mix and be the primer premixed liquid, multi-PRC reaction system and program are: the PCR reaction system of 20 ~ 50 μ L, comprise: 10 * PCR Buffer, 2 ~ 5 μ L, 10mM dNTP 1.6 ~ 4 μ L, TaqE 0.2 ~ 0.5 μ L of 5 Μ/μ L, primer premixed liquid 0.2 ~ 0.5 μ L, template DNA 0.8 ~ 2 μ L, ddH
2O 15 ~ 37.5 μ L; Response procedures is: 94 ℃ of 3min; 94 ℃ of 30s, 59 ~ 62 ℃ of 50 ~ 60s, 72 ℃ of 100s, 25 ~ 35 circulations; 72 ℃ of 7min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210328551.1A CN102899402B (en) | 2012-09-06 | 2012-09-06 | Vibrio shilonii multiple virulence factor GeXP rapid detection kit and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210328551.1A CN102899402B (en) | 2012-09-06 | 2012-09-06 | Vibrio shilonii multiple virulence factor GeXP rapid detection kit and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102899402A true CN102899402A (en) | 2013-01-30 |
| CN102899402B CN102899402B (en) | 2014-08-27 |
Family
ID=47571888
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210328551.1A Active CN102899402B (en) | 2012-09-06 | 2012-09-06 | Vibrio shilonii multiple virulence factor GeXP rapid detection kit and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102899402B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789694A (en) * | 2014-09-15 | 2015-07-22 | 中国农业科学院兰州兽医研究所 | Vesicular disease detection kit |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104195268B (en) * | 2014-09-15 | 2016-03-30 | 中国农业科学院兰州兽医研究所 | Detect test kit and the preparation method of foot and mouth disease A type, O type and Asia 1 C-type virus C |
-
2012
- 2012-09-06 CN CN201210328551.1A patent/CN102899402B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| BAI，F等: "登录号：EU240944.1", 《GENBANK》 * |
| LEAH RESHEF等: "Genome analysis of the coral bleaching pathogen Vibrio shiloi", 《ARCH MICROBIOL》 * |
| 辛瑞晓等: "哈维氏弧菌铁超氧化物歧化酶基因表达及免疫作用研究", 《水生生物学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789694A (en) * | 2014-09-15 | 2015-07-22 | 中国农业科学院兰州兽医研究所 | Vesicular disease detection kit |
| CN104789694B (en) * | 2014-09-15 | 2017-05-17 | 中国农业科学院兰州兽医研究所 | Vesicular disease detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102899402B (en) | 2014-08-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Feinstein et al. | Assessment of bias associated with incomplete extraction of microbial DNA from soil | |
| Hoffmann et al. | Riems influenza a typing array (RITA): An RT-qPCR-based low density array for subtyping avian and mammalian influenza a viruses | |
| Baran et al. | Quantification of diverse virus populations in the environment using the polony method | |
| Montmayeur et al. | High-throughput next-generation sequencing of polioviruses | |
| JP7013490B2 (en) | Validation methods and systems for sequence variant calls | |
| Stewart et al. | A multi-species TaqMan PCR assay for the identification of Asian gypsy moths (Lymantria spp.) and other invasive lymantriines of biosecurity concern to North America | |
| CN104046700A (en) | Detection kit for quickly identifying donkey skin, horse skin and mule skin | |
| Shaffer et al. | A comparison of six DNA extraction protocols for 16S, ITS and shotgun metagenomic sequencing of microbial communities | |
| Carleton et al. | Metagenomic approaches for public health surveillance of foodborne infections: opportunities and challenges | |
| CN102605106A (en) | Triple-fluorescence PCR (Polymerase Chain Reaction) detection method and kit for Nosema bombycis (Nb), Bombyx mori Nuclear Polyhedrosis Virus (BmNPV) and Bombyx mori Densovirus (BmDNV), as well as primers and probes | |
| CN108342507A (en) | HBV nucleic acid quantification detecting systems based on microlayer model digital pcr technology | |
| Chiu et al. | Next‐generation sequencing | |
| CN111349719A (en) | Specific primer for detecting novel coronavirus and rapid detection method | |
| Liu et al. | Assessment of two‐pool multiplex long‐amplicon nanopore sequencing of SARS‐CoV‐2 | |
| CN105132581A (en) | Genetically modified rice PA110-15 transformant specificity quantitative PCR detection primer | |
| Huang et al. | A novel multiplex assay system based on 10 methylation markers for forensic identification of body fluids | |
| CN102899402B (en) | Vibrio shilonii multiple virulence factor GeXP rapid detection kit and detection method thereof | |
| Canale et al. | The time is now for ubiquitous forensic mtMPS analysis | |
| CN102559889B (en) | Rapid detection kit and detection method for v.parahaemolyticus multiple virulence factor GeXP | |
| CN101899531B (en) | Primer and method for detecting human influenza A virus H1 and/or H3 subtype | |
| CN112725475A (en) | Mycobacterium tuberculosis detection primer, probe composition, kit and application | |
| CN102899412B (en) | Rapid detection kit and detection method for multiple virulence factor GeXP of vibrio coralliilyticus | |
| Fomsgaard et al. | Improvements in metagenomic virus detection by simple pretreatment methods | |
| CN105154572A (en) | Specific 5'-terminal quantitative PCR (polymerase chain reaction) detection primers for transgenic rice PA110-15 line | |
| Saeed et al. | Real-time polymerase chain reaction: applications in diagnostic microbiology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |