CN102892779A - Neuregulin antagonists and use thereof in treating cancer - Google Patents

Neuregulin antagonists and use thereof in treating cancer Download PDF

Info

Publication number
CN102892779A
CN102892779A CN2011800099223A CN201180009922A CN102892779A CN 102892779 A CN102892779 A CN 102892779A CN 2011800099223 A CN2011800099223 A CN 2011800099223A CN 201180009922 A CN201180009922 A CN 201180009922A CN 102892779 A CN102892779 A CN 102892779A
Authority
CN
China
Prior art keywords
antibody
cell
cancer
nrg
nrg1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN2011800099223A
Other languages
Chinese (zh)
Other versions
CN102892779B (en
Inventor
E.杰克森
E.A.斯维特-柯德罗
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genentech Inc
Leland Stanford Junior University
Original Assignee
Genentech Inc
Leland Stanford Junior University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genentech Inc, Leland Stanford Junior University filed Critical Genentech Inc
Publication of CN102892779A publication Critical patent/CN102892779A/en
Application granted granted Critical
Publication of CN102892779B publication Critical patent/CN102892779B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/4756—Neuregulins, i.e. p185erbB2 ligands, glial growth factor, heregulin, ARIA, neu differentiation factor
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/531—Stem-loop; Hairpin

Abstract

The invention provides neuregulin antagonists and methods of using the neuregulin antagonists in delaying the time to tumor recurrence or preventing resistence of cancer cells to treatment with a therapeutic agent.

Description

Neuregulin antagonist and the purposes in the treatment cancer thereof
Cross reference to related application
The application requires the rights and interests of the U.S. Provisional Application No.61/305878 that submits on February 18th, 2010, by mentioning by the complete income this paper of its disclosure.
Invention field
The present invention relates to by neuregulin antagonist for treating cancer.
Background of invention
The identity of cancer stem cell (CSC) and characteristic have been fields of strong research in the several years recently.Tumour be have the different biological characteristic cell heterogeneous mixture evidence the accumulation.Many haematological malignancieses have been reported separating of distinct cell colony with the unique ability that starts tumor growth with solid tumor.Yet, in use specific cells surface marker is expectedly identified CSC, discordance appears.For example, to leukemia, pancreas, colorectum, brain and mammary cancer, reported the discovery about the fundamental difference of stem Cell Phenotypic (summary is shown in Brennan and Matsui 2009).In addition, the estimation of CSC frequency noticeable change in tumor type and patient.CSC effect in primary or distant site are restarted tumour in the growth that maintains built vertical tumour or after chemotherapy still has to be determined.
For most of cancer patientss, the palindromia after chemotherapy is a dead major cause.Thereby, need to understand better the tumour that causes recurrence and restart cell (TRIC) to treat better in initial response chemotherapy processing by the patient who goes through cancer return.This is correlated with especially for nonsmall-cell lung cancer (NSCLC), because be greater than 2/3rds NSCLC patient, is not the candidate of excision.Most patients presents with terminal illness, and with the combined therapy (Lung Cancer Principles and Practice) of chemotherapy, radiation or two kinds.Yet although, good to the initial response for the treatment of, 5 annual survival rates of local terminal illness are still 23.7%, and be 3.5% SEER such as () Horner for terminal illness.
Shown that the de-adjusting (deregulation) via the EGFR signal conduction of crossing expression or activated mutant is the frequent event (summary is shown in Dahabreh etc., 2010) in NSCLC.EGFR is the prototype member of HER family tyrosine kinase, and this family comprises EGFR (Her1), Her2, Her3 and Her4.Her2 lacks functional ligand binding domain (Graus-Porta 1997), and Her3 lacks tyrosine kinase activity (Guy 1994), so these acceptors must work with heterodimer.Nearest evidence has shown that other Her family member also can play a role in NSCLC.Yet they are not too fully to characterize to the contribution of disease, and research often focuses on itself and the interaction (Kuyama etc. 2008, and Hirsch 2009, and Zhou 2006, and Johnson 2006, and Ding 2008) of EGFR activation.
Neuregulin is a kind of part of Her3 and Her4 receptor tyrosine kinase.There are 4 kinds of known members in neuregulin family, i.e. NRG1, NRG2, NRG3 and NRG4 (Falls 2003).The NRG1 transcript experiences alternative splicing widely, generates at least 15 kinds of different isoforms.All active isoforms are shared for active essential and enough EGF sample territories (Holmes 1992, and Yarden 1991).Shown NRG1 autocrine signal conduction adjusting pulmonary epithelial cells propagation (Jinbo 2002), and in people's lung development, play a role (Patel 2000), and involve the insensitivity (Zhou2006) of NSCLC to the EGFR inhibitor.
Need to be provided at effective therapeutical agent in the patient who treats the resistance cancer and experienced cancer return.
Summary of the invention
One aspect of the present invention provides the method for the front time of tumor recurrence in a kind of cancer patients of prolongation, comprises the neuregulin antagonist of described patient being used to significant quantity.In one embodiment, the method further comprises the agent of described patient's administering therapeutic.In one embodiment, therapeutical agent is chemotherapeutic or antibody.In certain embodiments, chemotherapeutic is the combination of Taxol (paclitaxal) or cis-platinum or Taxol and cis-platinum.
In certain embodiments, antibody is EGFR, HER2, HER3 or HER4 antibody.In certain embodiments, the cancer that the patient suffers from is nonsmall-cell lung cancer, mammary cancer, ovarian cancer, head and neck cancer, cervical cancer, bladder cancer, the esophageal carcinoma, prostate cancer or colorectal carcinoma.
In one embodiment, before tumor recurrence the prolongation of time than the recurrence in the situation that there is no described neuregulin antagonist before at least 1.25 times greatly of times.In one embodiment, before tumor recurrence the prolongation of time than the recurrence in the situation that there is no described neuregulin antagonist before at least 1.50 times greatly of times.
In certain embodiments, the neuregulin antagonist is antibody, small molecules, immunoadhesin or RNA.In one embodiment, the neuregulin antagonist is the NRG1 antagonist.In one embodiment, the NRG antagonist is anti-NRG1 antibody.
The accompanying drawing summary
Fig. 1: the diagram of restarting the body inner model of cell (TRIC) for studying tumour.
Fig. 2 A: the Calu3 people NSCLC xenograft models in nude mouse, wherein chemotherapy is comprised of Taxol and cis-platinum.Data present with average gross tumor volume ± SEM, n=12 mouse/group.
Fig. 2 B: the H441 people NSCLC xenograft models in nude mouse, wherein chemotherapy is comprised of Taxol and cis-platinum.Data present with average gross tumor volume ± SEM, n=12 mouse/group.
Fig. 2 C: have the KPL4 human breast model of tumour cell to the homotopic transplantation of SCID/beiz mouse mammary fat pad, wherein chemotherapy is comprised of Taxol.Data present with average gross tumor volume ± SEM, n=12 mouse/group.
Fig. 2 D: use cisplatin treated K-ras lSLG12D, CAG-LSL-GFP genetic engineering mouse NSCLC model.Data present with the mean number ± SEM of the GFP positive cell of each lung, n=6 mouse/group.
Fig. 3 A: by two kinds in microarray analysis independently probe proof NRG1mRNA enrichments in the TRIC of Calu3 xenograft models.Use the RNA from independently tumor sample separates to verify enrichment by the quantitative PCR in real time (qPCR) for NRG1a and NRG1b.
Fig. 3 B: the enrichment of NRG1mRNA in the TRIC of H441 xenograft models shown by two kinds of different micro probe arrays.This uses the RNA from the identical tumor sample for microarray analysis to verify by the qPCR for NRG1a and NRG1b.
Fig. 3 C: the enrichment of NRG1mRNA in the TRIC of KPL4 mammary cancer xenograft models shown by two kinds of different micro probe arrays.
Fig. 3 D: by a kind of micro probe array show and the NRG1mRNA that verifies by qPCR at K-ras lSLG12Denrichment in the TRIC of mouse NSCLC model.
Fig. 4: the NRG1 enrichment is special for residual cell, as the qPCR analytical proof of the tumour cell NRG1mRNA level by each size and the tumour of time after chemotherapy.
Fig. 5 A: figure has shown in the tap water random at it tumor growth curve of mouse of using the Calu3-shNRG1 heterograft tumour that having of vehicle (sucrose) or dox (2gm/L) set up.Gross tumor volume is measured to twice in one week, continue whole research.Data are with linear hybrid effect (Linear Mixed Effect, LME) matching that model produces gross tumor volume presents, and as having the cubic spline (cubic splines) of automatically determining knot (auto-determined knot), draws.
Fig. 5 B: figure has shown the tumor growth curve of the mouse with Calu3-shNRG1 heterograft tumour of having set up of processing with chemotherapy+sucrose or chemotherapy+dox.The matching that data produce gross tumor volume with the LME model presents, and as having the cubic spline of automatically determining knot, draws.
Fig. 6 A: figure has shown the tumor growth curve (n=12/group) of the mouse with H441-shNRG1 heterograft tumour of having set up of processing with sucrose or dox.Data present with the LME Fitting Analysis of gross tumor volume, as having the cubic spline of automatically determining knot, draw.
Fig. 6 B: figure has shown the tumor growth curve (n=12/group) of the mouse with H441-shNRG1 heterograft tumour of having set up of processing with chemotherapy+sucrose or chemotherapy+dox.Data present with the LME Fitting Analysis of gross tumor volume, as having the cubic spline of automatically determining knot, draw.
Fig. 7 A: figure has shown the tumor growth curve (n=12 mouse/group) of the mouse with H1299-shNRG1 heterograft tumour of having set up of processing with sucrose or dox.Data present with the LME Fitting Analysis of gross tumor volume, as having the cubic spline of automatically determining knot, draw.
Fig. 7 B: figure has shown the tumor growth curve (n=12/group) of the mouse with H1299-shNRG1 heterograft tumour of having set up of processing with chemotherapy+sucrose or chemotherapy+dox.Data present with the LME Fitting Analysis of gross tumor volume, as having the cubic spline of automatically determining knot, draw.
Fig. 8 A: figure has shown the LSL-K-ras processed with vehicle+contrast IgG (n=6), cis-platinum+contrast IgG (n=6) or cis-platinum+HER4ECD-Fc (n=8) g12D; P53 fl/+the mean tumour volume +/-SEM of mouse.Artemisiifolia, contrast mouse IgG2a antibody.
Fig. 8 B: figure has shown that multiple every day of the tumor load obtained by treatment plan changes and 95% fiducial interval.
Fig. 8 C: figure has shown the LSL-K-ras processed with vehicle+contrast IgG (n=10), cis-platinum+contrast IgG (n=11), cis-platinum+HER4-ECD (n=8) or vehicle+HER4-ECD (n=7) g12D; P53 fl/Flaverage percent variation ± the SEM of the tumor load from baseline of mouse.
Detailed Description Of The Invention
I. definition
For purpose herein, " acceptor people framework " refers to comprise the framework from the aminoacid sequence of human normal immunoglobulin framework or light chain variable territory (VL) framework as derivative as the total framework of people of hereinafter definition or heavy chain variable domain (VH) framework.The acceptor people framework " derive " from the total framework of human normal immunoglobulin framework or people can comprise its identical aminoacid sequence, or it can contain the aminoacid sequence variation.In some embodiments, the number that amino acid changes be 10 or still less, 9 or still less, 8 or still less, 7 or still less, 6 or still less, 5 or still less, 4 or still less, 3 or still less or 2 or still less.In some embodiments, VL acceptor people framework is identical on sequence with VL human normal immunoglobulin Frame sequence or the total Frame sequence of people.
" avidity " for example refers to, for example, between the single binding site of molecule (antibody) and its binding partners (antigen) all intensity of noncovalent interaction summations.Unless otherwise directed, as used in this article, " binding affinity " refers to that reflection for example, in conjunction with the interactional inherent binding affinity of 1:1 between right member (antibody and antigen).Molecule X can explain with dissociation constant (Kd) usually to the avidity of its mating partner Y.The common method that avidity can be known by this area is measured, and comprises method described herein.Specific description for measuring binding affinity and exemplary embodiment have hereinafter been described.
" affinity maturation " antibody refers to have the antibody of a place or many places change in one or more hypervariable regions (HVR), with the parental antibody that does not have this type of change, compares, and this type of change causes this antibody to improve the avidity of antigen.
Term " anti-NRG antibody " and " in conjunction with the antibody of NRG " refer to can be with enough avidity in conjunction with NRG, makes antibody can be used as diagnosis in target NRG and/or the antibody of therapeutical agent.In one embodiment, anti-NRG antibody to irrelevant, combination degree non-NRG albumen be antibody to the combination of NRG be less than approximately 10%, as for example measured by radioimmunoassay (RIA).In certain embodiments, have≤1 μ M of the antibody in conjunction with NRG ,≤100nM ,≤10nM ,≤1nM ,≤0.1nM ,≤0.01nM or≤0.001nM(for example 10 -8m or still less, for example 10 -8m to 10 -13m, for example 10 -9m to 10 -13m) dissociation constant (Kd).In certain embodiments, conservative NRG epi-position between the NRG of anti-NRG antibodies from different plant species.
Term herein " antibody " is used with broad sense, and contain various antibody structures, include but not limited to monoclonal antibody, polyclonal antibody, multi-specificity antibody (for example bi-specific antibody) and antibody fragment, as long as they show the antigen-binding activity of expectation.
" antibody fragment " refers to the molecule different from complete antibody, and it comprises in complete antibody the part in conjunction with the antigen of complete antibody combination.The example of antibody fragment includes but not limited to Fv, Fab, Fab ', Fab '-SH, F (ab ') 2; Double antibody; Linear antibody; Single-chain antibody molecule (for example scFv); With the multi-specificity antibody formed by antibody fragment.
With reference antibody " in conjunction with the antibody of identical epi-position " refer in competition assay with reference to antibody to its antigen in conjunction with blocking-up 50% or more antibody, and contrary, with reference to antibody in competition assay by this antibody to its antigen in conjunction with blocking-up 50% or more.Exemplary competition assay is provided herein.
Term " chimeric " antibody refers to that the part of weight wherein and/or light chain is derivative from specific source or species, and the remainder of heavy and/or light chain is from different sources or the derivative antibody of species.
Term " cancer " and " carcinous " refer to or describe feature in Mammals be generally the not modulated physiological situation of Growth of Cells/propagation.The example of cancer includes but not limited to cancer knurl, lymphoma (for example, He Jiejin (Hodgkin) family name and non_hodgkin lymphoma), blastoma, sarcoma and leukemia.The example more specifically of this type of cancer comprises squamous cell carcinoma, small cell lung cancer, nonsmall-cell lung cancer, the gland cancer of lung, the squama cancer of lung, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, carcinoma of the pancreas, glioma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma (hepatoma), mammary cancer, colorectal carcinoma, colorectal carcinoma, carcinoma of endometrium or uterus carcinoma, salivary-gland carcinoma, kidney, liver cancer, prostate cancer, carcinoma vulvae, thyroid carcinoma, liver cancer (hepatic carcinoma), leukemia and other lymphocytic hyperplasia venereal disease disease, with various types of heads and neck cancer.
" class " of antibody refers to constant domain that its heavy chain has or the type of constant region.Antibody has 5 large class: IgA, IgD, IgE, IgG and IgM, and several in these can further be divided into subclass (isotype), for example, and IgG 1, IgG 2, IgG 3, IgG 4, IgA 1, and IgA 2.The heavy chain constant domain corresponding with the inhomogeneity immunoglobulin (Ig) is called respectively α, δ, ε, γ and μ.
As used herein, term " cytotoxic agent " refers to suppress or stop cell function and/or cause necrocytosis or the material of destruction.Cytotoxic agent includes but not limited to: radio isotope (At for example 211, I 131, I 125, Y 90, Re 186, Re 188, Sm 153, Bi 212, P 32, Pb 212radio isotope with Lu); Chemotherapeutic or medicine (for example methotrexate (methotrexate), Zorubicin (adriamycin), vinca alkaloids (vinca alkaloids) (vincristine(VCR) (vincristine), vinealeucoblastine(VLB) (vinblastine), Etoposide (etoposide)), Dx (doxorubicin), melphalan (melphalan), mitomycin (mitomycin) C, Chlorambucil (chlorambucil), daunorubicin (daunorubicin) or other intercalator); Growth inhibitor; Enzyme and fragment thereof, such as nucleolytic enzyme; Microbiotic; Toxin, the enzyme activity toxin such as small molecules toxin or bacterium, fungi, plant or animal origin, comprise its fragment and/or variant; Reach hereinafter disclosed various antitumor or carcinostatic agent.
" effector functions " refers to the biologic activity that those are attributable to the antibody Fc district and change with antibody isotype.The example of antibody mediated effect device function comprises: C1q combination and CDC (CDC); The Fc receptors bind; The cytotoxicity (ADCC) of antibody dependent cellular mediation; Phagolysis; Cell surface receptor (for example B-cell receptor) is lowered; With the B cell activation.
" significant quantity " of medicament (for example pharmaceutical formulation) refers at essential dosage and effectively realizes the treatment of expectation on the period or the amount of prevention result.
Term herein " Fc district " at least contains the C petiolarea of a constant region part for defining heavy chain immunoglobulin.This term comprises native sequences Fc district and variant Fc district.In one embodiment, human IgG heavy chain Fc district is from Cys226, or extends to the carboxyl terminal of heavy chain from Pro230.Yet the C end Methionin (Lys447) in Fc district can exist or not exist.Unless regulation separately arranged herein, the numbering of the amino-acid residue in Fc district or constant region is according to the EU numbering system, be called again the EU index, as be recorded in Kabat etc., Sequences of Proteins of Immunological Interest, the 5th edition Public Health Service, National Institutes of Health, Bethesda, MD, 1991.
" framework " or " FR " refers to the variable domain residue except hypervariable region (HVR) residue.Usually, the FR of variable domain is comprised of 4 FR territories: FR1, FR2, FR3 and FR4.Thereby HVR and FR sequence are at VH(or VL) in generally with following order, occur: FR1-H1 (L1)-FR2-H2 (L2)-FR3-H3 (L3)-FR4.
Term " full length antibody ", " complete antibody " and " whole antibody " are used interchangeably in this article, refer to have substantially similar structure with the natural antibody structure or have contain the antibody of the heavy chain in Fc district as defined herein.
Term " host cell ", " host cell system " and " host cell culture " are used interchangeably, and refer to import the cell of exogenous nucleic acid, comprise the offspring of this type of cell.Host cell comprises " transformant " and " cell through transforming ", and it comprises that the primary cell through transforming reaches derivative offspring from it and do not consider the number of times gone down to posterity.The offspring can be incomplete same with parental cell on nucleic acid content, but can contain sudden change.Comprise herein and having and screening in the initial conversion cell or the identical function of selecting or the mutant offspring of biologic activity.
" people's antibody " refer to have with by antibody people or people's Hemapoiesis or the aminoacid sequence that aminoacid sequence that utilize people's antibody complete or collected works or other people's antibody coding sequence derivative antibody from inhuman source is corresponding.This definition clear-cut of people's antibody is got rid of and is comprised the humanized antibody of non-human antigen in conjunction with residue.
" people has framework " refers to the framework of the amino-acid residue the most often existed in table human normal immunoglobulin VL or VH Frame sequence selected works.Usually, human normal immunoglobulin VL or VH sequence selected works are from variable domain sequence subgroup.Usually, the sequence subgroup is as Kabat etc., Sequences of Proteins of Immunological Interest, the 5th edition, NIH Publication 91-3242, Bethesda MD (1991), the subgroup in the 1-3 volume.In one embodiment, for VL, subgroup is as Kabat etc., the subgroup κ I in seeing above.In one embodiment, for VH, subgroup is as Kabat etc., the subgroup III in seeing above.
" humanization " antibody refers to comprise from the amino-acid residue of inhuman HVR with from the chimeric antibody of the amino-acid residue of people FR.In certain embodiments, humanized antibody can comprise at least one, and common two whole variable domains basically are wherein all or all HVR(are for example basically, CDR) corresponding to those of non-human antibody, and all or basically all FR corresponding to those of people's antibody.Optionally, humanized antibody can at least comprise the part of the antibody constant region derivative from people's antibody.Antibody, for example non-human antibody " humanization form " refers to experience humanized antibody.
As used herein, term " hypervariable region " or " HVR " refer in antibody variable domains hypermutation on sequence and/or each district that form the fixed ring (" hypermutation ring ") of ceiling structure.Usually, 4 natural chain antibodies comprise 6 HVR; Three in VH (H1, H2, H3), and three in VL (L1, L2, L3).HVR generally comprise from the hypermutation ring and/or from " complementary determining region " amino-acid residue (CDR), rear a kind of be the highest serial variability and/or involve antigen recognition.Exemplary hypermutation ring is present in amino-acid residue 26-32 (L1), 50-52 (L2), 91-96 (L3), 26-32 (H1), 53-55 (H2) and 96-101 (H3).(Chothia and Lesk, J.Mol.Biol.196:901-917 (1987)).Exemplary CDR (CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2 and CDR-H3) is present in the 50-65 of 31-35B, H2 of 89-97, H1 of 50-56, L3 of amino-acid residue 24-34, L2 of L1 and the 95-102 (Kabat etc. of H3, Sequences of Proteins of Immunological Interest, the 5th edition Public Health Service, National Institutes of Health, Bethesda, MD (1991)).CDR1 in VH, CDR generally comprises the amino-acid residue that forms the hypermutation ring.CDR also comprises " specificity decision residue ", or " SDR ", and it is the residue of contact antigen.SDR be included in be called shortening-CDR, or in the CDR district of a-CDR.Exemplary a-CDR (a-CDR-L1, a-CDR-L2, a-CDR-L3, a-CDR-H1, a-CDR-H2 and a-CDR-H3) is present in the 50-58 of 31-35B, H2 of 89-96, H1 of 50-55, L3 of amino-acid residue 31-34, L2 of L1 and the 95-102 (seeing Almagro and Fransson, Front.Biosci.13:1619-1633 (2008)) of H3.Unless otherwise directed, the HVR residue in variable domain and other residue (for example, the FR residue) are in this article according to Kabat etc., and numbering sees above.
" immunoconjugates " refers to and one or more heterologous molecule, includes but not limited to the antibody that cytotoxic agent is puted together.
" individuality " or " experimenter " or " patient " are Mammalss.Mammals includes but not limited to animal (for example, ox, sheep, cat, dog and horse), primates (for example, people and non-human primates are such as monkey), rabbit and the rodents (for example, Mouse and rat) raised and train.In certain embodiments, individuality, experimenter or patient are the people.
" separation " antibody refers to the antibody separated with the component of its natural surroundings.In some embodiments, antibody purification is to the purity that is greater than 95% or 99%, as what for example, for example, measure by for example electrophoresis (, SDS-PAGE, isoelectrofocusing (IEF), capillary electrophoresis) or chromatography (, ion-exchange or reversed-phase HPLC).About the summary of the method for assessment of antibody purity, see such as Flatman etc., J.Chromatogr.B 848:79-87 (2007).
" separation " nucleic acid refers to the nucleic acid molecule separated with the component of its natural surroundings.The nucleic acid separated comprises the nucleic acid molecule contained in the cell that usually contains nucleic acid molecule, but nucleic acid molecule exists outside karyomit(e) or at the chromosome position place different from its natural dyeing body position.
" nucleic acid of the separation of the anti-NRG antibody of encoding " refers to that encoding antibody weighs and one or more nucleic acid molecule of light chain (or its fragment), comprise this type of nucleic acid molecule in single carrier or different carriers, and be present in this type of nucleic acid molecule of the one or more positions in host cell.
As used herein, term " monoclonal antibody " refers to from a group antibody that the antibody of homogeneity obtains basically, each antibody that forms colony is identical and/or in conjunction with identical epi-position, except the possible variant antibody that for example contains naturally occurring sudden change or occur between the generation of monoclonal antibody prepared product, this type of variant generally exists with indivisible.From the polyclonal antibody prepared product difference usually comprised for the different antibodies of different determinants (epi-position), every kind of monoclonal antibody of monoclonal antibody prepared product is for the single determinant on antigen.So, modifier " mono-clonal " indication antibody, from a group characteristic that the antibody of homogeneity obtains basically, requires to generate antibody by any ad hoc approach and should not be construed as.For example, can generate the monoclonal antibody that will use according to the present invention by multiple technologies, include but not limited to the method for the transgenic animal that hybridoma method, recombinant DNA method, phage display method and utilization contain all or part human immunoglobulin gene seat, described these class methods and other exemplary methods for generating monoclonal antibody herein.
" naked antibody " refers to not the antibody of for example, puting together with allos module (cytotoxicity module) or radioactively labelled substance.Naked antibody may reside in pharmaceutical formulation.
" natural antibody " refers to have the naturally occurring immunoglobulin molecules of different structure.For example, natural IgG antibody is about 150,000 daltonian different four glycan albumen, two identical light chains and two identical heavy chains of disulphide bonding, consists of.From N to C, hold, every heavy chain has a variable region (VH), is called again Weight variable territory or heavy chain variable domain, is then three constant domains (CH1, CH2 and CH3).Similarly, from N to C, hold, every light chain has a variable region (VL), is called again can lighten territory or light chain variable territory, is then constant light (CL) territory.According to its constant domain aminoacid sequence, light chain of antibody can be included into a kind of in two types, is called card handkerchief (κ) and lambda (λ).
Term " package insert " is used in reference to the instructions that usually comprises in the commercial package for the treatment of product, its containing indication, usage, dosage relevant for relating to this type for the treatment of product application, use, the information of conjoint therapy, contraindication and/or warning.
" per-cent (%) amino acid sequence identity " about the reference peptide sequence is defined as aligned sequences and introduces where necessary breach with after obtaining largest percentage sequence identity, and not by any conservative substituting while being considered as sequence identity a part of, the percentage of the amino-acid residue identical with amino-acid residue in the reference peptide sequence in candidate sequence.For the contrast of measuring per-cent amino acid sequence identity purpose can be carried out with the various ways in the art technology scope, for example use the available computer software of the public, such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.Those skilled in the art can determine the suitable parameters for aligned sequences, comprise institute's comparative sequences total length is obtained to the required any algorithm of maximum contrast.Yet for the purposes of the present invention, % amino acid sequence identity value is to use sequence to compare computer program ALIGN-2 to produce.The ALIGN-2 sequence compares computer program by Genentech, Inc. write, and source code is submitted to U.S. Copyright Bureau (US Copyright Office, Washington D.C. together with customer documentation, 20559), wherein it is registered with U.S. copyright registration TXU510087.The public is from Genentech, Inc., and South San Francisco, California can obtain the ALIGN-2 program, or can be from compilation of source code.The ALIGN2 program should be compiled in UNIX operating system, comprises on digital UNIX V4.0D and using.The all sequences comparative parameter is by ALIGN-2 program setting and constant.
Adopting during ALIGN-2 carrys out the situation of comparing amino acid sequence, given aminoacid sequence A with respect to (to), with (with) or for the % amino acid sequence identity of (against) given aminoacid sequence B (or can be expressed as have or comprise with respect to, with or for the given aminoacid sequence A of a certain % amino acid sequence identity of given aminoacid sequence B) following calculating:
Mark X/Y takes advantage of 100
Wherein X is to be the total number of atnino acid of identical match by sequence alignment program ALIGN-2 scoring in the A of this program and B comparison, and wherein Y is the amino-acid residue sum in B.If will be appreciated that, the length of the length of aminoacid sequence A and aminoacid sequence B is unequal, and A will be not equal to the % amino acid sequence identity of B with respect to A with respect to the % amino acid sequence identity of B.Unless expressly stated otherwise,, all % amino acid sequence identity values used herein are all described according to the preceding paragraph, use the ALIGN-2 computer program to obtain.
Term " pharmaceutical formulation " refers in following form, and making the biologic activity of allowing the activeconstituents wherein contained is effectively, and containing the preparation of meeting being accepted to experimenter that preparaton uses and being there is other component of unacceptable toxicity.
" pharmaceutical acceptable carrier " refers in pharmaceutical formulation different from activeconstituents, and to the experimenter nontoxic composition.Pharmaceutical acceptable carrier includes but not limited to buffer reagent, vehicle, stablizer or sanitas.
As used herein, term " NRG " refers to from any vertebrates source, the any natural neuregulin (be called again and adjust albumen) that comprises Mammals such as primates (for example people) and rodents (for example, Mouse and rat), unless otherwise directed.This term is contained " total length ", unprocessed NRG and is derived from any type of NRG of the processing in cell.The naturally occurring variant of NRG, for example splice variant or allelic variant also contained in this term.Exist the NRG:NRG1 (Holmes, W.E. etc., Science 256:1205-1210 (1992)) of 4 kinds of form known; NRG2 (Caraway, K.L. etc., Nature 387:512-516 (1997)); NRG3 (Zhang, E. etc., Proc Natl Acad Sci USA94:9562-9567)); And NRG4 (Harari, D. etc., Oncogene 18:2681-2689)).Due to alternative splicing, the NRG1 EGF sample territory that receptors bind needs exists two kinds of active isoforms, is called NRG1 alpha (NRG1 α) and NRG1 beta (NRG β).At Genbank accession number BK000383, (Ex Cell Res, shown the sequence of exemplary people NRG1 in 284:14-30 (2003) and U.S. Patent No. 5,367,060 for Falls, D.L..
As used herein, " treatment/processing " (and grammatical variants) refers to attempt to change the clinical intervention of the individual natural process for the treatment of, and can be in order to prevent or to implement during the process of clinical pathology.The desired effects for the treatment of includes but not limited to prophylactic generation or recurrence, mitigation symptoms, alleviates/reduce any direct or indirect pathological consequences of disease, prevents the prognosis of shifting, reducing progression of disease speed, improve or palliate a disease state and disappear or improve.In some embodiments, postpone the formation of disease, the progress that slows down disease, prevention of recurrence or extend the front time of tumor recurrence with NRG antagonist of the present invention.In certain embodiments, treatment causes tumour restart the reduced number of cell or lack fully; Tumour in solid tumor is restarted cell with respect to not being the reduced number that tumour is restarted the cell of cell in tumour; And/or suppress the propagation that tumour is restarted cell.In certain embodiments, with the treatment of NRG antagonist, cause than time lengthening before the tumor recurrence of large at least 1.25,1.50,1.75,2.0 times of time before the tumor recurrence in the situation not using the NRG antagonist for treating.
Term " variable region " or " variable domain " refer to antibody heavily or involve the territory of antibodies antigen in light chain.The heavy chain of natural antibody and light chain variable territory (being respectively VH and VL) generally have similar structure, and wherein each territory comprises 4 conservative framework regions (FR) and 3 hypervariable regions (HVR).(see such as Kuby Immunology such as Kindt, the 6th edition, W.H.Freeman and Co., the 91st page (2007)).Single VH or VL territory can be enough to give antigen-binding specificity.In addition, can use respectively the antibody that carrys out the separation and combination specific antigen from the VH of the antibody of conjugated antigen or library that complementary VL or VH territory are screened in the VL territory.For example see Portolano etc., J.Immunol.150:880-887 (1993); Clarkson etc., Nature352:624-628 (1991).
As used herein, term " carrier " refers to breed the nucleic acid molecule of connected another kind of nucleic acid.This term comprises as the carrier of self-replication type nucleic acid construct and is integrated into the carrier in the genome of the host cell of accepting its importing.Some carrier can instruct the expression of the nucleic acid be operatively connected with it.Examples of such carriers is referred to herein as " expression vector ".
II. composition and method
The present invention is based on following discovery, i.e. NRG autocrine signal conduction plays an important role in chemosensitive tumour originally after chemotherapy in the survival of a small set of tumour cell and propagation.The tumour cell of these survivals (be referred to herein as " tumour is restarted cell ", or " TRIC ") is responsible for its cancer before with recurrence (relapse) and the reproduction (recurrence) of the cancer in the patient of therapeutical agent treatment.In one embodiment, the therapeutical agent that is used for the treatment of the patient is chemotherapeutic.In another embodiment, the therapeutical agent that is used for the treatment of the patient is psma binding agent, such as antibody or its fragment.
Suppressing the NRG signal causes postponing or tumor recurrence or reproduction after the therapeutical agent treatment for prevention.Thereby, the NRG antagonist of the signal conduction that an aspect of of the present present invention provides inhibition NRG to induce.In one embodiment, the NRG antagonist is the NRG1 antagonist.The NRG antagonist is applied in treatment cancer and prevention resistance and/or in reproducing by the cancer after the therapeutical agent treatment.Another aspect of the present invention provides by the patient being used in NRG antagonist prevention patient the method to the resistance with the therapeutical agent treatment.Another aspect of the present invention provides by the patient being used to the prevention of NRG antagonist and has reproduced by cancer after the therapeutical agent treatment.Another aspect of the present invention provides the model that characterizes TRIC.As described in embodiment and accompanying drawing, this model comprises following cell, and the brute force response that it shows processing, cause significant tumor regression, is then palindromia after stopping processing.This model can be applied for the compound of target TRIC and the molecular basis of mensuration TRIC in screening.
Before concrete aspect comprises the prophylaxis of tumours recurrence or extends tumor recurrence, the method for time, comprise the NRG antagonist of the patient being used to significant quantity.In one embodiment, used therapeutical agent, such as chemotherapeutic or psma binding agent, such as the Antybody therapy patient.In one embodiment, cancer comprises tumour and restarts cell.In one embodiment, cancer is nonsmall-cell lung cancer.In one embodiment, cancer is mammary cancer.In one embodiment, treat the patient with chemotherapeutic.In one embodiment, chemotherapeutic is the medicament used as the nursing for treating standard of cancer.In one embodiment, chemotherapeutic is the combination of Taxol (paclitaxal) or cis-platinum or Taxol and cis-platinum.In one embodiment, chemotherapeutic is not tyrosine kinase inhibitor.In another embodiment, chemotherapeutic is tyrosine kinase inhibitor.In one embodiment, chemotherapeutic is EGFR, HER2, HER3 and/or HER4 inhibitor.Another embodiment comprises in addition with the combination of NRG antagonist uses chemotherapeutic to the patient.
In another embodiment, use the Antybody therapy patient.In one embodiment, antibody is anti-tyrosine-kinase enzyme antibody.In one embodiment, antibody is EGFR, HER2, HER3 and/or HER4 antibody.Another embodiment comprises with the combination of NRG antagonist in addition to patient's administration of antibodies.
In certain embodiments, before tumor recurrence the time than the tumor recurrence in the situation that there is no the neuregulin antagonist before at least 1.25,1.50,1.75,2.0,2.5,5.0,10,20 or 50 times greatly of times.
Provide on the other hand treatment to there is the patient's of resistance cancer method, comprised the NRG antagonist of the patient being used to significant quantity.In one embodiment, cancer comprises tumour and restarts cell.In one embodiment, cancer is nonsmall-cell lung cancer.In one embodiment, cancer is mammary cancer.In one embodiment, cancer is to having resistance with the chemotherapeutic treatment.In one embodiment, cancer has resistance to the combined therapy with Taxol or cis-platinum or Taxol and cis-platinum.In one embodiment, cancer is to having resistance with treatment with tyrosine kinase inhibitors.In one embodiment, cancer is to having resistance with EGFR, HER2, HER3 and/or HER4 inhibitor for treating.Another embodiment comprises the patient is used to chemotherapeutic in addition.In one embodiment, chemotherapeutic is the combination of Taxol or cis-platinum or Taxol and cis-platinum.In one embodiment, chemotherapeutic is EGFR, HER2, HER3 and/or HER4 inhibitor.
In one embodiment, cancer is to having resistance with the therapeutic antibodies treatment.In one embodiment, cancer is to having resistance with EGFR, HER2, HER3 or HER4 Antybody therapy.Another embodiment comprises the administration of antibodies to the patient in addition.In one embodiment, antibody is trastuzumab (trastuzumab) or handkerchief trastuzumab (pertuzumab).
The method of the resistance in the preventing cancer is provided on the other hand, has comprised that the patient to having cancer uses NRG antagonist and the therapeutical agent of significant quantity.In one embodiment, cancer comprises tumour and restarts cell.In one embodiment, cancer is nonsmall-cell lung cancer.In one embodiment, cancer is mammary cancer.In one embodiment, cancer is to having resistance with the chemotherapeutic treatment.In one embodiment, cancer has resistance to the combined therapy with Taxol or cis-platinum or Taxol and cis-platinum.In one embodiment, chemotherapeutic is not tyrosine kinase inhibitor.In another embodiment, chemotherapeutic is tyrosine kinase inhibitor.In one embodiment, chemotherapeutic is EGFR, HER2, HER3 and/or HER4 inhibitor.Another embodiment comprises the patient is used to chemotherapeutic in addition.In one embodiment, chemotherapeutic is the combination of Taxol or cis-platinum or Taxol and cis-platinum.
In one embodiment, cancer is to having resistance with the therapeutic antibodies treatment.In one embodiment, cancer is to having resistance with EGFR, HER2, HER3 or HER4 Antybody therapy.Another embodiment comprises the administration of antibodies to the patient in addition.In one embodiment, antibody is trastuzumab or handkerchief trastuzumab.
In these methods of therapeutic use, the NRG antagonist is antibody, small molecules, immunoadhesin or RNA.In one embodiment, the NRG antagonist is the NRG1 antagonist.In one embodiment, the NRG antagonist is anti-NRG1 antibody.
Aspect another, the invention provides the purposes of neuregulin antagonist in manufacturing or preparing medicine.In one embodiment, use the neuregulin antagonist, or extend the front time of tumor recurrence in the patient with the medicine of neuregulin antagonist manufacture.In another embodiment, use the neuregulin antagonist, or treat and there is the patient who therapeutical agent is had to the cancer of resistance with the medicine of neuregulin antagonist manufacture.
The A.NRG antagonist
The NRG antagonist that can be used for the inventive method comprises the polypeptide of specific binding NRG, NRG antibody (anti-NRG antibody), RNA, such as RNAi, siRNA, shRNA etc., small molecules, acceptor molecule and derivative, (see for example United States Patent (USP) 6,696,290 and 7 such as immunoadhesin (its specific binding NRG), 659,368, the U.S. discloses text 2010055093 and 20100278801) and fusion rotein.The NRG antagonist also comprises the Antagonism variant of NRG polypeptide, the fit and peptide body (peptibody) for the RNA of NRG.The example of every kind has hereinafter been described in these.In one embodiment, the NRG antagonist is the NRG1 antagonist.In other embodiments, the NRG antagonist is NRG2, NRG3 or NRG4 antagonist.
1. antibody
The anti-NRG antibody that can be used for the inventive method comprises with enough avidity and specific binding NRG, and can reduce or suppress any antibody of NRG signal conduction.NRG antibody is recorded in WO1992020798, U.S. Patent No. 6,953,842 and U.S. Patent No. 6,252,051.
a) affinity of antibody
In certain embodiments, have≤1 μ M of the antibody provided herein ,≤100nM ,≤10nM ,≤1nM ,≤0.1nM ,≤0.01nM or≤0.001nM(for example 10 -8m or still less, for example 10 -8m to 10 -13m, for example, 10 -9m to 10 -13m) dissociation constant (Kd).
In one embodiment, Kd is by measuring with the antibody interested of Fab pattern and the radio-labelled antigen binding assay (RIA) of antigen enforcement thereof as described in following assay method.By in the situation of the titration series there being unlabelled antigen with Cmin ( 125i) labelled antigen balance Fab, the antigen that then with the coated plate of anti-Fab antibody, catches combination is measured Fab to the solution binding affinity of antigen (see such as Chen etc., J.Mol.Biol.293:865-881 (1999)).In order to set up the condition of assay method, will
Figure BDA00002023878900151
porous plate (Thermo Scientific) catches with anti-Fab antibody (Cappel Labs) is coated and spends the night with 5 μ g/ml in 50mM sodium carbonate (pH 9.6), uses subsequently 2% in PBS (w/v) bovine serum albumin(BSA) in room temperature (approximately 23 ° of C) sealing 2-5 hour.In non-adsorption plate (Nunc#269620), by 100pM or 26pM 125the Fab(interested of I-antigen and serial dilution is such as with Presta etc., VEGF antibody in Cancer Res.57:4593-4599 (1997), the assessment of Fab-12 is consistent) mix.Then interested Fab is incubated overnight; For example, yet the sustainable longer time of incubation (approximately 65 hours) is to guarantee to reach balance.After this, mixture is transferred to the seizure plate, for example, in room temperature incubation (1 hour).Then remove solution, and with 0.1% Polysorbate 20 in PBS
Figure BDA00002023878900152
wash plate 8 times.After dull and stereotyped drying, add 150 μ l/ hole scintillation solution (MICROSCINT-20 tM; Packard), then at TOPCOUNT tMgamma counter (Packard) is upper to plate count 10 minutes.Select each Fab to provide to be less than or equal to 20% concentration of maximum combined for the competitive binding assay method.
According to another embodiment, Kd is used surperficial plasmon resonance assay method to use or
Figure BDA00002023878900154
(BIAcore, Inc., Piscataway, NJ) used immobilized antigen CM5 chips to measure in about 10 response units (RU) in 25 ° of C.In brief, hydrochloric acid N-ethyl-N '-(3-dimethylamino-propyl)-carbodiimide (EDC) for instructions and N-hydroxy-succinamide (NHS) activation carboxymethylation dextran biologic sensor chip (CM5 according to supplier, BIACORE, Inc.).Antigen is diluted to approximately 0.2 μ M of 5 μ g/ml(with 10mM sodium acetate pH 4.8), then with the flow velocity of 5 μ l/ minutes, inject to obtain the approximately coupling protein matter of 10 response units (RU).After injecting antigen, inject the 1M thanomin with sealing unreacted group.In order to carry out kinetic measurement, in 25 ° of C, with the flow velocity of approximately 25 μ l/ minutes, be infused in containing 0.05% Polysorbate 20 (TWEEN-20 tM) Fab(0.78nM to 500nM of twice serial dilution in the PBS (PBST) of tensio-active agent).Use Lang Gemiaoer (Langmuir) combination model simply one to one evaluation Software version 3.2) by while matching combination and the sensing figure calculations incorporated speed (k that dissociates on) and the speed (k that dissociates off).Equilibrium dissociation constant (Kd) is with ratio k off/ K oncalculate.See such as Chen etc., J.Mol.Biol.293:865-881 (1999).If, according to surperficial plasmon resonance assay method above, association rate surpasses 10 6m -1s -1, association rate can be measured by the fluorescent quenching technology so, according to spectrometer such as the spectrophotometer that has been equipped with cut-off device (Aviv Instruments) or 8000 serial SLM-AMINCO tMwith the measurement of stirring cuvette, in the situation that has the cumulative antigen of concentration, measure the anti-antigen-antibody of 20nM (Fab form) in PBS pH 7.2 and (excite=295nm in the fluorescent emission intensity of 25 ℃ in spectrophotometer (ThermoSpectronic); Emission=340nm, 16nm band is logical) rising or reduction.
b) antibody fragment
In certain embodiments, the antibody provided herein is antibody fragment.Antibody fragment includes but not limited to Fab, Fab ', Fab '-SH, F (ab ') 2, Fv and scFv fragment, and described other fragment hereinafter.About the summary of some antibody fragment, see the Nat.Med.9:129-134 such as Hudson (2003).About the summary of scFv fragment, see for example Pluckth ü n, in The Pharmacology of Monoclonal Antibodies; the 113rd volume, Rosenburg and Moore compile, (Springer-Verlag; New York), 269-315 page (1994); Be also shown in WO 93/16185; And U.S. Patent No. 5,571,894 and 5,587,458.Remedy the receptor binding domain residue about comprising, and there is the Fab of Half-life in vivo of prolongation and F (ab ') 2the discussion of fragment, be shown in U.S. Patent No. 5,869,046.
Double antibody is the antibody fragment with two antigen binding sites, its can be divalence or dual specific.See for example EP 404,097; WO 1993/01161; Hudson etc., Nat.Med.9:129-134 (2003); And Hollinger etc., Proc.Natl.Acad.Sci.USA 90:6444-6448 (1993).Three antibody and four antibody are also recorded in Hudson etc., Nat.Med.9:129-134 (2003).
Single domain antibody is the heavy chain variable domain all or in part that comprises antibody or the antibody fragment in light chain variable territory all or in part.In certain embodiments, single domain antibody is people's single domain antibody (Domantis, Inc., Waltham, MA; See for example U.S. Patent No. 6,248,516B1).
Can pass through multiple technologies, include but not limited to the proteolytic digestion of complete antibody and the generation of recombinant host cell (for example intestinal bacteria or phage) are generated to antibody fragment, as described in this article.
c) chimeric and humanized antibody
In certain embodiments, the antibody provided herein is chimeric antibody.Some chimeric antibody is recorded in for example U.S. Patent No. 4,816,567; And Morrison etc., Proc.Natl.Acad.Sci.USA, 81:6851-6855 (1984)).In an example, chimeric antibody comprises inhuman variable region (for example, from mouse, rat, hamster, rabbit or non-human primates, the derivative variable region such as monkey) and human constant region.In another example, chimeric antibody is " class conversion " antibody, and wherein class or subclass change from class or the subclass of parental antibody.Chimeric antibody comprises its Fab.
In certain embodiments, chimeric antibody is humanized antibody.Usually, non-human antibody's humanization, to reduce the immunogenicity to the people, is retained to parent non-human antibody's specificity and avidity simultaneously.Usually, humanized antibody comprises one or more variable domains, wherein HVR, for example CDR(or its part) derivative from the non-human antibody, and FR(or its part) derivative from human antibody sequence.Optionally, humanized antibody also can at least comprise the part of human constant region.In some embodiments, use for example, corresponding residue from non-human antibody's antibody of HVR residue (derivative) to substitute some the FR residues in humanized antibody, for example, to recover or to improve antibodies specific or avidity.
Humanized antibody and generation method thereof are summarized in for example Almagro and Fransson, Front.Biosci.13:1619-1633 (2008), and further be recorded in such as Riechmann etc., Nature332:323-329 (1988); Queen etc., Proc.Nat ' l Acad.Sci.USA 86:10029-10033 (1989); U.S. Patent No. 5,821,337,7,527,791,6,982,321 and 7,087,409; Kashmiri etc., Methods 36:25-34 (2005) (having described SDR (a-CDR) grafting); Padlan, Mol.Immunol.28:489-498 (1991) (having described " resurfacing "); Dall ' Acqua etc., Methods 36:43-60 (2005) (having described " FR reorganization "); And Osbourn etc., Methods 36:61-68 (2005) and Klimka etc., Br.J.Cancer, 83:252-260 (2000) (having described " pathfinder selection " method of FR reorganization).
Can include but not limited to for humanized people's framework region: the framework region (seeing such as J.Immunol.151:2296 such as Sims (1993)) that uses " best-fit (best-fit) " method to select; The derivative framework region of consensus sequence from people's antibody of the specific subgroup of light or variable region of heavy chain (is shown in such as Proc.Natl.Acad.Sci.USA such as Carter 89:4285 (1992); Reach the J.Immunol. such as Presta, 151:2623 (1993)); (somatic mutation) framework region of people's maturation or people's germline framework region (seeing for example Almagro and Fransson, Front.Biosci.13:1619-1633 (2008)); With by the derivative framework region in screening FR library (see such as Baca etc., J.Biol.Chem.272:10678-10684 (1997) and Rosok etc., J.Biol.Chem.271:22611-22618 (1996)).
d) people's antibody
In certain embodiments, the antibody provided herein is people's antibody.Can use the multiple technologies as known in the art antibody of being grown up next life.Usually, people's antibody is recorded in van Dijk and van de Winkel, Curr.Opin.Pharmacol.5:368-74 (2001) and Lonberg, Curr.Opin.Immunol.20:450-459 (2008).
Can be by transgenic animal being used to the original preparation of immunity people antibody, described transgenic animal have been modified to the response antigenicity and have attacked and generate whole person's antibody or have the complete antibody of people variable region.This type of animal contains all or part human immunoglobulin gene seat usually, and it replaces endogenous immunoglobulin loci, or it outside karyomit(e), exists or random integration enters in the karyomit(e) of animal.In this type of transgenic mice, generally by endogenous immunoglobulin loci deactivation.About obtain the summary of the method for people's antibody from transgenic animal, see Lonberg, Nat.Biotech.23:1117-1125 (2005).Be also shown in for example U.S. Patent No. 6,075,181 and 6,150,584, it has described XENOMOUSE tMtechnology; U.S. Patent No. 5,770,429, it has been described
Figure BDA00002023878900181
technology; U.S. Patent No. 7,041,870, it has been described
Figure BDA00002023878900182
technology, and U.S. Patent Application Publication text No.US 2007/0061900, it has been described
Figure BDA00002023878900183
technology).Can be for example by further modifying from the people variable region by the zoogenic complete antibody of this class with the combination of different people constant region.
Also can generate people's antibody by the method based on hybridoma.Human myeloma and the different myeloma cell line of mouse-people described for generating human monoclonal antibodies (are shown in for example Kozbor J.Immunol., 133:3001 (1984); Brodeur etc., Monoclonal Antibody Production Techniques and Applications, 51-63 page (Marcel Dekker, Inc., New York, 1987); And Boerner etc., J.Immunol., 147:86 (1991)).The people's antibody generated via the human B-lymphocyte hybridoma technology is also recorded in Li etc., Proc.Natl.Acad.Sci.USA, 103:3557-3562 (2006).Other method comprises that those for example are recorded in U.S. Patent No. 7,189, it has described 826(from hybridoma cell line generation mono-clonal human IgM antibody) and Ni, Xiandai Mianyixue, 26 (4): 265-268's (2006) (it has described people-people's hybridoma).People's hybridoma technology (Trioma technology) is also recorded in Vollmers and Brandlein, Histology and Histopathology, 20 (3): 927-937 (2005) and Vollmers and Brandlein, Methods and Findings in Experimental and Clinical Pharmacology, 27 (3): 185-91 (2005).
The Fv clone variable domain sequence generation people antibody that also can select by separating the phage display library derivative from the people.Then, people's constant domain of this type of variable domain sequence and expectation can be combined.The technology of selecting people's antibody from antibody library has hereinafter been described.
e) the derivative antibody in library
Can separate antibody of the present invention by combinatorial library is screened to one or more the active antibody with expectation.For example, for generating phage display library and this type of library screening being had to expectation, in conjunction with the several different methods of the antibody of feature, be as known in the art.These class methods summarize in such as Hoogenboom, equal Methods in Molecular Biology 178:1-37 (O ' volume such as Brien, Human Press, Totowa; NJ; 2001), and further be recorded in such as McCafferty etc., Nature348:552-554; Clackson etc., Nature 352:624-628 (1991); Marks etc., J.Mol.Biol.222:581-597 (1992); Marks and Bradbury, in Methods in Molecular Biology 248:161-175 (Lo compiles, Human Press, Totowa, NJ, 2003); Sidhu etc., J.Mol.Biol.338 (2): 299-310 (2004); Lee etc., J.Mol.Biol.340 (5): 1073-1093 (2004); Fellouse, Proc.Natl.Acad.Sci.USA 101 (34): 12467-12472 (2004); And Lee etc., J.Immunol.Methods 284 (1-2): 119-132 (2004).
In some phage display method, the complete or collected works of VH and VL gene are cloned by polymerase chain reaction (PCR) respectively, and restructuring at random in phage library, then can be to described phage library screening antigen in conjunction with phage, as be recorded in Winter etc., Ann.Rev.Immunol., 12:433-455 (1994).Phage is showed antibody fragment with scFv (scFv) fragment or with the Fab fragment usually.The hang oneself library in immune source provides for immunogenic high-affinity antibody, and does not need to build hybridoma.Perhaps, can (for example, from the people) clone natural complete or collected works so that the single source for large quantities of non-self antibody with also having autoantigen to be provided in the situation without any immune, as by Griffiths etc., EMBO J, 12:725-734 (1993) describes.Finally, also can be by the V constant gene segment C of not resetting from the stem cell clone, and also realize in vitro resetting the not immune library of synthetic generation with the CDR3 district of the PCR primer coding alterable height that contains stochastic sequence, as by Hoogenboom and Winter, J.Mol.Biol., 227:381-388 (1992) is described.The open text of patent of describing people's antibody phage library for example comprises: U.S. Patent No. 5,750,373 and the open text No.2005/0079574 of United States Patent (USP), 2005/0119455,2005/0266000,2007/0117126,2007/0160598,2007/0237764,2007/0292936 and 2009/0002360.
Think that the antibody or the antibody fragment that separate from people's antibody library are people's antibody or people's antibody fragments herein.
f) multi-specificity antibody
In certain embodiments, the antibody provided herein is multi-specificity antibody, for example bi-specific antibody.Multi-specificity antibody is at least two different loci to be had to the monoclonal antibody of binding specificity.In certain embodiments, one of binding specificity is for NRG, and another kind is for any other antigen.In certain embodiments, bi-specific antibody can be in conjunction with two different epi-positions of NRG.Also can cytotoxic agent be positioned to express with bi-specific antibody the cell of NRG.Bi-specific antibody can be with full length antibody or antibody fragment preparation.
Include but not limited to have the right recombinant co-expression of not homospecific two pairs of heavy chain immunoglobulin-light chains for the technology that generates multi-specificity antibody and (see Milstein and Cuello, Nature 305:537 (1983)), WO 93/08829 and Traunecker etc., EMBO is (1991) J.10:3655) and " projection-entering-hole " through engineering approaches (see for example U.S. Patent No. 5,731,168).Also can be by for generating the through engineering approaches static manipulation effects (WO 2009/089004A1) of antibody Fc-heterodimer molecule; Crosslinked two or more antibody or fragment (see for example U.S. Patent No. 4,676,980, and Brennan etc., Science, 229:81 (1985)); Generating bi-specific antibody with leucine zipper (sees such as Kostelny etc., J.Immunol., 148 (5): 1547-1553 (1992)); Use " double antibody " technology for generating bispecific antibody fragment (see such as Hollinger etc., Proc.Natl.Acad.Sci.USA, 90:6444-6448 (1993)); And use scFv (sFv) dimer (see such as Gruber etc., J.Immunol., 152:5368 (1994)); And, as described in such as the J.Immunol.147:60 such as Tutt (1991), prepare three-specific antibody and generate multi-specificity antibody.
Also comprise the engineered antibody with three or more functional antigen binding sites herein, comprise " octopus antibody " (seeing for example US 2006/0025576A1).
Antibody herein or fragment also comprise and comprising in conjunction with NRG and another kind of not " dual function FAb " or " DAF " (seeing for example US 2008/0069820) of the antigen binding site of synantigen.
g) antibody variants
The aminoacid sequence variant that the antibody provided herein is provided in certain embodiments.For example, can expect to improve binding affinity and/or other biological characteristics of antibody.Can introduce in the nucleotide sequence of encoding antibody by the modification by suitable, or synthesize to come the aminoacid sequence variant of Dispersal risk by peptide.This type of modification comprises the deletion of the residue in the aminoacid sequence of antagonist for example and/or inserts and/or substitute.Any combination that can be deleted, insert and substitute is to obtain final construct, as long as final construct has the feature of expectation, for example, the antigen combination.
h) substitute, insert and delete variant
In certain embodiments, provide the antibody variants with a place or many places amino acid replacement.Substitute the interested site of mutagenesis and comprise HVR and FR.Conservative substituting in table 1 shows under the title of " conservative substituting ".More the variation of essence provides in table 1 under the title of " exemplary substituting ", and further describe referring below to the amino acid side chain classification.Amino acid replacement can be introduced in interested antibody, and the activity that screening is expected to product, ADCC or the CDC of the antigen that for example retains/improve combination, the immunogenicity reduced or improvement.
table 1
Figure BDA00002023878900201
Figure BDA00002023878900211
According to common side chain characteristic, amino acid can divide into groups as follows:
(1) hydrophobic: nor-leucine, Met, Ala, Val, Leu, Ile;
(2) neutral, hydrophilic: Cys, Ser, Thr, Asn, Gln;
(3) acid: Asp, Glu;
(4) alkalescence: His, Lys, Arg;
(5) affect the residue of chain orientation: Gly, Pro;
(6) aromatic: Trp, Tyr, Phe.
Non-conservative alternative meeting need to be replaced with the member of one of these classifications another classification.
One class alternative variations involves one or more hypervariable regions residue of alternative parental antibody (for example humanization or people's antibody).Some biological characteristics that usually, for further studying the gained variant of selecting, can there is the change (for example improving) (avidity for example raise, the immunogenicity of reduction) of some biological characteristics with respect to parental antibody and/or can basically retain parental antibody.Exemplary alternative variations is the antibody of affinity maturation, and it can for example use all those technology as described in this article of affinity maturation technology based on phage display to generate easily.In brief, by one or more HVR residue sudden changes, and variant antibody is showed on phage, and it is screened to specific biologic activity (for example binding affinity).
Can make variation (for example, substituting) to HVR, for example, to improve affinity of antibody.Can be to HVR " focus ", (see for example Chowdhury by the residue of encoding with the codon of high frequency experience sudden change during the somatocyte ripening process, Methods Mol.Biol.207:179-196 (2008)), and/or SDR (a-CDR) makes this type of and changes, wherein to variant VH or the VL test binding affinity of gained.By the structure in secondary library and the affinity maturation of selecting again to carry out be recorded in such as Hoogenboom equal Methods in Molecular Biology 178:1-37 (O ' volume such as Brien, Human Press, Totowa, NJ, (2001)).In some embodiments of affinity maturation, for example, by several different methods (mutagenesis that, fallibility PCR, chain reorganization or oligonucleotide instruct) diversity is introduced as to the ripe variable gene of selecting.Then, create secondary library.Then, any antibody variants that the screening library has the avidity of expectation with evaluation.The multifarious method of another kind of introducing involves the method that HVR instructs, wherein for example, by several HVR residues (, 4-6 residue) randomization.Can for example with alanine scanning mutagenesis or modeling, come specificity identification to involve the HVR residue of antigen combination.Especially, frequent target CDR-H3 and CDR-L3.
In certain embodiments, can in one or more HVR, occur to substitute, insert or delete, as long as this type of changes the ability of not substantive reduction antibodies antigen.For example, can make conservative variation the (for example, conservative substituting, as provided), its not substantive reduction binding affinity herein to HVR.This type of variation can be in HVR " focus " or SDR outside.In some embodiment of variant VH provided above and VL sequence, each HVR is unaltered, or contains and be no more than 1,2 or 3 place's amino acid replacements.
A kind ofly can be used for identifying in antibody that the method in the residue that can be used as the mutagenesis target position or zone is called " alanine scanning mutagenesis ", as by Cunningham and Wells (1989) Science, 244:1081-1085 is described.In this method, by the group of residue or target residue (for example, charged residue such as arg, asp, his, lys and glu) identify, and whether the interaction of for example, replacing to measure antibody and antigen with neutral or electronegative amino acid (, L-Ala or many L-Ala) is affected.Can introduce further alternative to the initial amino acid position that shows function sensitive that substitutes.Perhaps/in addition, utilize the crystalline structure of antigen-antibody complex to identify the point of contact between antibody and antigen.As an alternative candidate, can target or eliminate this type of contact residues and contiguous residue.Can screen variant to determine whether they contain the characteristic of expectation.
Aminoacid sequence insert comprise length range be 1 residue to contain 100 or amino and/or the carboxyl terminal of the polypeptide of more residues merge, and insert in the sequence of single or multiple amino-acid residues.The example that end inserts comprises the antibody with N end methionyl residue.Other insertion variant of antibody molecule comprises the N of antibody or C holds and the fusions of the polypeptide of the serum half-life of enzyme (for example, for ADEPT) or prolongation antibody.
i) glycosylation variants
In certain embodiments, the antibody that change provides herein is to improve or to reduce the glycosylated degree of antibody.Can, by changing aminoacid sequence, make and create or eliminate interpolation or the deletion that one or more glycosylation sites are realized the glycosylation site of antagonist easily.
In the situation that comprises the Fc district at antibody, can change the carbohydrate that it adheres to.The natural antibody generated by mammalian cell comprises feeler oligosaccharides branch, two usually, and it generally connects the Asn297 in the CH2 territory that is attached to the Fc district by N.See such as TIBTECH 15:26-32 (1997) such as Wright.Oligosaccharides can comprise various carbohydrate, for example, and seminose, N-acetyl-glucosamine (GlcNAc), semi-lactosi and sialic acid, and the Fucose that is attached to the GlcNAc in two feeler oligosaccharide structures " trunk ".In some embodiments, can be modified to create to the oligosaccharides in antibody of the present invention the antibody variants of the characteristic with some improvement.
In one embodiment, provide antibody variants, it has shortage and adheres to (directly or indirectly) in the carbohydrate structure of the Fucose in Fc district.For example, the Fucose amount in this antibody-like can be 1% to 80%, 1% to 65%, 5% to 65% or 20% to 40%.By all sugared structure with respect to being attached to Asn297 (for example, compound, heterozygosis and structure high mannose) summation, calculate the mean vol of Fucose in Asn297 place sugar chain and measure the Fucose amount, as measured by the MALDI-TOF mass spectrometry, for example, as be recorded in WO 2008/077546.Asn297 refers to be arranged in the asparagine residue of approximately the 297th (the Eu numbering of Fc district residue) in Fc district; Yet Asn297 also can be positioned at due to the small sequence variations in antibody the 297th upstream or approximately ± 3, downstream amino acid, between the 294th and the 300th.This type of fucosylation variant can have the ADCC function of improvement.See for example open text No.US 2003/0157108 (Presta, L.) of United States Patent (USP); US 2004/0093621 (Kyowa Hakko Kogyo Co., Ltd).The example that relates to the publication of " de-fucosylation " or " Fucose lacks " antibody variants comprises: US 2003/0157108; WO 2000/61739; WO2001/29246; US 2003/0115614; US 2002/0164328; US 2004/0093621; US2004/0132140; US 2004/0110704; US 2004/0110282; US 2004/0109865; WO2003/085119; WO 2003/084570; WO 2005/035586; WO 2005/035778; WO2005/053742; WO2002/031140; The J.Mol.Biol.336:1239-1249 such as Okazaki (2004); The Biotech.Bioeng.87:614 such as Yamane-Ohnuki (2004).The example that can generate the clone of de-fucosylation antibody comprises the Lec13 Chinese hamster ovary celI of the protein fucosylation defect (Arch.Biochem.Biophys.249:533-545 (1986) such as Ripka; U.S. Patent application No US2003/0157108A1, Presta, L; And WO 2004/056312A1, Adams etc., especially at embodiment 11), and knock out clone, such as α-1,6-fucosyl transferase gene FUT8 knocks out Chinese hamster ovary celI (to be seen such as Biotech.Bioeng.87:614 such as Yamane-Ohnuki (2004); Kanda, Y. etc., Biotechnol.Bioeng., 94 (4): 680-688 (2006); And WO2003/085107).
Antibody variants with two somatotype oligosaccharides further is provided, and the two feeler oligosaccharides that for example wherein are attached to the antibody Fc district were by GlcNAc two minutes.This type of antibody variants can have the fucosylation of reduction and/or the ADCC function of improvement.The example of this type of antibody variants is recorded in such as WO 2003/011878(Jean-Mairet etc.); U.S. Patent No. 6,602,684(Umana etc.); And US 2005/0123546(Umana etc.).The antibody variants that has at least one galactose residue in the oligosaccharides that is attached to the Fc district also is provided.This type of antibody variants can have the CDC function of improvement.This type of antibody variants is recorded in such as WO 1997/30087(Patel etc.); WO 1998/58964 (Raju, S.); And WO 1999/22764 (Raju, S.).
j) Fc region variants
In certain embodiments, can be by a place or the Fc district of the antibody that many places are amino acid modified to be provided in being incorporated herein in, generate thus the Fc region variants.The Fc region variants can be included in the people Fc region sequence (for example, human IgG1, IgG2, IgG3 or IgG4Fc district) that one or more amino acid positions comprise amino acid modified (for example substituting).
In certain embodiments, the present invention is contained and is had some but the antibody variants of not all effector functions, described effector functions makes it become the expectation material standed for of following application, wherein the Half-life in vivo of antibody is important, and some effector functions (such as complement and ADCC) is unnecessary or harmful.Can carry out external and/or in vivo cytotoxicity assay method with the reduction of confirming CDC and/or ADCC activity/subdue.For example, can carry out Fc acceptor (FcR) binding assay to guarantee that antibody deficiency Fc γ R is in conjunction with (therefore likely lacking the ADCC activity), but retain the FcRn binding ability.The main cell NK cell of mediation ADCC is only expressed Fc γ RIII, and monocytes Fc γ RI, Fc γ RII and Fc γ RIII.At Ravetch and Kinet, gathered the FcR on the hematopoietic cell in the table 3 on the 464th page of Annu.Rev.Immunol.9:457-492 (1991) and expressed.The non-limitative example of the external test method of the ADCC activity of assessment molecules of interest is recorded in U.S. Patent No. 5; 500; 362(is shown in for example Hellstrom; I. wait Proc.Nat ' l Acad.Sci.USA 83:7059-7063 (1986)) and Hellstrom; I etc., Proc.Nat ' l Acad.Sci.USA 82:1499-1502 (1985); 5,821,337(is shown in Bruggemann, M. etc., J.Exp.Med.166:1351-1361 (1987)).Perhaps, can adopt the on-radiation measuring method (for example to see the ACTI for flow cytometry tMon-radiation cytotoxicity assay (CellTechnology, Inc.Mountain View, CA; With
Figure BDA00002023878900241
on-radiation cytotoxicity assay (Promega, Madison, WI)).For this type of assay method, useful effector cell comprises peripheral blood mononuclear cell (PBMC) and NK cell (NK) cell.Perhaps/in addition, can assess in vivo the ADCC activity of molecules of interest, for example, in animal model, such as being disclosed in Proc.Nat ' the l Acad.Sci.USA95:652-656's (1998) such as Clynes.Also can implement the C1q binding assay to confirm that antibody can not be in conjunction with C1q, and therefore lack the CDC activity.See that C1q in for example WO 2006/029879 and WO 2005/100402 and C3c are in conjunction with ELISA.In order to assess complement activation, can implement the CDC assay method and (see such as Gazzano-Santoro etc., J.Immunol.Methods 202:163 (1996); Cragg, M.S. etc., Blood 101:1045-1052 (2003); And Cragg, M.S. and M.J.Glennie, Blood103:2738-2743 (2004)).Also can implement the removing/transformation period in FcRn combination and body by method as known in the art and measure (seeing for example Petkova, S.B. etc., Int ' l.Immunol.18 (12): 1759-1769 (2006)).
Antibody with effector functions of reduction comprises that those have one or more (U.S. Patent No. 6,737,056) that substitutes in Fc district residue 238,265,269,270,297,327 and 329.This type of Fc mutant be included in two places in amino acid position 265,269,270,297 and 327 or more many places there is alternative Fc mutant, comprise that residue 265 and 297 is replaced into so-called " DANA " Fc mutant (U.S. Patent No. 7 of L-Ala, 332,581).
Describe some antibody variants with combination to FcR improvement or that reduce and (seen for example U.S. Patent No. 6,737,056; WO 2004/056312, and Shields etc., J.Biol.Chem.9 (2): 6591-6604 (2001)).
In certain embodiments, antibody variants comprises and has a place or the many places amino acid replacement that improves ADCC, for example the position 298,333 in Fc district and/or the EU numbering of 334(residue) alternative Fc district.
In some embodiments, the Fc district is made a change, its cause changing (, that improve or reduction) C1q combination and/or CDC (CDC), for example, as be recorded in U.S. Patent No. 6,194,551, WO 99/51642, and the J.Immunol.164:4178-4184 (2000) such as Idusogie.
Antibody with combination to neonatal Fc receptor (FcRn) of transformation period of prolongation and improvement is recorded in US2005/0014934A1 (Hinton etc.), neonatal Fc receptor (FcRn) is responsible for Maternal immunoglobulin G is transferred to fetus (Guyer etc., J.Immunol.117:587 (1976) and Kim etc., J.Immunol.24:249 (1994)).Those antibody comprise wherein to have and improve a place or the many places alternative Fc district of Fc district to the FcRn combination.This type of Fc variant comprises that those are at Fc district residue 238,256,265,272,286,303,305,307,311,312,317,340,356,360,362,376,378, a place or many places in 380,382,413,424 or 434 have alternative, for example, (U.S. Patent No. 7,371,826) that substitute of Fc district residue 434.
Be also shown in Duncan and Winter, Nature 322:738-40 (1988); U.S. Patent No. 5,648,260; U.S. Patent No. 5,624,821; And WO 94/29351, it pays close attention to other example of Fc region variants.
k) the engineered antibody variants through halfcystine
In certain embodiments, can expect to create the antibody engineered through halfcystine, for example, " thioMAb ", wherein one or more residues of antibody substitute with cysteine residues.In specific embodiment, alternative residue is present in the approached site of antibody.By with halfcystine, substituting those residues, reactive thiol group is positioned the approached site of antibody thus, and can, for by antibody and other module, such as medicine module or joint-medicine module, put together, to create immunoconjugates, as further described herein.In certain embodiments, can with halfcystine substitute following residue any or a plurality of: the V205(Kabat numbering of light chain); The A118(EU numbering of heavy chain); S400(EU numbering with heavy chain Fc district).Can be as for example U.S. Patent No. 7,521, the 541 described generation antibody engineered through halfcystine.
l) antibody derivatives
In certain embodiments, can further modify the antibody that provides herein to contain that this area is known and to be easy to the extra nonprotein character module obtained.The module that is suitable for the antibody derivatize includes but not limited to water-soluble polymers.The non-limitative example of water-soluble polymers includes but not limited to polyoxyethylene glycol (PEG), ethylene glycol/propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinylpyrrolidone, poly--DOX, gathers-1, and 3,6-tri-
Figure BDA00002023878900261
alkane, ethene/copolymer-maleic anhydride, polyamino acid (homopolymer or randomcopolymer) and dextran or poly-(n-VP) polyoxyethylene glycol, propylene glycol homopolymer, propylene oxide/ethylene oxide copolymer, polyoxyethylene polyvalent alcohol (for example glycerine), polyvinyl alcohol and composition thereof.Stability due to it in water, the polyoxyethylene glycol propionic aldehyde may have advantage aborning.Polymkeric substance can be any molecular weight, and can be branch or unbranched.The polymkeric substance number be attached on antibody can change, and if adhered to and surpassed a polymkeric substance, they can be identical or different molecules so.Generally speaking, can be identified for number and/or the type of the polymkeric substance of derivatize according to following consideration, include but not limited to antibody wants improved concrete property or function, antibody derivatives whether will be used to specify treatment under condition etc.
The conjugate of antibody and nonprotein character module that can be by being exposed to the radiation-selective heating is provided in another embodiment.In one embodiment, nonprotein character module is carbon nanotube (Kam etc., Proc.Natl.Acad.Sci.USA 102:11600-11605 (2005)).Radiation can be any wavelength, and includes but not limited to not infringement of ordinary cells, but nonprotein character module is heated to near the wavelength of the killed temperature of cell antibody-nonprotein character module.
m) recombination method and composition
Can generate antibody with recombination method and composition, for example, as be recorded in U.S. Patent No. 4,816,567.The nucleic acid of the separation of the anti-NRG antibody described herein of encoding is provided in one embodiment.This type of nucleic acid can encoded packets contain the aminoacid sequence of antibody VL and/or the aminoacid sequence that comprises VH (for example, the light and/or heavy chain of antibody).In another embodiment, one or more carriers that comprise this type of nucleic acid (for example, expression vector) are provided.In another embodiment, provide the host cell that comprises this type of nucleic acid.In this type of embodiment, host cell (for example comprises, with following carrier, transform): the carrier that (1) comprises nucleic acid, the aminoacid sequence of the aminoacid sequence of the VL that described nucleic acid encoding comprises antibody and the VH that comprises antibody, or (2) first carrier and Second support, described the first carrier comprises the nucleic acid of encoded packets containing the aminoacid sequence of the VL of antibody, and described Second support comprises the nucleic acid of encoded packets containing the aminoacid sequence of the VH of antibody.In one embodiment, host cell is eucaryon, for example Chinese hamster ovary (CHO) cell or lymphoidocyte (for example, Y0, NS0, Sp20 cell).In one embodiment, the method that generates anti-NRG antibody is provided, and wherein the method is included in the host cell of cultivating the nucleic acid that comprises encoding antibody under the condition that is suitable for expressing antibody, as provided, and optionally, from host cell (or host cell nutrient solution), reclaim antibody.
Restructuring for anti-NRG antibody generates, and the nucleic acid of encoding antibody (for example as described above) is separated, and insert in one or more carriers, with further clone and/or expression in host cell.Can use conventional rules this type of nucleic acid easily to be separated and check order (for example, by carrying out with oligonucleotide probe, the weight that described oligonucleotide probe can the specific binding encoding antibody and the gene of light chain).
The host cell that is suitable for clone or expression antibody coding carrier comprises protokaryon described herein or eukaryotic cell.For example, can in bacterium, generate antibody, particularly when not needing glycosylation and Fc effector functions.The expression in bacterium for antibody fragment and polypeptide, be shown in for example U.S. Patent No. 5,648,237,5,789,199 and 5,840,523(be also shown in Charlton, Methods in Molecular Biology, (B.K.C.Lo compiles the 248th volume, Humana Press, Totowa, NJ, 2003), the 245-254 page, it has described the expression of antibody fragment in intestinal bacteria (E.coli.)).After expression, antibody can be separated from the bacterial cell slurry in soluble fraction, and can be further purified.
Outside prokaryotic organism, eukaryotic microorganisms is clone or the expressive host that is suitable for the antibody coding carrier such as filamentous fungus or yeast, comprise its glycosylation pathway differ " humanization ", cause generation to there is the partially or completely fungi and yeasts strain of the antibody of people's glycosylation pattern.See Gerngross, Nat.Biotech.22:1409-1414 (2004), and Li etc., Nat.Biotech.24:210-215 (2006).
The host cell that is suitable for expressing glycosylated antibodies is also derivative from multicellular organisms (invertebrates and vertebrates).The example of invertebral zooblast comprises plant and insect cell.Identified many baculovirus strains, it can use together with insect cell, especially for transfection fall army worm (Spodoptera frugiperda) cell.
Also can utilize plant cell cultures as the host.It has been described for generate the PLANTIBODIESTM technology of antibody transgenic plant for example to see U.S. Patent No. 5,959,177,6,040,498,6,420,548,7,125,978 and 6,417,429().
Also can use vertebrate cells as the host.For example, the mammal cell line that is suitable for growing in suspension can be useful.Other example of useful mammalian host cell line is the monkey kidney CV1 system (COS-7) transformed through SV40; Human embryo kidney (HEK) system (293 or 293 cells, as be recorded in such as Graham etc., J.Gen Virol.36:59's (1977)); Hamster nephrocyte childhood (BHK); Mouse Sai Tuoli (sertoli) cell (the TM4 cell, as be recorded in for example Mather, Biol.Reprod.23:243-251's (1980)); Monkey-kidney cells (CV1); African green monkey kidney cell (VERO-76); Human cervical carcinoma cell (HELA); Madin-Darby canine kidney(cell line) (MDCK; Ox mouse (buffalo rat) liver cell (BRL 3A); Human pneumonocyte (W138); Human liver cell (Hep G2); MMT (MMT 060562); The TRI cell, as be recorded in such as Mather etc., Annals N.Y.Acad.Sci.383:44-68's (1982); MRC 5 cells; With the FS4 cell.Other useful mammalian host cell line comprises Chinese hamster ovary (CHO) cell, comprises DHFR-CHO cell (Urlaub etc., Proc.Natl.Acad.Sci.USA 77:4216 (1980)); With myeloma cell line such as Y0, NS0 and Sp2/0.About being suitable for the summary of some mammalian host cell line that antibody generates, see for example Yazaki and Wu, Methods in Molecular Biology, (B.K.C.Lo compiles the 248th volume, Humana Press, Totowa, NJ), 255-268 page (2003).
n) assay method
Can identify, screen or characterize its physico/chemical properties and/or biologic activity to the NRG antagonist provided herein by many measure method as known in the art.
On the one hand, to its antigen-binding activity of antibody test of the present invention, such as the method by known such as ELISA, Western trace etc., carry out.
On the other hand, provide the assay method for the identification of its NRG antagonist with biologic activity.Biologic activity for example can comprise, suppress receptor tyrosine kinase signal conduction that NRG induces, suppress tumor growth, suppress cell proliferation, etc.Also provide in vivo and/or the external antagonist with this type of biologic activity.
In certain embodiments, antagonist of the present invention is tested to this type of biologic activity.The level of the phosphorylation that can induce by the NRG that measures the tyrosine residues of receptor tyrosine kinase in existing and there is no the situation of potential NRG antagonist in one embodiment, is measured the ability that antagonist suppresses the receptor tyrosine kinase signal conduction that NRG induces.Holmes, wait 1992.It is below the exemplary assay method of measuring the phosphorylation state of receptor tyrosine kinase.Together with the NRG antagonist with potential or damping fluid (contrast), preincubation stimulated the cell of expressing Her2 and Her3 (such as the Caov3 cell, or engineered for expressing the cell of Her2 and Her3) with 10nM NRG after 60 minutes.Analyze full cell lysate to measure the level of tyrosine phosphorylation on the Western trace of detecting with antiphosphotyrosine antibody.Can scan trace with quantitative anti-Tyrosine O-phosphate signal.Contrast and compare with damping fluid, the NRG antagonist can reduce the level of tyrosine phosphorylation.In one embodiment, with untreated the contrast, compare, the tyrosine kinase signal conduction that the NRG antagonist is induced NRG suppresses at least 30%, 40%, 50%, 60%70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%.
In certain embodiments, to its ability of cell growth inhibiting or propagation in vitro of antibody test of the present invention.Assay method for cell growth inhibiting or propagation is as known in the art.Measure cell viability with illustrative some assay method for cell proliferation of " cell killing " assay method described herein.A kind of this type of assay method is CellTiter-Glo tMphotogenic cell viability assay method, it can be purchased from Promega (Madison, WI).The number of quantitatively measuring the viable cell in culture of the existing ATP of described assay method based on indication metabolic activity cell.See (1993) J.Immunol.Meth.160:81-88 such as Crouch, U.S. Patent No. 6602677.Can carry out assay method with 96 or 384 well format, make it be suitable for automatization high flux screening (HTS).See (1995) the AntiCancer Drugs6:398-404 such as Cree.These assay method rules involve directly adds single agents to cultured cells
Figure BDA00002023878900291
reagent).This causes lysis, and produces the luminous signal generated by the luciferase reaction.The ATP amount of luminous signal and existence is proportional, and described ATP amount is directly proportional to the viable cell number in being present in culture.Can pass through luminometer or CCD camera imaging device record data.Luminous output is expressed as relative light unit (RLU).
For the another kind of assay method of cell proliferation, be " MTT " assay method, i.e. a kind of colorimetric method, its measuring line plastochondria reductase enzyme is by 3-(4,5-dimethylthiazole-2-yl)-2, and 5-phenylbenzene Thiazolyl blue tetrazolium bromide compound is oxidized to the first moon for (formazan).With CellTiter-Glo tMassay method is the same, the number of the metabolic activity cell existed in this assay method indicator cells culture.See (2005) Cancer Res.65:3877-3882 such as Mosmann (1983) J.Immunol.Meth.65:55-63 and Zhang.
On the one hand, the NRG antagonist is tested to its ability of inducing cell death in vitro.Assay method for inducing cell death is as known in the art.In some embodiments, this type of assay method is measured for example forfeiture of film integrality, as the picked-up by propidium iodide (PI), Trypan Blue (seeing (1995) Cytotechnology, the 17:1-11 such as Moore) or 7AAD indication.In exemplary PI picked-up assay method, the Eagle substratum (D-MEM) by cell in the DulbeccoShi improvement that is supplemented with 10% heat-inactivated FBS (Hyclone) and 2mM L-glutaminate: cultivate in HamShi F-12 (50:50).So, implement assay method in the situation that there is no complement and immune effector cell.By cell in the 100x20mm ware with every ware 3x10 6density inoculation, and allow to adhere to and spend the night.Substratum is removed, and changed with the substratum of independent fresh culture or the antibody that contains each concentration or immunoconjugates.By the cell incubation period of 3 days.After processing, individual layer is cleaned with PBS, and separate by trypsin treatment.Then, by cell with 1200rpm in centrifugal 5 minutes of 4 ° of C, the Ca cold at 3ml by granule 2+(10mMHepes, pH 7.4,140mM NaCl, 2.5mM CaCl for binding buffer liquid 2) in resuspended, and halving sampling enters in the 12x 75mm pipe that the 35mm filter screen adds cap (every pipe 1ml, each treatment group 3 pipe) to remove cell lump.Then, pipe is accepted PI (10 μ g/ml).Use FACSCAN tMflow cytometer and FACSCONVERT tMcellQuest software (Becton Dickinson) analytic sample.So, identify the antibody of the necrocytosis level of inducing statistically significant, as absorbed mensuration by PI.
On the one hand, the NRG antagonist is tested to its ability of apoptosis-induced (apoptosis) in vitro.A kind of exemplary assay method for apoptosis-induced antibody or immunoconjugates is the annexin binding assay.In an exemplary annexin binding assay, by cell cultures, and inoculate in ware, as discussed in the previous paragraph.Substratum is removed, and replaced with the substratum of independent fresh culture or the antibody that contains 0.001 to 10 μ g/ml or immunoconjugates.After 3 days incubation period, individual layer is cleaned with PBS, and separate by trypsin treatment.Then, by cell centrifugation, at Ca 2+resuspended in binding buffer liquid, and halving sampling enters in pipe, as discussed in the previous paragraph.Then, pipe is accepted the annexin (for example annexin V-FITC) (1 μ g/ml) through mark.Use FACSCAN tMflow cytometer and FACSCONVERT tMcellQuest software (BD Biosciences) analytic sample.So, identify and induce the antibody of the annexin of statistically significant in conjunction with level with respect to contrast.For apoptosis-induced antibody or the exemplary assay method of another kind of immunoconjugates, it is the histone DNA ELISA colorimetric method of degrading between the nucleosome for detection of genomic dna.Can use for example necrocytosis to detect ELISA test kit (Roche, Palo Alto, CA) and implement this type of assay method.
The cell used in any above-mentioned external test method comprises natural expression NRG or engineered for expressing cell or the clone of NRG.This type of cell comprises with respect to the normal cell of same tissue origin crosses the tumour cell of expressing NRG.This type of cell also comprises the clone (comprising tumor cell line) of expressing NRG and does not usually express NRG, has still used the clone of the nucleic acid transfection of coding NRG.
On the one hand, the NRG antagonist is tested to its ability of cell growth inhibiting or propagation in vivo.In certain embodiments, the NRG antagonist is tested to the ability that it suppresses tumor growth in vivo.Can use body inner model system, such as xenograft models, carry out this class testing.In exemplary heterograft system, human tumor cells is imported to the suitably non-human animal of immunocompromised host, for example, in athymia " naked " mouse.Animal is used to antibody of the present invention.Measure the ability of antibody suppression or reduction tumor growth.In some embodiment of above-mentioned heterograft system, human tumor cells is the tumour cell from people patient.This type of xenograft models can be purchased from Oncotest GmbH (Frieberg, Germany).In certain embodiments, human tumor cells is the cell from human tumor cell line.In certain embodiments, by subcutaneous injection or by being implanted into suitable position, in the non-human animal who in mammary fat pad, human tumor cells is imported to immunocompromised host suitably.
In certain embodiments, with untreated the contrast, compare, the NRG antagonist is by cell inhibitory effect at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%.In other embodiments, with untreated the contrast, compare, the NRG antagonist suppresses at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% by tumor growth.
2.NRG Binding peptide
Can use in the method for the invention NRG Binding peptide or its fragment of specific binding NGR, for example, with in conjunction with and isolate NGR albumen, stop thus the conduction of its signal.Preferably, NRG polypeptide or its fragment are soluble forms.In some embodiments, the soluble form of polypeptide passes through in conjunction with NGR, and the biologic activity that stops thus the natural binding partners of itself and its to be combined NGR applies inhibition.
3. fit
Fit is to form the specific binding target molecule, such as the nucleic acid molecule of the tertiary structure of NRG polypeptide.Fit generation and therapeutic use are to improve and set up in this area.See for example U.S. Patent No. 5,475,096.About the fit visible U.S. Patent Application Publication text of other information No.20060148748.
4. peptide body
The peptide body is the peptide sequence that is connected of aminoacid sequence with fragment or the part of coding immunoglobulin molecules.Polypeptide can, from any method by for specific binding, include but not limited to that the selected randomized sequence of display technique of bacteriophage is derivative.In a preferred embodiment, selected polypeptide can be connected with the Fc aminoacid sequence partly of coding immunoglobulin (Ig).The peptide body of specific binding antagonism NRG also can be used for method of the present invention.
5. Antagonism nucleic acid
Other NRG antagonist is sense-rna or the DNA construct of using antisense technology to prepare, and wherein for example sense-rna or DNA molecular, by the mRNA hybridization fixed with target, and stop protein translation to work directly to block the translation of mRNA.Can via triple helix formation or antisense DNA or RNA, come controlling gene to express with antisense technology, this all combination to DNA or RNA based on polynucleotide of two kinds of methods.For example, can use 5 ' encoding section of the polynucleotide sequence of the coding ripe NRG polypeptide herein design length of assigning to is the about antisense rna oligonucleotide of 10 to 40 base pairs.By the DNA oligonucleotide design, be that (triple helix, be shown in Lee etc., Nucl.Acids Res., 6:3073 (1979) with involving the gene regions complementation of transcribing; Cooney etc., Science, 241:456 (1988); Dervan etc., Science, 251:1360 (1991)), stop thus transcribing and generating of NRG polypeptide.Antisense rna oligonucleotide is hybridized with mRNA in vivo, and blocking-up mRNA molecule is translated into NRG polypeptide (antisense-Okano, Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press:Boca Raton, FL, 1988).Also oligonucleotide as described above can be delivered to cell, make antisence RNA in vivo or DNA to suppress the generation of NRG polypeptide.When using antisense DNA, from translation initiation site (, for example the pact of target gene nucleotide sequence-10 and+10 positions between) derivative oligodeoxyribonucleotide is preferred.
SiRNA (siRNA) is the double stranded rna molecule that the length of reduction expression of target gene is generally less than 30 Nucleotide.Verified siRNA can be used as the instrument (Shi Y., Trends in Genetics 19 (1): 9-12 (2003)) in the research of failed regulate gene expression of wherein traditional antagonist such as small molecules or antibody.Length is that external synthetic, the double-stranded RNA of 21 to 23 Nucleotide can serve as RNA interfering (iRNA), and energy specific inhibition of gene expression (Fire A., Trends in Genetics 391; 806-810 (1999)).These iRNA work to the degraded of its target RNA by mediation.Yet, because their length is under 30 Nucleotide, so they do not trigger the cell anti-virus defense mechanism.In some embodiments of the present invention, the part of the encoding sequence of siRNA and NRG coded polynucleotide or its complement has at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity.
6. oligopeptides
NRG of the present invention is combination in conjunction with oligopeptides, and preferred specific binding is the oligopeptides of NRG as described in this article.In conjunction with oligopeptides, can or can prepare and purifying with recombinant technology with known oligopeptides synthetic method chemosynthesis by NRG.NRG in conjunction with the length of oligopeptides normally at least about 5 amino acid, perhaps length is at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 amino acid or more, wherein this type of oligopeptides can in conjunction with, preferred specific binding is NRG as described in this article.Can use known technology to identify that in the situation without undo experimentation NRG is in conjunction with oligopeptides.In this, notice that technology for oligopeptides that can specific binding polypeptide target thing to the oligopeptides library screening is as known in the artly (to see for example U.S. Patent No. 5,556,762,5; 750,373,4,708; 871,4,833,092; 5,223,409,5; 403,484,5,571; 689,5,663,143; The open text No.WO 84/03506 of PCT and WO84/03564; Geysen etc., Proc.Natl.Acad.Sci.U.S.A., 81:3998-4002 (1984); Geysen etc., Proc.Natl.Acad.Sci.U.S.A., 82:178-182 (1985); Geysen etc., in Synthetic Peptides as Antigens, 130-149 (1986); Geysen etc., J.Immunol.Meth., 102:259-274 (1987); Schoofs etc., J.Immunol., 140:611-616 (1988), Cwirla, S.E. etc. (1990) Proc.Natl.Acad.Sci.USA, 87:6378; Lowman, H.B. etc. (1991) Biochemistry, 30:10832; Clackson, T. etc. (1991) Nature, 352:624; Marks, J.D. etc. (1991), J.Mol.Biol., 222:581; Kang, A.S. etc. (1991) Proc.Natl.Acad.Sci.USA, 88:8363, and Smith, G.P. (1991) Current Opin.Biotechnol., 2:668).
In this, (bacterium) phage display is a kind of known technology, its allow the large oligopeptides library of screening with identify in those libraries can specific binding polypeptide target thing the member.Phage display is a kind of technology that variant polypeptide is showed on the phage particle surface with the fusion rotein with coat protein (Scott, J.K. and Smith, G.P. (1990) Science, 249:386).The effectiveness of phage display is following truth, can be to the large library of the randomized protein variant of selectivity (or random clone cDNA) those sequences with the high-affinity binding target molecule of sorting fast and effectively.Peptide (Cwirla, S.E. etc. (1990) Proc.Natl.Acad.Sci.USA, 87:6378) or protein (Lowman, H.B. etc. (1991) Biochemistry, 30:10832 on phage have been used; Clackson, T. etc. (1991) Nature, 352:624; Marks, J.D. etc. (1991), J.Mol.Biol., 222:581; Kang, (1991) Proc.Natl.Acad.Sci.USA such as A.S., 88:8363) (Smith, G.P. (1991) Current Opin.Biotechnol., the 2:668) that screening has the particular combination characteristic to millions of peptide species or oligopeptides showed in library.The phage library of sorting random mutation body need a kind of for the strategy that builds and breed a large amount of variants, a kind of rules of using the target acceptor to carry out affinity purification and a kind of assessment the means in conjunction with the result of enrichment.U.S. Patent No. 5,223,409,5,403,484,5,571,689 and 5,663,143.
The method that generates peptide library and these libraries of screening also is disclosed in U.S. Patent No. 5,723,286,5,432,018,5,580,717,5,427,908,5,498,530,5,770,434,5,734,018,5,698,426,5,763,192 and 5,723,323.
7. small molecules
In some embodiments, NRG is combination in conjunction with small molecules, preferably the specific binding organic molecule different from oligopeptides or antibody as defined herein of NRG as described in this article.Can use currently known methods (seeing for example open text No.WO00/00823 of PCT and WO00/39585) to identify that also chemosynthesis NRG is in conjunction with organic molecule.NRG is less than approximately 2000 dalton usually in conjunction with organic micromolecular size, perhaps size is less than approximately 1500,750,500,250 or 200 dalton, wherein can use known technology to identify in the situation without undo experimentation can be in conjunction with, preferred specific binding this organic micromolecule of NRG as described in this article.In this, notice that the technology for molecule that can Binding peptide target thing to the organic molecule library screening is (seeing for example open text No.WO00/00823 of PCT and WO00/39585) as known in the art.NRG can be aldehyde for example in conjunction with organic molecule, ketone, oxime, hydrazone, semicarbazone, carbohydrazide (carbazide), primary amine, secondary amine, tertiary amine, the hydrazine that N-replaces, hydrazides, alcohol, ether, mercaptan, thioether, disulphide, carboxylic acid, ester, acid amides, urea, carbamate, carbonic ether, ketal, thioketal (thioketal), acetal, thioacetal, aryl halide, aromatic yl sulphonate, haloalkane, the hydrocarbyl sulfonic ester, aromatics, heterogeneous ring compound, aniline, alkene, alkynes, glycol, amino alcohol,
Figure BDA00002023878900341
azoles alkane,
Figure BDA00002023878900342
azoles quinoline, thiazolidine, thiazoline, enamine, sulphonamide, epoxide, aziridine, isocyanic ester, SULPHURYL CHLORIDE, diazonium compound, acid chloride, etc.
8. immunoconjugates
The present invention also provides and has comprised and one or more cytotoxic agents, the immunoconjugates of the NRG antagonist herein of for example, puting together such as chemotherapeutic or medicine, growth inhibitor, toxin (, the enzyme activity toxin of archon, bacterium, fungi, plant or animal origin or its fragment) or radio isotope.
In one embodiment, immunoconjugates is antibody-drug conjugates (ADC), and wherein antibody and one or more medicines are puted together, include but not limited to that maytansinoid (is shown in U.S. Patent No. 5,208,020,5,416,064 and European patent EP 0 425235B1); Auristatin is such as monomethyl auristatin medicine module DE and DF(MMAE and MMAF) (seeing U.S. Patent No. 5,635,483 and 5,780,588 and 7,498,298); Dolastatin (dolastatin); Calicheamicin (calicheamicin) or derivatives thereof (is shown in U.S. Patent No. 5,712,374,5,714,586,5,739,116,5,767,285,5,770,701,5,770,710,5,773,001 and 5,877,296; Hinman etc., Cancer Res.53:3336-3342 (1993); And Lode etc., Cancer Res.58:2925-2928 (1998)); Anthracycline antibiotics such as daunomycin (daunomycin) or Dx (doxorubicin) (are shown in Kratz etc., Current Med.Chem.13:477-523 (2006); Jeffrey etc., Bioorganic& Med.Chem.Letters16:358-362 (2006); Torgov etc., Bioconj.Chem.16:717-721 (2005); Nagy etc., Proc.Natl.Acad.Sci.USA 97:829-834 (2000); Dubowchik etc., Bioorg.& Med.Chem.Letters 12:1529-1532 (2002); King etc., J.Med.Chem.45:4336-4343 (2002); And U.S. Patent No. 6,630,579); Methotrexate; Vindesine (vindesine); Taxan (taxane) is such as docetaxel (docetaxel), Taxol, larotaxel, tesetaxel and ortataxel; Trichothecin (trichothecene); And CC1065.
In another embodiment, immunoconjugates comprises the antibody as described in this article of puting together with enzyme activity toxin or its fragment, and described enzyme activity toxin includes but not limited to diphtheria A chain, the non-binding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa (Pseudomonas aeruginosa)), ricin (ricin) A chain, toxalbumin (abrin) A chain, capsule lotus root toxalbumin (modeccin) A chain, α-broom aspergillin (sarcin), tung oil tree (Aleutites fordii) toxalbumin, Dianthus caryophyllus L. (dianthin) toxalbumin, dyers' grapes (Phytolaca americana) albumen (PAPI, PAPII and PAP-S), balsam pear (Momordica charantia) inhibition, curcin (curcin), crotin (crotin), Saponaria officinalis (sapaonaria officinalis) inhibitor, white tree toxalbumin (gelonin), NSC-69529 (mitogellin), restrictocin (restrictocin), phenomycin (phenomycin), enomycin (enomycin) and trichothecin (trichothecenes).
In another embodiment, immunoconjugates comprises the antibody as described in this article of puting together to form the radioactivity conjugate with radioactive atom.Multiple radio isotope can be used for generating the radioactivity conjugate.Example comprises At 211, I 131, I 125, Y 90, Re 186, Re 188, Sm 153, Bi 212, P 32, Pb 212radio isotope with Lu.When using the radioactivity conjugate to be detected, it can comprise the radioactive atom for scintillation method research, for example tc99m or I123, or (be called again nuclear magnetic resonance for nucleus magnetic resonance (NMR) imaging, mri) spin label of use, such as iodo-123, iodine-131 again, indium-111, fluoro-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron.
Can generate with multiple bifunctional protein coupling agent the conjugate of antibody and cytotoxic agent, such as N-succinimido 3-(2-pyridyl dithio) propionic ester (SPDP), succinimido-4-(N-maleimide amino methyl) hexanaphthene-1-carboxylicesters (SMCC), imino-sulfane (IT), imido-ester (all example hydrochloric acid hexanedioyl imido acid dimethyl esters), active ester class (such as suberic acid two succinimido esters), aldehydes (such as glutaraldehyde), double azido compound (such as two (p-azido benzoyl base) hexanediamine), dual azepine derivatives (such as two (p-diazobenzene formyl radical)-quadrols), diisothio-cyanate is (such as toluene 2, the 6-vulcabond), with the double activated fluorine cpd (such as 1, 5-bis-fluoro-2, the 4-dinitrobenzene) dual-function derivative.For example, can be as Vitetta etc., Science 238:1098 prepares the ricin immunotoxin described in (1987).The 1-isothiocyanic acid benzyl of carbon-14 mark-3-methyl diethylene triaminepentaacetic acid(DTPA) (MX-DTPA) is for the exemplary sequestrant by radioactive nuleus thuja acid and antibody coupling.Referring to WO94/11026.Joint can be " can cut joint " of being convenient to release cells drug toxicity in cell.For example, sour unstable joint, peptase susceptibility joint, photo-labile joint, dimethyl joint be can use or disulphide joint (Chari etc., Cancer Res 52:127-131 (1992) contained; U.S. Patent No. 5,208,020).
Immunoconjugates or ADC are herein clearly contained, but this type of conjugate that is not limited to prepare with cross-linking reagent, described cross-linking reagent includes but not limited to BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo-GMBS, sulfo-KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC, and sulfo-SMPB, and SVSB (succinimido-(4-vinyl sulphone) benzoic ether), they be commercial (for example, from Pierce Biotechnology, Inc., Rockford, IL., U.S.A).
B. for the method and composition of diagnosis and detection
In certain embodiments, the NRG antagonist provided herein can be used for the imitate existence of NRG in product of detection of biological.As used herein, term " detection " is contained quantitatively or qualitative detection.In certain embodiments, biological sample comprises cell or tissue, such as lung tissue or breast tissue.
In one embodiment, provide the anti-NRG antibody used in diagnosis or detection method.Aspect another, the method that provides detection of biological to imitate the existence of NRG in product.In certain embodiments, the method is included under the condition of allowing anti-NRG antibodies NRG biological sample is contacted with anti-NRG antibody, as described in this article, and detects whether between anti-NRG antibody and NRG, form mixture.These class methods can be external or the interior method of body.In one embodiment, with anti-NRG antibody, select to be applicable to the experimenter with anti-NRG Antybody therapy, for example wherein NRG is a kind of for selecting patient's biological marker.
In one embodiment, if the patient has, want or likely become therapy is had to the cancer of resistance, select this patient to use the NRG antagonist for treating.An aspect of of the present present invention provides a kind of assay method, and whether its mensuration patient has is wanted or likely become therapy is had to the cancer of resistance.In one embodiment, this assay method comprises that the tumour cell mensuration NRG to gathering from the patient expresses, and wherein the expression of NRG indication patient has will or likely become the cancer of resistance to therapy.In one embodiment, if the NRG expression level in tumour is less than the NRG expression level in tumour TRIC, the patient is chosen as to have and wants or likely become therapy is had to the cancer of resistance.
In one embodiment, if the patient has in the cancer with likely recurring after the therapeutical agent treatment, select this patient to use the NRG antagonist for treating.An aspect of of the present present invention provides a kind of assay method, and whether it measures the patient and have in the cancer with likely recurring after the therapeutical agent treatment.In one embodiment, this assay method comprises that the tumour cell from patient's collection is measured to NRG expresses, and wherein the expression of NRG indication patient has in the cancer with likely recurring after the therapeutical agent treatment.In one embodiment, if the NRG expression level in tumour is less than the NRG expression level in tumour TRIC, the patient is chosen as and has by the cancer of recurrence likely after therapeutical agent treatment.
In certain embodiments, the diagnostic assay method comprises the expression of using immunohistochemistry for example, in situ hybridization or RT-PCR to measure neuregulin in tumour cell.In other embodiments, the diagnostic assay method comprises the expression level that uses quantitative RT-PCR for example to measure neuregulin in tumour cell.In some embodiments, the diagnostic assay method further comprises the expression level of comparing the mensuration neuregulin with control tissue such as for example non-carcinous adjacent tissue.
In certain embodiments, provide the anti-NRG antibody through mark.Marker includes but not limited to the marker of direct-detection or module (such as fluorescence, color development, electron dense, chemoluminescence and radioactively labelled substance), and for example via the module of enzyme reaction or interaction of molecules indirect detection, such as enzyme or part.Exemplary marker includes but not limited to radio isotope 32p, 14c, 125i, 3h and 131i, fluorophore is such as Rare Earth Chelate or fluorescein and derivative thereof, rhodamine (rhodamine) and derivative thereof, dansyl, Umbelliferone, luciferase, for example, Fluc and bacteriofluorescein enzyme (U.S. Patent No. 4, 737, 456), luciferin, 2, 3-dihydro phthalazine diketone, horseradish peroxidase (HRP), alkaline phosphatase, beta-galactosidase enzymes, glucoamylase, N,O-Diacetylmuramidase, the carbohydrate oxydase, for example, glucose oxidase, galactose oxidase, and glucose-6-phosphate dehydrogenase (G6PD), heterocycle oxydase such as uriKoxidase and XOD (its with the enzyme that adopts the hydrogen peroxide oxidation dyestuff former such as the HRP coupling), lactoperoxidase, or microperoxisome, vitamin H/affinity element, spin label, the phage marker, stable free radical, etc..
C. therapeutic method and composition
The NRG antagonist provided herein can be provided in therapeutic method.
On the one hand, provide the NRG antagonist as drug use.Aspect other, provide the NRG antagonist used in the treatment cancer.In certain embodiments, provide the NRG antagonist used in methods for the treatment of.In certain embodiments, the invention provides in treatment and have the NRG antagonist used in the method for individuality of cancer, described method comprises the NRG antagonist of individuality being used to significant quantity.In this type of embodiment, described method further comprises at least one other therapeutical agent of individuality being used to significant quantity, for example, and as described below.In other embodiment, the invention provides the NRG antagonist used in the patient of cancer return has been experienced in treatment.In certain embodiments, the invention provides the NRG antagonist used in the method to the resistance with the therapeutical agent treatment in the prevention individuality, described method comprises uses the NRG antagonist of significant quantity to prevent the resistance to therapeutical agent to individuality.
Aspect another, the invention provides the purposes of NRG antagonist in manufacturing or preparing medicine.In one embodiment, medicine is used for the treatment of cancer.In another embodiment, medicine is used in the method for the treatment of cancer, and described method comprises that the individuality to having cancer uses the medicine of significant quantity.In this type of embodiment, described method further comprises at least one other therapeutical agent of individuality being used to significant quantity, for example as described below.In another embodiment, medicine is for preventing the patient to the resistance with the therapeutical agent treatment.In another embodiment, medicine is for preventing the recurrence of patient's cancer.
Aspect another, the invention provides pharmaceutical formulation, any NRG antagonist provided herein is provided for it, for example in any above-mentioned therapeutic method, uses.In one embodiment, any NRG antagonist and the pharmaceutical acceptable carrier provided herein is provided pharmaceutical formulation.In another embodiment, any NRG antagonist and at least one other therapeutical agent provided herein is provided pharmaceutical formulation, for example as described below.
An embodiment provides pharmaceutical composition or the medicine that contains NRG antagonist and treatment inert support, thinner or vehicle, and uses compound of the present invention to prepare the method for such composition and medicine.In an example, can by envrionment temperature at suitable pH, and can accept carrier with purity and the physiology of expectation, dosage and the concentration carrier nontoxic to the recipient in employing is mixed into the galenical administration form and carrys out the preparation compound.The pH of preparaton depends primarily on specific end use and the concentration of compound, but preferably, and scope is approximately 3 to about any numerical value of 8.In an example, compound is prepared in acetate buffer (being pH 5).In another embodiment, compound is aseptic.For example, can, by compound with solid or amorphous compositions, with freeze-dried formulation or with aqueous solution, store.
By mixing have expectation this type of antagonist of purity and one or more optional pharmaceutical acceptable carriers (Remington ' s Pharmaceutical Sciences the 16th edition, Osol, A. compiles (1980)) mix and prepare the pharmaceutical formulation of NRG antagonist as described in this article with freeze-dried formulation or aqueous solution form.Usually, pharmaceutical acceptable carrier is nontoxic at adopted dosage and concentration to the recipient, and includes but not limited to buffer reagent, such as phosphoric acid salt, Citrate trianion and other organic acid; Antioxidant, comprise xitix and methionine(Met); Sanitas is (such as octadecyl dimethyl benzyl ammonium chloride; Chlorination hexane diamine; Benzalkonium chloride, benzethonium chloride; Phenol, butanols or phenylcarbinol; The P-hydroxybenzoic acid hydrocarbyl carbonate, such as methyl p-hydroxybenzoate or propyl ester; Pyrocatechol; Resorcinol; Hexalin; The 3-amylalcohol; And meta-cresol); Lower molecular weight (being less than approximately 10 residues) polypeptide; Protein, such as serum albumin, gelatin or immunoglobulin (Ig); Hydrophilic polymer, such as polyvinylpyrrolidone; Amino acid, such as glycine, glutamine, l-asparagine, Histidine, arginine or Methionin; Monose, disaccharides and other carbohydrate, comprise glucose, seminose or dextrin; Sequestrant, such as EDTA; Carbohydrate, such as sucrose, N.F,USP MANNITOL, trehalose or sorbyl alcohol; The salify counter ion, such as sodium; Metal composite (for example Zn-protein complex); And/or nonionogenic tenside, such as polyoxyethylene glycol (PEG).Exemplary pharmaceutical acceptable carrier herein further comprises the neutral active Unidasa glycoprotein (sHASEGP) of interstitial medicine dispersion agent such as solubility, and human soluble PH-20 Unidasa glycoprotein for example, such as rHuPH20 baxter International, Inc.).The sHASEGP that some is exemplary and using method, comprise that rHuPH20 is recorded in the open text No.2005/0260186 and 2006/0104968 of United States Patent (USP).On the one hand, sHASEGP and one or more other glycosaminoglycan enzymes are combined such as chondroitinase.
Exemplary lyophilized antibodies preparaton is recorded in U.S. Patent No. 6,267,958.The water-based antibody formulations comprises that those are recorded in U.S. Patent No. 6,171,586 and WO2006/044908, and rear a kind of preparaton comprises Histidine-acetate buffer.
With the mode consistent with good medical practice prepare, dosed administration and use composition.The factor of considering in this context comprise clinical condition, the illness of treated concrete illness, the concrete patient who treats, individual patients cause, deliver the other factors that position, the method for using, the schedule of using and the medical science practitioner of medicament know.
According to the method for drug administration, the pharmaceutical composition of packaging application (or preparaton) in many ways.Usually, the commodity of sale comprise the container of the pharmaceutical formulation with suitable form of wherein depositing.Suitable container is well known to a person skilled in the art, and comprise material such as bottle (plastic cement and glass), pouch, ampoule, plastics bag, metallic cylinder (cylinder), etc.Container can also comprise anti-tampering assembly (assemblage) to stop the content that accidentally approaches packing.In addition, container has the label of depositing on it, and it describes the content of container.Label can also comprise suitable warning.
Can prepare extended release preparation.The suitable example of extended release preparation comprises the semipermeability matrix of the solid hydrophobic polymkeric substance that contains compound, and this matrix is the shaping commercial form, for example film, or microcapsule.The example of sustained release matrix comprises that polyester, hydrogel (for example poly-(2-hydroxyethyl-methacrylic ester), or poly-(vinyl alcohol)), polylactide, Pidolidone and the multipolymer of γ-ethyl-Pidolidone ester, nondegradable ethane-acetic acid ethyenyl, degradable lactic acid-ethanol copolymer are such as LUPRONDEPOT tM(the Injectable microspheres body formed by lactic acid-ethanol copolymer and leuprorelin acetate), and poly--D-(-)-3-hydroxybutyrate.
In an example, the pharmacy effective dose of the NRG antagonist that every dose of parenteral is used can be at about 0.01-100mg/kg every day, or approximately in the scope of 0.1 to 20mg/kg weight in patients, and the typical initial range of the compound used is 0.3 to 15mg/kg/ days.In another embodiment, preferably, the oral dosage form, contain such as Tablet and Capsula the 5-100mg compound of the present invention of having an appointment.
Can be by any suitable means, comprise oral, surface (comprise containing clothes and hypogloeeis), rectum, vagina, in skin, parenteral, subcutaneous, intraperitoneal, lung, in intracutaneous, sheath and in epidural and nose, if reach and be expected to be useful in topical therapeutic, use the NRG antagonist in damage.The parenteral infusion comprises intramuscular, intravenously, intra-arterial, intraperitoneal or subcutaneous administration.
Part is of short duration or long-term according to using, and dosed administration can pass through any suitable path, for example, by injection, such as intravenously or subcutaneous injection, carries out.Contain various dosed administration schedules herein, include but not limited to single administration or repeatedly using, injecting and use and the pulse infusion in a plurality of time points.
Can be with any administration form easily, for example, tablet, powder, capsule, solution, dispersion, suspension, syrup, spraying, suppository, gel, emulsion, paster etc. are used the NRG antagonist.Such composition can contain component conventional in medicinal preparations, for example, and thinner, carrier, pH properties-correcting agent, sweetener, weighting agent and other promoting agent.
Prepare typical preparaton by mixing compound of the present invention and carrier or vehicle.Suitable carrier and vehicle are well known to a person skilled in the art; and for example be recorded in detail; Ansel; Howard C.; Deng; Ansel ' s Pharmaceutical Dosage Forms and Drug Delivery Systems.Philadelphia:Lippincott, Williams & Wilkins, 2004; Gennaro, the Remington:The Science and Practice of Pharmacy.Philadelphia:Lippincott such as Alfonso R., Williams & Wilkins, 2000; And Rowe, Raymond C.Handbook of Pharmaceutical Excipients.Chicago, Pharmaceutical Press, 2005.Preparaton can also comprise one or more buffer reagents, stablizer, tensio-active agent, wetting agent, lubricant, emulsifying agent, suspending agent, sanitas, antioxidant, contrast medium (opaquing agent), glidant, processing aid, tinting material, sweetener, send out pastil (perfuming agent), perfume compound, thinner and other known additive to provide medicine (, compound of the present invention or its pharmaceutical composition) gracefulness present or help to manufacture medicament production (that is, medicine).
The example of suitable oral dosage form is the tablet that contains approximately 25mg, the 50mg, 100mg, 250mg or the 500mg compound of the present invention that mix with about 90-30mg lactose hydrous, about 5-40mg croscarmellose sodium, about 5-30mg polyvinylpyrrolidone (PVP) K30 and about 1-10mg Magnesium Stearate.At first, the powdery composition is mixed, then mix with the solution of PVP.Can be by the composition dries of gained, granulation, with Magnesium Stearate, mix, and use conventional equipment to be compressed into tablet form.Can for example pass through, by compound of the present invention (5-400mg) at suitable buffered soln, for example in phosphate buffered saline buffer, dissolve, if want, add tension regulator (tonicifier), for example salt such as sodium-chlor prepares the example of aerosol preparaton.Can for example with 0.2 micron filter, carry out filtering solution, to remove impurity and pollutent.
Therefore, embodiment comprises the pharmaceutical composition of inclusion compound or its steric isomer or pharmaceutically acceptable salt.Comprise inclusion compound or its steric isomer or pharmaceutically acceptable salt in another embodiment, and the pharmaceutical composition of pharmaceutical acceptable carrier or vehicle.
In the situation of antibody, once or in a series of treatments to the suitable administration of antibodies of patient.According to type and the seriousness of disease, about 1 μ g/kg to 15mg/kg(0.1mg/g-10mg/kg for example) antibody can be the initial candidate dosage that the patient is used, and no matter for example by the one or many separate administration, or is undertaken by continuous infusion.According to factor referred to above, a kind of scope of typical every per daily dose can be about 1 μ g/kg to 100mg/kg or more.For several days or longer in repetitive administration, according to situation, generally understand continued treatment, until occur the expectation of disease symptoms is suppressed.A kind of exemplary dosage of antibody can be at about 0.05mg/kg to the scope of about 10mg/kg.So, can to the patient use one or approximately 0.5mg/kg, 2.0mg/kg, 4.0mg/kg or 10mg/kg(or its any combination of multi-agent).Can be for example weekly or within every three weeks, intermittently use this type of dosage (for example make the patient accept approximately 2 to approximately 20, or for example about 6 doses of antibody).Can use initial higher loading dosage, be then one lower or multi-agent.Yet other dosage can be useful.Easily monitor the progress of this therapy by conventional technology and assay method.
Should be appreciated that and can replace the NRG antagonist or outside the NRG antagonist, use immunoconjugates of the present invention to implement any above-mentioned preparaton or therapeutic method.
Can be used in combination NRG antagonist of the present invention separately or with other medicament in therapy.For example, can use altogether NRG antagonist of the present invention with at least one other therapeutical agent.
In certain embodiments, other therapeutical agent is the medicament that suppresses the tyrosine kinase receptor approach.In one embodiment, other therapeutical agent suppresses the HER approach.In one embodiment, other therapeutical agent is the inhibitor of EGFR, HER2, HER3 and/or HER4.
As used herein, term " EGFR inhibitor " refer in conjunction with EGFR or otherwise with the EGFR direct interaction, and stop or reduce the compound of its signaling activity, and or be called " EGFR antagonist ".The example of this type of medicament comprises in conjunction with the antibody of EGFR and small molecules.Comprise that in conjunction with the example of the antibody of EGFR monoclonal antibody 579 (ATCC CRL HB 8506), monoclonal antibody 455 (ATCC CRL HB8507), monoclonal antibody 225 (ATCC CRL 8508), monoclonal antibody 528 (ATCC CRL 8509) (be shown in U.S. Patent No. 4,943,533, Mendelsohn etc.) and variant, such as 225(C225 or the Cetuximab (Cetuximab) of chimericization;
Figure BDA00002023878900421
with reconstruct people 225 (H225) (seeing WO96/40210, Imclone Systems Inc.); IMC-11F8, a kind of complete people, EGFR target antibody (Imclone); Antibody (U.S. Patent No. 5,212,290) in conjunction with II type mutant EGFR; In conjunction with the humanized and chimeric antibody of EGFR, as be recorded in U.S. Patent No. 5,891,996; With the people's antibody in conjunction with EGFR, such as ABX-EGF or Victibix (Panitumumab) (seeing WO98/50433, Abgenix/Amgen); EMD 55900 (the Eur.J.Cancer 32A:636-640 (1996) such as Stragliotto); EMD7200(horse trastuzumab (matuzumab)), i.e. a kind of EGFR of the humanization for EGFR antibody, it competes EGFR and is combined (EMD/Merck) with EGF and TGF-α; Human epidermal growth factor receptor antibody HuMax-EGFR (GenMab); Be called E1.1, E2.4, E2.5, E6.2, E6.4, E2.11, E6.3 and E7.6.3 and be recorded in US 6,235,883 fully human antibodies; MDX-447 (Medarex Inc); With monoclonal antibody 806 or humanization monoclonal antibody 806 (Johns etc., J.Biol.Chem.279 (29): 30375-30384 (2004)).Anti-egfr antibodies and cytotoxic agent can be puted together, so generate immunoconjugates (seeing for example EP659,439A2, Merck Patent GmbH).The EGFR antagonist comprises that small molecules is such as being recorded in US Patent No: 5,616,582,5,457,105,5,475,001,5,654,307,5,679,683,6,084,095,6,265,410,6,455,534,6,521,620,6,596,726,6,713,484,5,770,599,6,140,332,5,866,572,6,399,602,6,344,459,6,602,863,6,391,874,6,344,455,5,760,041,6,002,008 and 5,747,498, and open text: the WO98/14451 of following PCT, WO98/50038, the compound of WO99/09016 and WO99/24037.Concrete small molecules EGFR antagonist comprises OSI-774(CP-358774, erlotinib (erlotinib),
Figure BDA00002023878900422
genentech/OSI Pharmaceuticals); PD 183805(CI 1033,2-acrylamide, the chloro-4-fluorophenyl of N-[4-[(3-) amino]-7-[3-(4-morpholinyl) propoxy-]-the 6-quinazolyl]-, dihydrochloride, Pfizer Inc.); ZD1839, Gefitinib (gefitinib) (IRESSA tM) 4-(3 '-chloro-4 '-fluoroanilino)-7-methoxyl group-6-(3-morpholino propoxy-) quinazoline, AstraZeneca); ZM 105180 ((6-amino-4-(3-aminomethyl phenyl-amino)-quinazoline, Zeneca); BIBX-1382 (N8-(the fluoro-phenyl of the chloro-4-of 3-)-N2-(1-methyl-piperidin-4-yl)-Kui Linpyrimido quinoline [5,4-d] pyrimidine-2,8-diamines, Boehringer Ingelheim); PKI-166 ((R)-4-[4-[(1-phenylethyl) amino]-1H-pyrrolo-[2,3-d] pyrimidine-6-yl]-phenol); (R)-6-(4-hydroxy phenyl)-4-[(1-phenylethyl) amino]-7H-pyrrolo-[2,3-d] pyrimidine); CL-387785 (N-[4-[(3-bromophenyl) amino]-the 6-quinazolyl]-2-butylene acid amides (butynamide)); EKB-569 (the chloro-4-fluorophenyl of N-[4-[(3-) amino]-3-cyano group-7-oxyethyl group-6-quinolyl]-4-(dimethylamino)-2-butylene acid amides) (Wyeth); AG1478 (Pfizer); (SU 5271 for AG1571; Pfizer); Dual EGFR/HER2 tyrosine kinase inhibitor is such as lapatinibditosylate (lapatinib)
Figure BDA00002023878900431
the chloro-4-[(3-fluorophenyl of GSK572016 or N-[3-) methoxyl group] phenyl] the 6[5[[[2 methyl sulphonyl) ethyl] amino] methyl]-the 2-furyl]-4-quinazoline amine; Glaxo-SmithKline).
As used herein, term " HER2 inhibitor " refer in conjunction with HER2 or otherwise with the HER2 direct interaction, and stop or reduce the compound of its signaling activity, and or be called " HER2 antagonist ".The example of this type of medicament comprises in conjunction with the antibody of HER2 and small molecules.Specific HER2 antibody comprises handkerchief trastuzumab (pertuzumab) and trastuzumab (trastuzumab).As used herein, term " HER3 inhibitor " refer in conjunction with HER3 or otherwise with the HER3 direct interaction, and stop or reduce the compound of its signaling activity, and or be called " HER3 antagonist ".The example of this type of medicament comprises in conjunction with the antibody of HER3 and small molecules.As used herein, term " HER4 inhibitor " refer in conjunction with HER4 or otherwise with the HER4 direct interaction, and stop or reduce the compound of its signaling activity, and or be called " HER4 antagonist ".The example of this type of medicament comprises in conjunction with the antibody of HER4 and small molecules.
The open text of patent that relates to HER antibody comprises: U.S. Patent No. 5, 677, 171, U.S. Patent No. 5, 720, 937, U.S. Patent No. 5, 720, 954, U.S. Patent No. 5, 725, 856, U.S. Patent No. 5, 770, 195, U.S. Patent No. 5, 772, 997, U.S. Patent No. 6, 165, 464, U.S. Patent No. 6, 387, 371, U.S. Patent No. 6, 399, 063, US2002/0192211A1, U.S. Patent No. 6, 015, 567, U.S. Patent No. 6, 333, 169, U.S. Patent No. 4, 968, 603, U.S. Patent No. 5, 821, 337, U.S. Patent No. 6, 054, 297, U.S. Patent No. 6, 407, 213, U.S. Patent No. 6, 719, 971, U.S. Patent No. 6, 800, 738, US2004/0236078A1, U.S. Patent No. 5, 648, 237, U.S. Patent No. 6, 267, 958, U.S. Patent No. 6, 685, 940, United States Patent (USP) NO.6, 821, 515, WO98/17797, U.S. Patent No. 6, 333, 398, U.S. Patent No. 6, 797, 814, U.S. Patent No. 6, 339, 142, U.S. Patent No. 6, 417, 335, U.S. Patent No. 6, 489, 447, WO99/31140, US2003/0147884A1, US2003/0170234A1, US2005/0002928A1, U.S. Patent No. 6, 573, 043, US2003/0152987A1, WO99/48527, US2002/0141993A1, WO01/00245, US2003/0086924, US2004/0013667A1, WO00/69460, WO01/00238, WO01/15730, U.S. Patent No. 6, 627, 19681, U.S. Patent No. 6, 632, 979B1, WO01/00244, US2002/0090662A1, WO01/89566, US2002/0064785, US2003/0134344, WO 04/24866, US2004/0082047, US2003/0175845A1, WO03/087131, US2003/0228663, WO2004/008099A2, US2004/0106161, WO2004/048525, US2004/0258685A1, U.S. Patent No. 5, 985, 553, U.S. Patent No. 5, 747, 261, U.S. Patent No. 4, 935, 341, U.S. Patent No. 5, 401, 638, U.S. Patent No. 5, 604, 107, WO 87/07646, WO 89/10412, WO91/05264, EP 412, 116B1, EP 494, 135B1, U.S. Patent No. 5, 824, 311, EP 444, 181B1, EP 1, 006, 194A2, US 2002/0155527A1, WO 91/02062, U.S. Patent No. 5, 571, 894, U.S. Patent No. 5, 939, 531, EP 502, 812B1, WO 93/03741, EP 554, 441B1, EP 656, 367A1, U.S. Patent No. 5, 288, 477, U.S. Patent No. 5, 514, 554, U.S. Patent No. 5, 587, 458, WO 93/12220, WO 93/16185, U.S. Patent No. 5, 877, 305, WO93/21319, WO 93/21232, U.S. Patent No. 5, 856, 089, WO 94/22478, U.S. Patent No. 5, 910, 486, U.S. Patent No. 6, 028, 059, WO 96/07321, U.S. Patent No. 5, 804, 396, U.S. Patent No. 5, 846, 749, EP 711, 565, WO 96/16673, U.S. Patent No. 5, 783, 404, U.S. Patent No. 5, 977, 322, U.S. Patent No. 6, 512, 097, WO 97/00271, U.S. Patent No. 6, 270, 765, U.S. Patent No. 6, 395, 272, U.S. Patent No. 5, 837, 243, WO 96/40789, U.S. Patent No. 5, 783, 186, U.S. Patent No. 6, 458, 356, WO 97/20858, WO 97/38731, U.S. Patent No. 6, 214, 388, U.S. Patent No. 5, 925, 519, WO 98/02463, U.S. Patent No. 5, 922, 845, WO 98/18489, WO 98/33914, U.S. Patent No. 5, 994, 071, WO98/45479, U.S. Patent No. 6, 358, 682B1, US 2003/0059790, WO 99/55367, WO01/20033, US 2002/0076695A1, WO 00/78347, WO 01/09187, WO 01/21192, WO 01/32155, WO 01/53354, WO 01/56604, WO 01/76630, WO02/05791, WO02/11677, U.S. Patent No. 6, 582, 919, US2002/0192652A1, US 2003/0211530A1, WO 02/44413, US 2002/0142328, U.S. Patent No. 6, 602, 670B2, WO 02/45653, WO 02/055106, US 2003/0152572, US 2003/0165840, WO 02/087619, WO03/006509, WO03/012072, WO 03/028638, US 2003/0068318, WO 03/041736, EP 1, 357, 132, US 2003/0202973, US 2004/0138160, U.S. Patent No. 5, 705, 157, U.S. Patent No. 6, 123, 939, EP 616, 812B1, US 2003/0103973, US 2003/0108545, U.S. Patent No. 6, 403, 630B1, WO 00/61145, WO 00/61185, U.S. Patent No. 6, 333, 348B1, WO 01/05425, WO 01/64246, US 2003/0022918, US2002/0051785A1, U.S. Patent No. 6, 767, 541, WO 01/76586, US 2003/0144252, WO 01/87336, US 2002/0031515A1, WO 01/87334, WO 02/05791, WO02/09754, US 2003/0157097, US 2002/0076408, WO 02/055106, WO 02/070008, WO 02/089842, WO 03/86467 and US 2010/0255010.
In certain embodiments, other therapeutical agent is chemotherapeutic." chemotherapeutic " refers to can be used for treating the chemical compound of cancer.The example of chemotherapeutant comprises alkylating agent class (alkylating agents), such as phosphinothioylidynetrisaziridine (thiotepa) and endoxan (cyclosphosphamide)
Figure BDA00002023878900451
sulfonic acid hydrocarbyl carbonate class (alkyl sulfonates), such as busulfan (busulfan), Improsulfan (improsulfan) and piposulfan (piposulfan), aziridines (aziridines), such as Benzodepa (benzodepa), card ripple quinone (carboquone), U.S. appropriate in sending (meturedepa) and uredepa (uredepa), Ethylenimine class (ethylenimines) and methylmelamine class (methylamelamines), comprise hemel (altretamine), triethylenemelamine (triethylenemelamine), APO (triethylenephosphoramide), TESPA (triethylenethiophosphoramide) and trimethylolmelamine (trimethylomelamine), Annonaceousacetogenicompounds (acetogenin) (especially bullatacin (bullatacin) and bullatacin ketone (bullatacinone)), delta-9-Tetrahydrocannabinol (tetrahydrocannabinol) (Dronabinol (dronabinol), β-lapachol (lapachone), lapachol (lapachol), colchicine class (colchicines), betulic acid (betulinic acid), camptothecine (camptothecin) (comprises synthetic analogues Hycamtin (topotecan)
Figure BDA00002023878900453
CPT-11(Irinotecan (irinotecan),
Figure BDA00002023878900454
acetyl camptothecine, scopoletin (scopoletin) and 9-aminocamptothecin), bryostatin (bryostatin), callystatin, CC-1065(comprises its Adozelesin (adozelesin), Carzelesin (carzelesin) and Bizelesin (bizelesin) synthetic analogues), podophyllotoxin (podophyllotoxin), podophyllic acid (podophyllinic acid), Teniposide (teniposide), hidden algae element class (cryptophycin) (particularly hidden algae element 1 and hidden algae element 8), dolastatin (dolastatin), duocarmycin(comprises synthetic analogues, KW-2189 and CB1-TM1), Eleutherobin (eleutherobin), pancratistatin, sarcodictyin, sponge chalone (spongistatin), nitrogen mustards (nitrogen mustards), such as Chlorambucil (chlorambucil), Chlornaphazine (chlornaphazine), courage phosphamide (chlorophosphamide), Estramustine (estramustine), ifosfamide (ifosfamide), chlormethine (mechlorethamine), mustron (mechlorethamine oxide hydrochloride), melphalan (melphalan), novoembichin (novembichin), phenesterin (phenesterine), prednimustine (prednimustine), Trofosfamide (trofosfamide), uracil mastard (uracil mustard), nitrosourea (nitrosoureas), such as BCNU (carmustine), chlorozotocin (chlorozotocin), Fotemustine (fotemustine), lomustine (lomustine), Nimustine (nimustine) and Ranimustine (ranimnustine), antibiotics, for example, such as Enediyne Antibiotic (enediyne) (Calicheamicin (calicheamicin), especially Calicheamicin γ 1I and Calicheamicin ω I1(are shown in such as Nicolaou etc., Angew.Chem Intl.Ed.Engl., 33:183-186 (1994)), CDP323, i.e. a kind of oral administration of alpha-4 integrin inhibitor, anthracycline antibiotic (dynemicin), comprise anthracycline antibiotic A, Ai Sibo mycin (esperamicin), and Neocarzinostatin (neocarzinostatin) chromophore and related colour albumen Enediyne Antibiotic chromophore), aclacinomycin (aclacinomycin), D actinomycin D (actinomycin), anthramycin (anthramycin), azaserine (azaserine), bleomycin (bleomycin), act-C (cactinomycin), carabicin, carminomycin (carminomycin), cardinophyllin (carzinophilin), chromomycin (chromomycins), actinomycin D (dactinomycin), daunorubicin (daunorubicin), Detorubicin (detorubicin), 6-phenodiazine-5-oxygen-L-nor-leucine, Doxorubicin (doxorubicin) (comprises
Figure BDA00002023878900461
morpholino Doxorubicin, cyano group morpholino Doxorubicin, 2-pyrroles are for Doxorubicin and Doxil parenteral solution
Figure BDA00002023878900462
liposome Doxorubicin TLC D-99 the liposome Doxorubicin of PEGization
Figure BDA00002023878900464
with the deoxidation Doxorubicin), epirubicin (epirubicin), esorubicin (esorubicin), idarubicin (idarubicin), marcellomycin (marcellomycin), mitomycin (mitomycins) is such as mitomycin C, mycophenolic acid (mycophenolic acid), nogalamycin (nogalamycin), olivomycin (olivomycin), Peplomycin (peplomycin), potfiromycin, puromycin (puromycin), triferricdoxorubicin (quelamycin), rodorubicin (rodorubicin), streptonigrin (streptonigrin), streptozotocin (streptozocin), tubercidin (tubercidin), ubenimex (ubenimex), Zinostatin (zinostatin), zorubicin (zorubicin), the antimetabolite class, such as methotrexate (MTX), gemcitabine (gemcitabine)
Figure BDA00002023878900465
Tegafur (tegafur)
Figure BDA00002023878900466
capecitabine (capecitabine)
Figure BDA00002023878900467
Epothilones (epothilone) and 5 FU 5 fluorouracil (5-FU), folacin, such as denopterin (denopterin), methotrexate (MTX), pteroyltriglutamic acid (pteropterin), Trimetrexate (trimetrexate), purine analogue, such as fludarabine (fludarabine), Ismipur (mercaptopurine), ITG (thiamiprine), thioguanine (thioguanine), pyrimidine analogue, such as ancitabine (ancitabine), azacitidine (azacitidine), 6-azauridine, Carmofur (carmofur), cytarabine (cytarabine), two BrdU (dideoxyuridine), doxifluridine (doxifluridine), enocitabine (enocitabine), floxuridine (floxuridine), androgen such as Calusterone (calusterone), dromostanolone (dromostanolone propionate), epithioandrostanol (epitiostanol), Mepitiostane (mepitiostane), Testolactone (testolactone), anti-adrenal gland class, such as aminoglutethimide (aminoglutethimide), mitotane (mitotane), Trilostane (trilostane), folic acid supplement, such as folinic acid (folinic acid), aceglatone (aceglatone), aldophosphamide glucosides (aldophosphamide glycoside), amino-laevulic acid (aminolevulinic acid), eniluracil (eniluracil), amsacrine (amsacrine), bestrabucil, bisantrene (bisantrene), Edatrexate (edatraxate), Defosfamide (defofamine), demecolcine (demecolcine), diaziquone (diaziquone), elfornithine, Elliptinium Acetate (elliptinium acetate, Epothilones (epothilone), ethoglucid (etoglucid), gallium nitrate, hydroxyl urea (hydroxyurea), lentinan (lentinan), Lonidamine (lonidainine), maytansinoid class (maytansinoids), such as maytansine (maytansine) and ansamitocin (ansamitocin), mitoguazone (mitoguazone), mitoxantrone (mitoxantrone), Mopidamol (mopidamol), C-283 (nitracrine), Pentostatin (pentostatin), Phenamet (phenamet), THP (pirarubicin), Losoxantrone (losoxantrone), 2-ethyl hydrazides (ethylhydrazide), procarbazine (procarbazine),
Figure BDA00002023878900471
polysaccharide compound (JHS NaturalProducts, Eugene, OR), razoxane (razoxane), rhizomycin (rhizoxin), Sizofiran (sizofiran), Spirogermanium (spirogermanium), tenuazonic acid (tenuazonic acid), triethyleneiminobenzoquinone (triaziquone), 2,2 ', 2 '-RA3, trichothecin class (trichothecenes) (especially T-2 toxin, verrucarine (verrucarin) A, roridin (roridin) A and the rhzomorph (anguidin) that crawls), urethane (urethan), eldisine (vindesine)
Figure BDA00002023878900472
Dacarbazine (dacarbazine), mannomustin (mannomustine), dibromannitol (mitobronitol), mitolactol (mitolactol), pipobroman (pipobroman), gacytosine, cytarabine (arabinoside) (" Ara-C "), phosphinothioylidynetrisaziridine (thiotepa), taxoid (taxoid), for example Taxol (paclitaxel)
Figure BDA00002023878900474
nano particle formulation Taxol (ABRAXANETM) and the Taxotere (doxetaxel) of albumin transformation
Figure BDA00002023878900475
Chlorambucil (chloranbucil), 6-thioguanine (thioguanine), purinethol (mercaptopurine), methotrexate (MTX) (methotrexate), the platinum agent, such as cis-platinum (cisplatin), oxaliplatin (oxaliplatin) (for example
Figure BDA00002023878900481
and carboplatin (carboplatin), Changchun medicine class (vincas) (it stops tubulin polymerization to form microtubule), comprise vincaleukoblastinum (vinblastine)
Figure BDA00002023878900482
vincristine (vincristine) eldisine (vindesine)
Figure BDA00002023878900484
and vinorelbine (vinorelbine)
Figure BDA00002023878900485
Etoposide (etoposide) (VP-16), ifosfamide (ifosfamide), mitoxantrone (mitoxantrone), folinic acid (leucovorin), NSC-279836 (novantrone), Edatrexate (edatrexate), daunomycin (daunomycin), aminopterin (aminopterin), ibandronate (ibandronate), topoisomerase enzyme inhibitor RFS 2000, DFMO (DMFO), retinoic acid-like (retinoids), such as retinoic acid (retinoic acid), comprise bexarotene (bexarotene)
Figure BDA00002023878900486
diphosphonates (bisphosphonates), such as clodronate (clodronate) (for example
Figure BDA00002023878900487
or
Figure BDA00002023878900488
etidronate (etidronate) NE-58095, zoledronic acid/zoledronate (zoledronic acid/zoledronate) alendronate (alendronate)
Figure BDA000020238789004811
Pamidronate (pamidronate)
Figure BDA000020238789004812
Tiludronate (tiludronate)
Figure BDA000020238789004813
or Risedronate (risedronate)
Figure BDA000020238789004814
troxacitabine (troxacitabine) (DOX nucleosides cytimidine analog), ASON, particularly suppress to involve the ASON of the gene expression in the signal transduction path of abnormal (abherant) cell proliferation, such as for example PKC-α, Raf, H-Ras and EGF-R ELISA (EGF-R), vaccine, such as vaccine and gene therapy vaccine, for example
Figure BDA000020238789004816
vaccine,
Figure BDA000020238789004817
vaccine and vaccine, topoisomerase 1 inhibitor (for example
Figure BDA000020238789004819
rmRH(for example
Figure BDA000020238789004820
BAY439006(Sorafenib (sorafenib), Bayer), SU-11248(Sutent (sunitinib), Pfizer), perifosine (perifosine), cox 2 inhibitor (for example celecoxib (celecoxib) or etoricoxib (etoricoxib)), proteosome inhibitor (for example PS341), Velcade (bortezomib)
Figure BDA000020238789004822
CCI-779, for pyrrole method Buddhist nun (tipifarnib) (R11577), orafenib, ABT510, Bcl-2 inhibitor such as Ao Limosen sodium (oblimersen sodium)
Figure BDA000020238789004823
pixantrone, EGFR inhibitor (definition sees below), tyrosine kinase inhibitor (definition sees below), serine-threonine kinase inhibitor such as rapamycin (rapamycin) (sirolimus (sirolimus),
Figure BDA000020238789004824
(SCH 6636, SARASAR for farnesyl transferase inhibitor such as Luo Nafani (lonafarnib) TM), and pharmaceutically acceptable salt, acid or the derivative of any above-mentioned substance, and the combination of two or more above-mentioned substances, such as the abbreviation of CHOP(endoxan, Doxorubicin, vincristine and prednisolone conjoint therapy) and FOLFOX(oxaliplatin (ELOXATIN TM) abbreviation of therapeutic scheme of associating 5-FU and folinic acid).The example of chemotherapeutant comprises alkylating agent class (alkylating agents), such as phosphinothioylidynetrisaziridine (thiotepa) and endoxan (cyclosphosphamide)
Figure BDA00002023878900451
sulfonic acid hydrocarbyl carbonate class (alkyl sulfonates), such as busulfan (busulfan), Improsulfan (improsulfan) and piposulfan (piposulfan), aziridines (aziridines), such as Benzodepa (benzodepa), card ripple quinone (carboquone), U.S. appropriate in sending (meturedepa) and uredepa (uredepa), Ethylenimine class (ethylenimines) and methylmelamine class (methylamelamines), comprise hemel (altretamine), triethylenemelamine (triethylenemelamine), APO (triethylenephosphoramide), TESPA (triethylenethiophosphoramide) and trimethylolmelamine (trimethylomelamine), Annonaceousacetogenicompounds (acetogenin) (especially bullatacin (bullatacin) and bullatacin ketone (bullatacinone)), delta-9-Tetrahydrocannabinol (tetrahydrocannabinol) (Dronabinol (dronabinol), β-lapachol (lapachone), lapachol (lapachol), colchicine class (colchicines), betulic acid (betulinic acid), camptothecine (camptothecin) (comprises synthetic analogues Hycamtin (topotecan)
Figure BDA00002023878900453
CPT-11(Irinotecan (irinotecan),
Figure BDA00002023878900454
acetyl camptothecine, scopoletin (scopoletin) and 9-aminocamptothecin), bryostatin (bryostatin), callystatin, CC-1065(comprises its Adozelesin (adozelesin), Carzelesin (carzelesin) and Bizelesin (bizelesin) synthetic analogues), podophyllotoxin (podophyllotoxin), podophyllic acid (podophyllinic acid), Teniposide (teniposide), hidden algae element class (cryptophycin) (particularly hidden algae element 1 and hidden algae element 8), dolastatin (dolastatin), duocarmycin(comprises synthetic analogues, KW-2189 and CB1-TM1), Eleutherobin (eleutherobin), pancratistatin, sarcodictyin, sponge chalone (spongistatin), nitrogen mustards (nitrogen mustards), such as Chlorambucil (chlorambucil), Chlornaphazine (chlornaphazine), courage phosphamide (chlorophosphamide), Estramustine (estramustine), ifosfamide (ifosfamide), chlormethine (mechlorethamine), mustron (mechlorethamine oxide hydrochloride), melphalan (melphalan), novoembichin (novembichin), phenesterin (phenesterine), prednimustine (prednimustine), Trofosfamide (trofosfamide), uracil mastard (uracil mustard), nitrosourea (nitrosoureas), such as BCNU (carmustine), chlorozotocin (chlorozotocin), Fotemustine (fotemustine), lomustine (lomustine), Nimustine (nimustine) and Ranimustine (ranimnustine), antibiotics, for example, such as Enediyne Antibiotic (enediyne) (Calicheamicin (calicheamicin), especially Calicheamicin γ 1I and Calicheamicin ω I1(are shown in such as Nicolaou etc., Angew.Chem Intl.Ed.Engl., 33:183-186 (1994)), CDP323, i.e. a kind of oral administration of alpha-4 integrin inhibitor, anthracycline antibiotic (dynemicin), comprise anthracycline antibiotic A, Ai Sibo mycin (esperamicin), and Neocarzinostatin (neocarzinostatin) chromophore and related colour albumen Enediyne Antibiotic chromophore), aclacinomycin (aclacinomycin), D actinomycin D (actinomycin), anthramycin (anthramycin), azaserine (azaserine), bleomycin (bleomycin), act-C (cactinomycin), carabicin, carminomycin (carminomycin), cardinophyllin (carzinophilin), chromomycin (chromomycins), actinomycin D (dactinomycin), daunorubicin (daunorubicin), Detorubicin (detorubicin), 6-phenodiazine-5-oxygen-L-nor-leucine, Doxorubicin (doxorubicin) (comprises
Figure BDA00002023878900461
morpholino Doxorubicin, cyano group morpholino Doxorubicin, 2-pyrroles are for Doxorubicin and Doxil parenteral solution
Figure BDA00002023878900462
liposome Doxorubicin TLC D-99 the liposome Doxorubicin of PEGization
Figure BDA00002023878900464
with the deoxidation Doxorubicin), epirubicin (epirubicin), esorubicin (esorubicin), idarubicin (idarubicin), marcellomycin (marcellomycin), mitomycin (mitomycins) is such as mitomycin C, mycophenolic acid (mycophenolic acid), nogalamycin (nogalamycin), olivomycin (olivomycin), Peplomycin (peplomycin), potfiromycin, puromycin (puromycin), triferricdoxorubicin (quelamycin), rodorubicin (rodorubicin), streptonigrin (streptonigrin), streptozotocin (streptozocin), tubercidin (tubercidin), ubenimex (ubenimex), Zinostatin (zinostatin), zorubicin (zorubicin), the antimetabolite class, such as methotrexate (MTX), gemcitabine (gemcitabine)
Figure BDA00002023878900465
Tegafur (tegafur)
Figure BDA00002023878900466
capecitabine (capecitabine)
Figure BDA00002023878900467
Epothilones (epothilone) and 5 FU 5 fluorouracil (5-FU), folacin, such as denopterin (denopterin), methotrexate (MTX), pteroyltriglutamic acid (pteropterin), Trimetrexate (trimetrexate), purine analogue, such as fludarabine (fludarabine), Ismipur (mercaptopurine), ITG (thiamiprine), thioguanine (thioguanine), pyrimidine analogue, such as ancitabine (ancitabine), azacitidine (azacitidine), 6-azauridine, Carmofur (carmofur), cytarabine (cytarabine), two BrdU (dideoxyuridine), doxifluridine (doxifluridine), enocitabine (enocitabine), floxuridine (floxuridine), androgen such as Calusterone (calusterone), dromostanolone (dromostanolone propionate), epithioandrostanol (epitiostanol), Mepitiostane (mepitiostane), Testolactone (testolactone), anti-adrenal gland class, such as aminoglutethimide (aminoglutethimide), mitotane (mitotane), Trilostane (trilostane), folic acid supplement, such as folinic acid (folinic acid), aceglatone (aceglatone), aldophosphamide glucosides (aldophosphamide glycoside), amino-laevulic acid (aminolevulinic acid), eniluracil (eniluracil), amsacrine (amsacrine), bestrabucil, bisantrene (bisantrene), Edatrexate (edatraxate), Defosfamide (defofamine), demecolcine (demecolcine), diaziquone (diaziquone), elfornithine, Elliptinium Acetate (elliptinium acetate, Epothilones (epothilone), ethoglucid (etoglucid), gallium nitrate, hydroxyl urea (hydroxyurea), lentinan (lentinan), Lonidamine (lonidainine), maytansinoid class (maytansinoids), such as maytansine (maytansine) and ansamitocin (ansamitocin), mitoguazone (mitoguazone), mitoxantrone (mitoxantrone), Mopidamol (mopidamol), C-283 (nitracrine), Pentostatin (pentostatin), Phenamet (phenamet), THP (pirarubicin), Losoxantrone (losoxantrone), 2-ethyl hydrazides (ethylhydrazide), procarbazine (procarbazine),
Figure BDA00002023878900471
polysaccharide compound (JHS NaturalProducts, Eugene, OR), razoxane (razoxane), rhizomycin (rhizoxin), Sizofiran (sizofiran), Spirogermanium (spirogermanium), tenuazonic acid (tenuazonic acid), triethyleneiminobenzoquinone (triaziquone), 2,2 ', 2 '-RA3, trichothecin class (trichothecenes) (especially T-2 toxin, verrucarine (verrucarin) A, roridin (roridin) A and the rhzomorph (anguidin) that crawls), urethane (urethan), eldisine (vindesine)
Figure BDA00002023878900472
Dacarbazine (dacarbazine), mannomustin (mannomustine), dibromannitol (mitobronitol), mitolactol (mitolactol), pipobroman (pipobroman), gacytosine, cytarabine (arabinoside) (" Ara-C "), phosphinothioylidynetrisaziridine (thiotepa), taxoid (taxoid), for example Taxol (paclitaxel)
Figure BDA00002023878900474
nano particle formulation Taxol (ABRAXANETM) and the Taxotere (doxetaxel) of albumin transformation
Figure BDA00002023878900475
Chlorambucil (chloranbucil), 6-thioguanine (thioguanine), purinethol (mercaptopurine), methotrexate (MTX) (methotrexate), the platinum agent, such as cis-platinum (cisplatin), oxaliplatin (oxaliplatin) (for example
Figure BDA00002023878900481
and carboplatin (carboplatin), Changchun medicine class (vincas) (it stops tubulin polymerization to form microtubule), comprise vincaleukoblastinum (vinblastine)
Figure BDA00002023878900482
vincristine (vincristine) eldisine (vindesine)
Figure BDA00002023878900484
and vinorelbine (vinorelbine)
Figure BDA00002023878900485
Etoposide (etoposide) (VP-16), ifosfamide (ifosfamide), mitoxantrone (mitoxantrone), folinic acid (leucovorin), NSC-279836 (novantrone), Edatrexate (edatrexate), daunomycin (daunomycin), aminopterin (aminopterin), ibandronate (ibandronate), topoisomerase enzyme inhibitor RFS 2000, DFMO (DMFO), retinoic acid-like (retinoids), such as retinoic acid (retinoic acid), comprise bexarotene (bexarotene)
Figure BDA00002023878900486
diphosphonates (bisphosphonates), such as clodronate (clodronate) (for example
Figure BDA00002023878900487
or
Figure BDA00002023878900488
etidronate (etidronate) NE-58095, zoledronic acid/zoledronate (zoledronic acid/zoledronate) alendronate (alendronate)
Figure BDA000020238789004811
Pamidronate (pamidronate)
Figure BDA000020238789004812
Tiludronate (tiludronate)
Figure BDA000020238789004813
or Risedronate (risedronate)
Figure BDA000020238789004814
troxacitabine (troxacitabine) (DOX nucleosides cytimidine analog), ASON, particularly suppress to involve the ASON of the gene expression in the signal transduction path of abnormal (abherant) cell proliferation, such as for example PKC-α, Raf, H-Ras and EGF-R ELISA (EGF-R), vaccine, such as vaccine and gene therapy vaccine, for example
Figure BDA000020238789004816
vaccine,
Figure BDA000020238789004817
vaccine and vaccine, topoisomerase 1 inhibitor (for example
Figure BDA000020238789004819
rmRH(for example
Figure BDA000020238789004820
BAY439006(Sorafenib (sorafenib), Bayer), SU-11248(Sutent (sunitinib), Pfizer), perifosine (perifosine), cox 2 inhibitor (for example celecoxib (celecoxib) or etoricoxib (etoricoxib)), proteosome inhibitor (for example PS341), Velcade (bortezomib)
Figure BDA000020238789004822
CCI-779, for pyrrole method Buddhist nun (tipifarnib) (R11577), orafenib, ABT510, Bcl-2 inhibitor such as Ao Limosen sodium (oblimersen sodium)
Figure BDA000020238789004823
pixantrone, EGFR inhibitor (definition sees below), tyrosine kinase inhibitor (definition sees below), serine-threonine kinase inhibitor such as rapamycin (rapamycin) (sirolimus (sirolimus),
Figure BDA000020238789004824
(SCH 6636, SARASAR for farnesyl transferase inhibitor such as Luo Nafani (lonafarnib) TM), and pharmaceutically acceptable salt, acid or the derivative of any above-mentioned substance, and the combination of two or more above-mentioned substances, such as the abbreviation of CHOP(endoxan, Doxorubicin, vincristine and prednisolone conjoint therapy) and FOLFOX(oxaliplatin (ELOXATIN TM) abbreviation of therapeutic scheme of associating 5-FU and folinic acid).
As defined herein, chemotherapeutic comprises " antihormone agent " or " endocrine therapy agent ", and it act as adjusting, reduction, blocking-up or suppresses to promote the effect of the hormone of growth of cancers.They self can be hormones, include but not limited to: have the estrogen antagonist of the agonist/antagonist overview of mixing, comprise tamoxifen (tamoxifen)
Figure BDA00002023878900491
4-hydroxytamoxifen, toremifene (toremifene)
Figure BDA00002023878900492
idoxifene (idoxifene), droloxifene (droloxifene), raloxifene (raloxifene)
Figure BDA00002023878900493
trioxifene (trioxifene), that Lip river former times fragrant (keoxifene) and selective estrogen receptor modulators class (SERM) are such as SERM3; The pure antiestrogen that there is no agonist properties, such as fulvestrant (fulvestrant)
Figure BDA00002023878900494
can block estrogen receptor (ER) dimerization with this type of medicament of EM800(, suppress the DNA combination, increase the ER turnover, and/or suppress the ER level); Aromatase inhibitor, comprise steroidal aromatase inhibitor such as formestane (formestane) and Exemestane (exemestane)
Figure BDA00002023878900495
with on-steroidal aromatase inhibitor such as Anastrozole (anastrazole)
Figure BDA00002023878900496
letrozole (letrozole)
Figure BDA00002023878900497
and aminoglutethimide (aminoglutethimide), and other aromatase inhibitor comprises R 83842 (vorozole)
Figure BDA00002023878900498
magace (megestrol acetate) fadrozole (fadrozole) and 4 (5)-imidazoles; Gonadotropin-releasing hormone agonist, comprise Leuprolide (leuprolide)
Figure BDA000020238789004910
with
Figure BDA000020238789004911
goserelin (goserelin), buserelin (buserelin) and triptorelin (tripterelin); Sex steroid, comprise that ethisterone (progestines) such as Magace and medroxyprogesterone acetate, oestrogenic hormon are such as stilboestrol and premarin (premarin) and male sex hormone/retinoid such as Fluoxymesterone (fluoxymesterone), all-trans retinoic acid (transretionic acid) and fenretinide (fenretinide); Onapristone (onapristone); Mifepristone; Under estrogen receptor, adjust (ERD); Androgen antagonist such as flutamide (flutamide), Nilutamide (nilutamide) and than Ka meter Te (bicalutamide); And pharmaceutically acceptable salt, acid or the derivative of any above-mentioned substance; And the combination of two or more above-mentioned substances.
This type of conjoint therapy also comprises: (i) lipid kinase inhibitors; (ii) antisense oligonucleotide, particularly those inhibition involve genetic expression in the signal transduction path of abnormal cell proliferation, such as for example PKC-α, Ralf and H-Ras; (iii) ribozyme such as the vegf expression inhibitor (for example,
Figure BDA000020238789004912
ribozyme) and the HER2 expression inhibitor; (iv) vaccine is such as the gene therapy vaccine, for example,
Figure BDA000020238789004913
vaccine,
Figure BDA000020238789004914
vaccine and
Figure BDA000020238789004915
vaccine; rIL-2; topoisomerase 1 inhibitor;
Figure BDA000020238789004918
rmRH; (v) anti-angiogenic agent such as rhuMAb-VEGF (bevacizumab)
Figure BDA000020238789004919
genentech); Pharmaceutically acceptable salt, acid or derivative with any above-mentioned substance.
Above this type of conjoint therapy of record is contained co-administered (wherein two or more therapeutical agents are included in identical or different preparaton), and separate administration, in this case, can be before using other therapeutical agent and/or adjuvant, using of NRG antagonist of the present invention occur simultaneously and/or afterwards.Also can be used in combination NRG antagonist of the present invention with radiotherapy.
D. goods
In another aspect of this invention, a kind of goods are provided, the material that it contains and can be used for the treatment, prevents and/or diagnose illness as described above.Goods comprise on container and container or the label of combining with container or package insert.Suitable container for example comprise bottle, phial, syringe, IV solution bag, etc.Container can be formed such as glass or plastics by multiple material.Container holds separately or effectively treats, prevents and/or diagnose the composition of situation with another kind of combination of compositions, and can there is aseptic access port (for example, container can be phial or the intravenous solution bag with the stopper that can be passed by hypodermic needle).At least one promoting agent in composition is antibody of the present invention.The situation of selection is treated in label or package insert indication with composition.In addition, goods can comprise the first container that (a) has the composition wherein contained, and wherein composition comprises antibody of the present invention; (b) have the second container of the composition wherein contained, wherein composition comprises other cytotoxicity or the curative medicament of other side.Goods in this embodiment of the present invention can further comprise package insert, and its indication can be treated specific situation with composition.Perhaps/in addition, goods can further comprise second (or 3rd) container, and it comprises pharmacy can accept damping fluid, such as water for injection,bacteriostatic (BWFI), phosphate buffered saline (PBS), RingerShi solution and dextrose solution.It can further comprise other material of seeing expectation from business and User Perspective, comprises other damping fluid, thinner, filter, pin and syringe.
III. embodiment
Below the embodiment of method and composition of the present invention.Should be appreciated that in view of general description provided above, can implement various other embodiments.
Embodiment 1: method
Clone
NSCLC clone Calu3, H441, H1299, H1993, A549 and H596 and KPL4 breast cancer cell line are available from American type culture collection (American Type Culture Collection, ATCC), Manassas, VA.These clones are maintained in the RPMI that contains 10%FBS, Pen/Strep and L-glutaminate.Calu3 is cultivated in the ATCC substratum of replacing RPMI.By TZV-b-Actin muscle-eGFP lentiviruses transduction Calu3, H441 and KPL4 clone.After repeatedly going down to posterity, sorting the high GFP express cell that increases are to obtain about 95%GFP positive cell, and these subbreed are described as Calu3-GFP and H441-GFP and KPL4-GFP.Mouse NSCLC clone LKPH1 and LKPH2 are certainly from carrying Kras lSL-G12D/+; P53 fL+; Two independent tumours of the mouse of Z/EG lung tumor are derivative.At first, clone is set up in the DMEM/F12 substratum that contains 5%FBS, Niu Chuiti extract, N2 fill-in, EGF, FGF, Pen/Strep and L-glutaminate.LKPH1 and LKPH2 are cultivated in the DMEM high glucose substratum that contains 10%FBS, Pen/Strep and L-glutaminate.Induction type shRNA slow virus: the hairpin oligonucleotide used in this research is as follows: shNRG1:5 '-GATCCCCCATGGTGAACATAGCGAATTTCAAGAGAATTCGCTATGTTCACCATGTT TTTTGGAAA-3 ' (justice is arranged) (SEQ ID NO:1) and 5 '-AGCTTTTCCAAAAAACATGGTGAACATAGCGAATTCTCTTGAAATTCGCTATGTTC ACCATGGGG-3 ' (antisense) (SEQ ID NO:2).ShNRG1.2:5 ' GATCCCCGAGTATATGTGCAAAGTGATTCAAGAGATCACTTTGCACATATTACTCT TTTTTGGAAA-3 ' (justice is arranged) (SEQ ID NO:3) and 5 '-AGCTTTTCCAAAAAAGAGTATATGTGCAAAGTGATCTCTTGAATCACTTTGCACAT ATACTCGGG-3 ' (antisense) (SEQ ID NO:4).ShErbB4:5 '-GATCCCCGATCACAACTGCTGCTTAATTCAAGAGATTAAGCAGCAGTTGTGATCTT TTTTGGAAA-3 " (justice is arranged) (SEQ ID NO:5) and 5 ' AGCTTTTCCAAAAAAGATCACAACTGCTGCTTAATCTCTTGAATTAAGCAGCAGTT GTGATCGGG-3 ' (antisense) (SEQ ID NO:6).ShErbB3:5 '-GATCCCCAAGAGGATGTCAACGGTTATTCAAGAGATAACCGTTGACATCCTCTTTT TTTTGGAAA-3 ' (justice is arranged) (SEQ ID NO:7) and 5 '-AGCTTTTCCAAAAAAAAGAGGATGTCAACGGTTATCTCTTGAATAACCGTTGACAT CCTCTTGGG-3 ' (antisense) (SEQ ID NO:8).Mouse shNRG1:5 "-GATCCCCCATGGTGAACATAGCGAATTTCAAGAGAATTCGCTATGTTCACCATGTT TTTTGGAAA-3 ' (justice is arranged) (SEQ ID NO:9) and 5 '-AGCTTTTCCAAAAAACATGGTGAACATAGCGAATTCTCTTGAAATTCGCTATGTTC ACCATGGGG-3 " (antisense) (SEQ ID NO:10).
Complementary double-stranded shRNA oligonucleotide is inserted in Tet induction type viruse gene transferring vector, as described Cancer Res.2006 such as () Hoeflich.Carrier system is comprised of shuttle vectors and dsRed expressing viral vector main chain, and described dsRed expressing viral vector main chain contains the shRNA expression of regulating to realize Tet through codon optimized Tet repressor-internal ribosome entry site-dsRed box.Luciferase shRNA construct (Hoeflich etc.) had before been described.
Virus packing and clone generate: based on previously described method, use Lipofectamine (Invitrogen, Carlsbad, CA) generate by the pHUSH-Lenti-dsRed construct of the shRNA that cotransfection contains expectation in the HEK293T cell and the plasmid of expression vesicular stomatitis virus (VSV-G) envelope glycoprotein and HIV-1 packaging protein (GAG-POL) the slow virus construct that carries induction type shRNA.With these virus transduction target cells.After being greater than and going down to posterity for 3 times, select precontract 20%dsRed expressing tumor cell with the FACS sorting, by its collection, merging expansion.
In vitro study: in order to induce shRNA, express, the stabilized cell that will contain Vibravenos (doxycycline) induction type shNRG1 or sh luciferase ties up in the 1ug/ml Vibravenos to be cultivated 6 days altogether.Induce first day that cell is cultivated in 10%FBS, then titration FBS in the process of 4 days.Then, the growth last 6 hours during by the complete serum starvation of cell.Then, cell is processed carry out RNA extraction or Western trace.For the research of the HER4ECD in Lung Tumor clone, the LKPH cell is cultivated 24 hours in the serum starvation condition, add afterwards the HER4ECD of 2mg/ml concentration.Then, by LKPH cell incubation 48 hours again, process afterwards to carry out the Western trace.Be implemented in as follows on the H441 cell and add external source NRG1: the H441 cell is carried out to serum starvation and reach 18 hours, add afterwards 1uM recombinant human NRG1 β-1 extracellular domain (R& D systems) or the anti-artemisiifolia of 1uM (ragweed) IgG2A in contrast.Add after NRG1 or artemisiifolia 10 minutes, the processing cell is to carry out the Western trace.
RNA separates, prepared and qPCR by cDNA: with the micro-test kit of Qiagen RNeasy, carry out isolation of RNA.Use ABI high frequency high fidelity test kit to prepare complementary DNA according to the instructions of manufacturers from total RNA.Use ABI gene-specific primer/probe to measure NRG1 α, NRG1 β, HER3, HER4 expression by quantitative PCR in real time (ABI 7500).Use GAPDH or RAB14 housekeeping gene stdn genetic expression.
Heterograft tumor research in body: tumour cell (1000-2000 ten thousand) is implanted in the right side of nude mouse.Reach about 200mm at tumor size 3the time, mouse is divided into to the different treatment group.Then, for vehicle or chemotherapy for preliminary research, (Taxol, i.v.+ cis-platinum i.p.) are processed mouse.The chemotherapy dosage regimen is the cis-platinum 5mg/kg i.p. that Taxol 20mg/kg i.v. every other day reaches 5 doses and the 1st day and the 7th day (for the Calu3 model) and the 1st day and the 14th day (for the H441 model).In the end after the potion chemotherapy, collect tumour and the contrast of time match vehicle of disappearing at least 1 week.Use Dispase/collagenase to separate tumour, and sample is carried out to the FACS sorting to collect the GFP positive tumor cell.Strike low research for NRG1, treatment group is: sucrose, Vibravenos (dox), chemotherapy+sucrose and chemotherapy+Vibravenos.Start the processing with sucrose or Vibravenos in the time identical with first dose of chemotherapy, and proceed, continue whole research.Provide arbitrarily 5% sucrose water to the vehicle group, and provide the Vibravenos of the 1mg/ml in 5% sucrose to the Vibravenos group.
Heterograft tumor growth analyses: in order suitably to analyze in time the replicate measurement from the gross tumor volume of same animal, use hybrid modeling method (Pinheiro etc. 2009).This method can solve replicate measurement and due to research finish before appropriateness due to the relevant animal termination of non-processing exit rate (drop out rate) both.To each treatment group with the cubic regression batten by nonlinearity profile (profille) matching the time course to the log2 gross tumor volume.
LSL-K-ras in body g12D; P53 fl/+and LSL-K-ras g12D; P53 fl/Flher4ECD research: with Adeno-Cre virus infection LSL-K-ras g12D; P53 fl/+, and allow the tumor inducing after ripening 16 weeks.After tumor inducing 16 weeks (research the 0th day) implement the baseline CT scan, and, by mice group, make the average initial gross tumor volume of every group equate.Continue three weeks weekly with cis-platinum (7mg/kg) or phosphate buffered saline (PBS), and biweekly continue whole research to the mouse administration with HER4ECD-Fc (25mg/kg) or anti-artemisiifolia IgG2A (25mg/kg).Implemented series of CT scanning at the 14th day, the 45th day and the 66th day.X ray minicomputer tomography (micro-CT): utilize two micro-CT systems (vivaCT40 and vivaCT 75, Scanco Medical, Switzerland) to carry out vertical lung imaging.By animal randomization between the micro-CT system, and scan again on the same system for the baseline imaging.Obtain data with 38 μ m (vivaCT 40) or 50 μ m (vivaCT 75) isotropy volume elements size, 1000 projections (projection), 250ms (vivaCT 40) or 200ms (vivaCT 75) integral time, 45keV photon energy and 177mA electric current.For the time length of in-vivo imaging, by 2% isoflurane anesthesia in medical air for animal, and by modulated warm gases flow in 37 ° of constant C temperature.The imaging time of each dialogue is every animal approximately 15 minutes (vivaCT 75) or 25 minutes (vivaCT 40), and the radiation dose of estimating is about 0.2Gy (vivaCT 75) or 0.1Gy (vivaCT 40).Use image analysis software bag Analyze (AnalyzeDirect, Inc., Lenexa, KS, USA) to assess imaging data in coronal plane.Once identify the plane, maximum cross-section of each tumour, measure maximum diameter of tumor (d 1) and maximum perpendicular diameter (d 2) estimated value.Total tumor load is with the vector product (d of the direction estimated value of all tumours 1x d 2) summation calculate.Before verified micro-CT tumor analysis in body, and found and analyze by vitro micro-CT total gross tumor volume of (Singh etc., 2010) measuring to be associated well.
Microarray analysis: the weight range of the total RNA used in two-wheeled T7 amplification scheme is every duplicate samples 10ng to 50ng.Using Message Amp II aRNA amplification kit (Applied Biosystems, Foster City, CA) to complete first round amplification and second takes turns cDNA and synthesizes.Then, use the fast A mp labelling kit (Agilent Technologies, Palo Alto, CA) of Agilent to mix the Cye-5 dyestuff via the IVT reaction.Every part of specimen through the Cy-5 mark and the general ginseng through the Cy-3 mark are shone to RNA (Agilent Technologies, Palo Alto, CA) merge, and hybridize to total man's genome 4x44K array of Agilent, as described in the scheme of manufacturers.By this array clean, dry and scan on the DNA microarray scanner of Agilent.Use the feature extraction software (Feature Extraction software) 9.5 of Agilent to analyze the array image of acquisition, and obtain indivedual log2 ratios of background deduction strength of signal.The Cybert-T check (Baldi and Long, 2001) of implementing improvement carrys out the expression overview between the processing of comparison medium thing and chemotherapy group.Multiple check is proofreaied and correct to (Storey and Tibshirani, 2003) application False discovery rate (q value).
SiRNA oligomer (siRNA) set of siRNA:HER3 (M-003127-03), HER1 (M-003114-01), HER2, HER4 and non-targeted contrast (D-001206-14-20) is purchased from Dharmacon Lafayette, CO.Dye siRNA is imported in the H522 cell by reverse.Inoculating cell/hole in 96 hole microtiter plates, the RNAi oligomer of the merging that described 96 hole microtiter plates contain 50mmol/L and according to the preincubation mixture that is recommended in DharmaFECT# (T-2001-02, the Dharmacon) transfection reagent of dilution in OPTI-MEM (Invitrogen) of manufacturers.After transfection 96 hours, by AlamarBlue, dye and measure the impact of on cell proliferation.
Western trace: for the Western trace of vitro cell culture, adherent cell is cleaned three times with ice-cold 1x phosphate buffered saline (PBS) (PBS), and cracking in RIPA damping fluid (Pierce Biotechnology), Halt proteinase inhibitor and Halt inhibitors of phosphatases mixture (Thermo Scientific).Lysate is collected, homogenized, and clarified by centrifugal 10 minutes.Preparation primary mouse tumor lysate in the situation of not carrying out the PBS cleaning, as described above.By the classification in 4-12%NuPAGE Novex bis-tris gel (Invitrogen) of supernatant liquor protein.Use iBlot xerography mark system (Invitrogen) to implement trace according to the specification sheets of manufacturers.Use Odyssey Western engram analysis and infrared imaging system (Li-Cor Biosciences) to implement nitrocellulose membrane closure and antibody staining according to the instructions of manufacturers.Manifest trace on Odyssey scanner (Li-Cor Biosciences).Antibody: use following primary antibodie in the Western Blot experiment: anti-Actin muscle (612656, BD Biosciences), anti-GAPDH (sc-25778, Santa Cruz Biotechnology), anti-EGF acceptor (2232, Cell Signaling Technology), anti-Neu (sc-284, Santa Cruz Biotechnology), anti-ErbB3 (sc-285, Santa Cruz Biotechnology), anti-phosphoric acid HER3 (4791, Cell Signaling Technology), anti-ErbB4 (sc-283, Santa Cruz Biotechnology), anti-phosphoric acid HER4 (4757, Cell Signaling Technology), anti-Akt (4691, Cell Signaling Technology), anti-phosphoric acid Akt (4058, Cell Signaling Technology), Stat/ phosphoric acid Stat antibody sampler test kit (9939/9914, Cell Signaling Technology), anti-MEK 1/2 (9126, Cell Signaling Technology), anti-phosphoric acid MEK 1/2 (2338, Cell Signaling Technology).Use resists from following two of Li-Cor Biosciences: anti-rabbit igg of the goat that the goat anti-mouse IgG that IRDye 680 puts together, IRDye 800CW put together.
Embodiment 2: for the optimization of the body inner model of studying residual disease and recurrence
Produce several cancer models, and be responsible for for studying the cell that tumour is restarted, described cancer model shown that response is chemotherapeutic and significantly disappeared, and is then the tumor recurrence (Fig. 1) stopped after treatment.These cells are that tumour is restarted cell (TRIC).For production model, will be through the human tumor cells subcutaneous transplantation of GFP mark, and reach about 200mm at tumor size 3the time, process mouse by vehicle or chemotherapy, as shown in corresponding model.Enzymic digestion with separate after by the FACS sorting, the GFP+ tumour cell is separated from the tumour disappeared or process through vehicle.In the end after the potion chemotherapy minimum one week and before tumor growth recovers the collection tumour.
The GFP of Non-small cell lung carcinoma (NSCLC) clone Calu3 and H441 is expressed to subbreed to be implanted in nude mouse to generate xenograft models.For the Calu3 model, chemotherapy is comprised of Taxol (20mg/kg, i.v. every other day reaches 5 doses) and cis-platinum (5mg/kg, i.p. reaches 2 doses in every 7 days).Fig. 2 A(data present with average gross tumor volume ± SEM, the n=15/ group).For the H441 model, chemotherapy is comprised of Taxol (20mg/kg, i.v. every other day reaches 5 doses) and cis-platinum (5mg/kg, i.p. reaches 2 doses in every 14 days).Fig. 2 B(data present with average gross tumor volume ± SEM, for what process through vehicle, and the n=9/ group, and for processing through chemotherapy, the n=14/ group).
The GFP of MCF-7 KPL4 is expressed to the mammary fat pad of subbreed homotopic transplantation to the SCID/beiz mouse.For the KPL4 model, chemotherapy is comprised of Taxol (20mg/kg, i.v every other day reaches 5 doses).Fig. 2 C(data present with average gross tumor volume ± SEM, n=12 mouse/group).
After completing the chemotherapy scheme, the tumour of the mouse of processing through chemotherapy significantly is less than the mouse of processing through vehicle.Continue several weeks after the potion chemotherapy that disappears in the end, but tumor recurrence subsequently.Fig. 2 A-C.
In addition, by the LSL-K-ras of NSCLC g12Dgenetic engineering mouse model (Jackson etc., 2001) and Z/EG Cre report strain (Novak etc., 2000) hybridization, and use in this research.Within 12 weeks after the AdenoCre of lung infects (that is, tumour promotion), start cis-platinum (7mg/kg i.p. reaches 3 doses in every 7 days).Within after last potion chemotherapy 1 week, collect lung, and pass through afterwards the FACS separating tumor cell in enzymic digestion with separating.In the end after the potion cis-platinum, one week facs analysis to the GFP positive tumor cell that exists in lung discloses and contrasts and compare with vehicle, and the tumor cell number purpose in the mouse of cisplatin treated significantly reduces.Fig. 2 D(data present with the average number ± SEM of the GFP positive cell of each lung, the n=6/ group).So, LSL-K-ras g12Dthe cisplatin treated of mouse causes the remarkable reduction of tumor load, but it does not cause the survival extended, and the indication tumour recurs (Oliver etc., 2010) after treatment.
Although every kind of model response chemotherapy as described above, the different time recurrence of tumour after treatment, although there is Leukopenia almost completely.Survive before death the chemotherapeutic cell through the GFP mark at the tumor regrowth long hair and contain TRIC, and be isolated further to study.
The enrichment of NRG1 in embodiment 3:TRIC
The growth curve of measuring in advance based on every kind of model, 1-3 week after processing the last time, but collect before death the tumour disappeared or process through vehicle at the tumor regrowth long hair of processing through chemotherapy.By enzymic digestion separation for tumor tissues, and separate the GFP positive tumor cell by fluorescence-activated cell sorting (FACS).
For the difference of the genetic expression overview that characterizes and tumour cell of residual that process through vehicle, from tumour cell (PI – and GFP +) isolation of RNA, and implement to express the order type analysis.Microarray analysis announcement to Calu3 and H441 model is compared with the tumour cell of processing through vehicle, and NRG1 expresses in the residual tumour cell of processing through chemotherapy significantly higher (Fig. 3 A-B).Use two kinds of independently residual enrichments in the cell of chemotherapy processing of micro probe array mensuration.For the Calu3 xenograft models, use the first probe measurement to 8.6 times enrichment (p=0.003, q=0.003) (Fig. 3 A, the little figure of left side microarray), and use the second probe measurement to 5.3 times enrichment (p=0.001, the q=0.002(n=8/ group)) (Fig. 3 A, the little figure of right side microarray).For the H441 xenograft models, use the first probe assay to 4.9 times enrichment (p<0.001, q=0.009) ((Fig. 3 B, the little figure of left side microarray)), and use the second probe assay to 2.8 times enrichment (p=0.001, the q=0.013(n=8/ group)) ((Fig. 3 B, the little figure of right side microarray)).
Due to alternative splicing, there are two kinds of active congruencys in the NRG1 EGF sample territory that receptors bind needs, is called NRG1 alpha (NRG1 α) and NRG1 beta (NRG1 β).We confirm the enrichment (Fig. 3 A-B) of NRG1 α and NRG1 β by quantitative PCR in real time (qPCR).For the Calu3 xenograft models, use independently tumor sample, 4.7 times of (p=0.02) (Fig. 3 A, little figure of left side qPCR) of NRG1 alpha expression enrichment, and 3.4 times of (p=0.04) (Fig. 3 A, the little figure of right side qPCR) (n=6/ groups) of NRG1 β enrichment.For the H441 xenograft models, use the tumor sample identical with microarray analysis, 11.4 times of NRG1 α enrichments (Fig. 3 B, the little figure of left side qPCR), and 12.1 times of NRG1 β enrichments (Fig. 3 B, the little figure of right side qPCR).
NRG1mRNA enrichment in the TRIC from KPL4 mammary cancer xenograft models.Use two kinds of independently micro probe array mensuration enrichments (Fig. 3 C).
For LSL-K-ras g12Dmodel, based on microarray, NRG1 expresses and compares significantly higher at the residual tumour cell of processing through chemotherapy with the tumour cell of processing through (bulk) in bulk vehicle.Use microarray analysis to measure 13.7 times of enrichments (p<0.001, q=1) (n=6/ group) (Fig. 3 D, the little figure of microarray).By qPCR, independent sample is confirmed to enrichment, show 9 times of enrichments (p=0.04) (Fig. 3 D, the little figure of qPCR).
NRG1 is at all 3 kinds of MODEL C alu3, H441 and LSL-K-ras g12Din in residual treated cell one of several genes of significant enrichment.Interestingly, HER3 and HER4 expression of receptor all do not have as one man enrichment in all models.
By the activation at immunostaining tumour assessment NRG1 acceptor HER3 aspect phosphoric acid HER3.Most of tumour cells in residual tumor are p-HER3 positives, and the tumour of processing through vehicle only shows the dispersion bunch of p-HER3 positive cell.Do not find the expression of another kind of HER3 part NRG2 in residual tumour cell.So, residual tumor cells expression NRG1, and show the receptor activation strengthened, show the NRG1 autocrine activity raise.
The adjusting that embodiment 4:NRG1 expresses
The NRG1 of the rising of observing in residual tumour cell expresses the enrichment that can be derived from the NRG1 express cell subgroup existed in primary tumor.Perhaps, the NRG1 of chemotherapy in can inducing cell expresses, and then, described cell has resistance to its cytotoxic effect, or expression level can be subject to tumor size or growth kinetics impact.In order to distinguish these possibilities, a plurality of time assessment NRG1 expression levels (Fig. 4) by qPCR in the tumour of different volumes and after chemotherapy.NRG1 mRNA level does not increase after single dose chemotherapy (cis-platinum+Taxol).In fact, except residual tumour, the NRG1 level the institute of test if having time and volume be equal to.These results show that NRG1 expresses and are not subject to chemotherapy-induced or not affected by tumor size, and consistent with the enrichment of the NRG1 express cell subgroup of preexist.
Autocrine NRG1-HER signal conduction in embodiment 5:NSCLC
In order to identify both models of coexpression part and acceptor thereof, check the expression in parent Calu3 and H441 cell and one group of others NSCLC clone of NRG1 and acceptor thereof.Although the expression level of NRG1 α and NRG1 β transcript is heterogeneous between clone, when comparing with normal lung, they are much higher in most cells system.Surprisingly, in the H441 cell, the NRG1 transcript only exists when cell is cultivated in vivo with tumour.The H441 cell of cultivating is not expressed detectable NRG1 α or NRG1 β transcript, and this has highlighted the difference of the characteristic of in vitro and in vivo cultured cells.The Western of 4 kinds of HER acceptors is analyzed to the heterogeneous expression disclosed between 6 kinds of people NSCLC systems.With respect to other clone, Calu3 has the highest vivoexpression level of all 4 kinds of acceptors.
In order to assess the possible downstream mediators of NRG1 autocrine signal conduction, generation is carried for the Vibravenos induction type shRNA (Gray etc., 2007) of NRG1 (shNRG1) and Calu3, the H441 of constructive expression's dsRED reporter gene and the stable subbreed of H1299 parental cell line.The NRG-1 gene contains a plurality of promotors, and experiences alternative splicing widely, generates at least 15 kinds of different isoforms.All active isoforms all contain RTK and activate essential and enough EGF sample territory (Holmes etc., 1992; Yarden and Peles, 1991).The shNRG1 target is low to striking of all possible isoform to realize to common EGF sample territory.Generation has for the coupling stable cell lines of the Vibravenos induction type shRNA (shLuc) of luciferase in contrast.While cultivating, only in the Calu3-shNRG1 cell, have the effective and special reduction (approximately 90%) of NRG1 α and NRG1 β transcript in the situation that has Vibravenos (dox).Measure the p-HER3 in the cell of the Calu3-shNRG1 through serum hunger of cultivating, the relevant reduction of p-AKT level and the reduction slightly of p-HER4 in having the situation of dox.In these lysates, p-Stat3 or p-Mek1/2 level do not have the variation that can detect.
Because the H441 cell is not expressed any NRG1 transcript in vitro, so by assess the mediators of NRG1 signal conduction in these cells with external source NRG1 ligand stimulation.With NRG1, stimulating after the cell of serum hunger, p-HER3 and p-AKT have increase.The level of p-Stat3 or p-Mek1/2 does not have the variation that can detect.
Also in the mouse lung carcinoma cell, assess NRG1 effector approach.Two kinds independently clone from LSL-K-ras g12D; P53 fl/+lung tumor is derivative, i.e. LKPH1 and LKPH2, and be referred to as LKPH system (seeing embodiment 1).The stable subbreed of dox induction type shNrg1 or shLuc is carried in generation.Only in having the situation of dox, in LKPH shNrg1 clone, see the Nrg1 transcript of reduction.In addition, exist the reduction of p-HER3 and p-AKT level in the cell of the LKPH-shNRG1 through serum hunger of cultivating in the situation of the dox existed.P-Mek1/2 in the culture of shortage Nrg1 mRNA and the level variation of p-Stat3 can not detect by the Western trace, have pointed out Nrg1 not participate in these effector approach.
In a word, NRG1 stimulation and the NRG1 in Calu3 and LKPH1/2 cell from the H441 cell strikes the main downstream effect thing that low Notes of Key Data PI3K approach is the NRG1 signal conduction in the NSCLC cell.The activity decreased of the HER3 signal conduction in the tumour cell of the NRG1 transcript in people and mouse NSCLC model and the expression of HER acceptor rising and cultivation (NRG1 strikes low rear) is pointed out in NSCLC and is had autocrine NRG1-HER3 signal conductive rings.In addition, its expression rising (Fig. 3) in the residual tumor cell has pointed out the conduction of NRG1 autocrine signal to play a role in chemoresistance and/or palindromia.
Embodiment 6:NRG1 strikes the tumor recurrence after low delay chemotherapy
By assessing independent or striking low effect measuring NRG1 with the NRG1 of chemotherapy combination and strike the low impact on the recurrence after primary tumor growth and chemotherapy.Use three-type-person NSCLC model in this research, its difference that shows the HER family receptors is expressed pattern.The Calu3 model has the high protein level of all acceptors, and H441 shows HER2 and the strong expression of HER3 and medium HER1, and H1299 shows medium level HER1,2 and 3.
In order to measure the effect of NRG1 target in the Calu3 model, the mouse of carrying the Calu3-shNRG1 tumour is included into to 4 groups; 1) vehicle+sucrose, 2) vehicle+dox, 3) chemotherapy+sucrose, and 4) chemotherapy+dox.Use and identical chemotherapy scheme described in the embodiment 2 above, and in tap water arbitrarily Orally administered 5% sucrose or dox (2g/L).Biweekly measure gross tumor volume during research.Individual (for vehicle+sucrose to the mouse of using in research, n=12 mouse, and for vehicle+dox, n=13 mouse) generate tumor growth curve, and the matching produced with linear hybrid effect (LME) model of gross tumor volume presents, in Fig. 5 A and 5B, as thering is the cubic spline of automatically determining knot, draw.Vehicle+dox group (time (TDT)=44.5 day before multiplication) compares with vehicle+sucrose (TDT=17 days) the remarkable delay that tumor doubling time is arranged, and prompting NRG1 strikes lower part and suppresses tumor growth (Fig. 5 A).
Assess the impact of NRG1 on tumor recurrence by the tumor growth in comparative chemistry therapy+sucrose and those tumor growths in chemotherapy+dox group.Compare and remarkable delay is arranged on tumor recurrence (Fig. 5 B) with chemotherapy+sucrose (TDT=124 days) in chemotherapy+dox group (TDT is greater than 181 days, finishes not reach to research).In addition, hang oneself in having and there is no chemotherapeutic both of these case many recurrent tumors of the mouse that dox processes mainly consist of the brown/black mucoid liquid that is that only has little visible tumor tissues district.The gross tumor volume of the volume ratio reality of therefore, measuring in the dox treatment group is quite a lot ofly large.Do not observe difference between any group in the Calu3-shLuc comparative study.In addition, in the end after the potion chemotherapy, the Calu3 tumour was being implemented to immunohistochemistry (IHC) aspect proliferation marker Ki67 in 3 days.Compare with chemotherapy+sucrose tumour, significantly lower Ki67 positive cell ratio is arranged in the tumour of processing through chemotherapy+dox, pointed out the residual tumor cell moderate stimulation propagation of NRG1 signal conduction after chemotherapy.
The mRNA level of NRG1 α and NRG1 β isoform in the tumour cell that mensuration is early stage and late period, time point was collected.The NRG1 transcript increases during time point late, and indication is struck and lowly do not maintained in vivo.
Also check that in the H441 xenograft models, NRG1 strikes low effect.Although growth has MIN impact (Fig. 6 A(n=12/ group) on primary tumor, tumor growth curve presents with the LME Fitting Analysis of gross tumor volume, as thering is the cubic spline of automatically determining knot, draw, compare tumor recurrence with chemotherapy+sucrose (TDT=94 days) in chemotherapy+dox group (TDT is greater than 150 days, finishes not reach to research) remarkable delay (Fig. 6 B((n=12/ group) is arranged).In the H441-shLuc body, in research, gross tumor volume does not have this type of difference.Similar to the Calu3 xenograft models, the H441 model also shows the NRG1 transcript level of rising late during time point.
Recover the mechanism of back in order to investigate the NRG1 level, the expression to tumor cell assay through the gene of lentiviruses transduction.Also comprise the dsRed marker gene because there is the slow virus of the cell of shRNA for transduction, thus by flow cytometry relatively early stage and late period dsRED positive tumor cell during time point ratio.Express the facs analysis body internal loss that (5 days) and time point in late period (being greater than 100 days) are expressed tumour assessment lentiviral gene in early days of the ratio of the genetically modified tumour cell of slow virus dsRed (the human specific ESA positive) by inspection.The mouse of early stage time point is accepted sucrose or dox, and late period time point mouse accept chemotherapy+sucrose or chemotherapy+dox.Observe the tumour remarkable reduction of the dsRed positive cell ratio of time point late of processing through sucrose and dox, reduce that significantly larger (1.8 times to 4.1 times, p=0.007) for the tumour of processing through dox.This has pointed out the loss of viral transgene expression to be associated with the recovery of NRG1 level.
Calu3 and H441 cell both show the HER3 protein level of rising, propose following problem, i.e. the effect of NRG1 in tumor recurrence is for having whether the tumour that acceptor crosses expression is specific.For head it off, use the H1299 xenograft models with much lower HER3 level.Similar to the H441 model, independent grows and only has appropriate impact primary tumor striking of NRG1 is low.Although comparatively speaking and the H1299 tumour very aggressive growth is arranged, NRG1 strike low cause gained to chemotherapeutic response strengthen and chemotherapy+dox group (TDT=30.45 days) to chemotherapy+sucrose (TDT=11.5 days) in the remarkable delay (n=12/ group) (Fig. 7 A, B) of tumor recurrence.
In addition, generate the stable subbreed of expression for the H1299 of the different shRNA (shNRG1.2) of NRG1, it causes the reduction of more appropriate (modest) of NRG1 mRNA level.In the body carried out with H1299-shNRG1.2, research is further illustrated in NRG1 and strikes after low chemotherapeutic response is strengthened.Yet growth inhibiting amplitude is less in this model, with NRG1, to strike low degree light consistent for this.Be with or without in chemotherapeutic situation and thering is no difference on gross tumor volume between sucrose and dox treatment group in research in the H1299-shLuc body.
On primary tumor, growth only has appropriateness to medium impact in the low inhibition on the conduction of NRG1 autocrine signal of striking of shRNA mediation, but significantly postpones the tumor recurrence after chemotherapy.Although can not in xenograft models, remain low to striking for a long time of NRG1, we observe the remarkable delay that NRG1 strikes low rear tumor recurrence.Adjusting primary tumor growth has been pointed out in these discoveries, with variant on the critical path of chemoresistance and recurrence.
Embodiment 7: use the part trap to postpone tumor recurrence to the inhibition of NRG1 signal conduction
In order to test the conduction of NRG1 signal at LSL-K-ras g12D; P53 fl/+effect in recurrence in mouse model after promoting chemotherapy, adopt the part trap method of isolating in vivo NRG1 and stoping its bind receptor.Generate the fusions of the people HER4 extracellular domain (HER4-ECD) merged with mouse IgG2A Fc.HER4 shows the high-affinity combination (Tzahar etc., 1994) to NRG1.While in vitro the LKPH1 through serum hunger and LKPH2 cell being added to HER4-ECD, observe the inhibition to the conduction of NRG1/HER3 signal, as the p-HER3 level by reducing shows.So, molecule operation in the NRG1 signal conduction of disturbing the autocrine mediation as expected in vitro.
When research starts (the 0th day) by X ray minicomputer tomography (micro-CT) to carrying the LSL-K-ras of lung tumor g12D; P53 fl/+the mouse imaging, be divided into three groups that equate initial tumor load, and following the processing: 1) PBS+ contrast IgG2A; 2) cis-platinum+contrast IgG2A; With 3) cis-platinum+HER4-ECD.Mouse experiences the variation that vertical micro-CT scans to measure tumor load.(Fig. 8 A(figure represents mean tumour volume +/-SEM to the average tumor load, artemisiifolia, contrast mouse IgG2a antibody)) and the analysis of tumor growth rate ((Fig. 8 B(figure has shown multiple variation every day and 95% fiducial interval of the tumor load obtained by processing scheme)) disclosed the only combination of cis-platinum+HER4-ECD, rather than independent cis-platinum causes the remarkable inhibition to tumor growth.Although the stagnation of its tumor growth during the scanning of micro-CT for the first time after the mouse of cisplatin treated shows chemotherapy, when research finishes, average tumor load and overall tumor growth rate are there is no significant difference (Fig. 8 A-B) between vehicle and cisplatin treated group.
At LSL-K-ras g12D; P53 fl/Flimplement second research in mouse, as described above.Yet, outside as described above group, this research comprises the single medicament arm of HER4-ECD.The analysis of tumor load has been disclosed with the mouse of processing through cis-platinum+vehicle and compared with all other groups by micro-CT at the 28th day, in the mouse of processing through cis-platinum+HER4-ECD, tumor load significantly reduces (Fig. 8 C).Comparatively speaking, independent HER4-ECD processes not impact of tumor growth, has further supported the unique effect of NRG1 autocrine signal conduction in chemoresistance and/or tumor regrowth length.In this research, with vehicle+contrast IgG (n=10), cis-platinum+contrast IgG (n=11), cis-platinum+HER4-ECD (n=8) or vehicle+HER4-ECD (n=7), process LSL-K-ras g12D; P53 fl/Flmouse.Figure representative in Fig. 8 C is from the average percent variation ± SEM of the tumor load of baseline.Utilize the check of DunnettShi multiple comparisons to compare all treatment group for vehicle.**p=0.0016。Use unpaired t check for its monotherapy assessment combination activity.*p<0.05，**p<0.01。
NRG1 acceptor usage in embodiment 8:NSCLC
In order to understand in the NRG1 autocrine signal conduction in NSCLC to adopt which HER acceptor, we assess HER3 and HER4 strikes the low impact on tumor cell proliferation.Compare the high-caliber all HER family receptors of Calu3NSCLC model tormulation with other clone.Generate stable dox induction type shHER3 (Calu3-shHER3) and shHER4 (Calu3-shHER4) Calu3 cell subbreed, and carry the compared with control cells system for the dox induction type shRNA of luciferase.HER3 and HER4 transcript level reduce respectively in the situation that has dox (2ug/ml) in Calu3-shHER3 and Calu3-shHER4, as measured by qPCR, cause the protein level reduced, as measured by the Western trace.Interestingly, the p-AKT downward degree of observing in Calu3-shHER3 in having the situation of dox is more much bigger than what see in Calu3-shHER4, and having pointed out HER3 is the principal recipient of the NRG1 autocrine signal conduction in mediation Calu3 model.
In order to confirm in vivo this effect, use Calu3-shHER3 and the Calu3-shHER4 xenograft models processed with sucrose or dox to implement research.Be applied in its vehicle (sucrose) or dox (2gm/L) (n=14/ group) in tap water arbitrarily to the mouse of Calu3-shHER3 with foundation or Calu3-shHer4 heterograft tumour.Compare with those mouse (TDT=11 days) that receive saccharose treatment, in the mouse that reception dox processes, have the substance of pair Calu3-shHER3 tumor growth to suppress (TDT=19 days).Yet, in the Calu3-shHER4 body in research not to the remarkable inhibition of tumor growth.
Although in extracorporeal receptor analysis and body, the research indication has high HER4 level, the conduction of NRG1 autocrine signal mainly occurs via HER3 in this model.
Assessment NRG1 autocrine signal conduction in H522 people NSCLC clone, the high-caliber HER4 of H522 people NSCLC expression of cell lines, and there is no the HER3 that can detect.Generate the H522-shNRG1 subbreed.H522-shNRG1 cell through serum hunger is used to dox and cause the phosphoric acid HER4 and the phosphoric acid S6 level that reduce.Do not observe difference in the H522-shLuc compared with control cells.Hang down in test cell propagation the needs to every kind of HER family member with striking of siRNA mediation.Only to HER4 but not other HER family receptors strike the low cell proliferation reduced that causes.These Notes of Key Datas NRG1 autocrine signal conduction in the H522 cell, via HER4, occur.So, the conduction of the NRG1 autocrine signal in NSCLC can be by HER3 and HER4 mediation.
Although, for the clear purpose of understanding, aforementioned invention quite at length is described as illustration and example, specification sheets and embodiment should not be construed as and limit the scope of the invention.Complete the including of disclosure of all patents that clearly will quote herein by mentioning and scientific literature.
Reference
1)Lung Cancer Principles and Practice,Third edn(2005)(Philadelphia:Lippincott Williams & Wilkins).
2)Agus,D.B.,et al.(2002).Targeting ligand-activated ErbB2 signaling inhibits breast and prostate tumor growth.Cancer cell 2,127-137.
3)al Moustafa,A.E.,et al(1999).Expression of P185erbB-2,P160erbB-3,P180erbB-4,and heregulin alpha in human normal bronchial epithelial and lung cancer cell lines.Anticancer Res 19,481-486.
4)Baldi,P.,and Long,A.D.(2001).A Bayesian framework for the analysis of microarray expression data:regularized t -test and statistical inferences of gene changes.Bioinformatics 17,509-519.
5)Bao,S.,et al.(2006).Stem cell-like glioma cells promote tumor angiogenesis through vascular endothelial growth factor.Cancer research 66,7843-7848.
6)Brennan,S.K.,and Matsui,W.(2009).Cancer stem cells:controversies in multiple myeloma.Journal of molecular medicine(Berlin,Germany)87,1079-1085.
7)Carey,K.D.,et al.(2006).Kinetic analysis of epidermal growth factor receptor somatic mutant proteins shows increased sensitivity to the epidermal growth factor receptor tyrosine kinase inhibitor,erlotinib.Cancer research 66,8163-8171.
8)Costello,R.T.,et al.(2000).Human acute myeloid leukemia CD34+/CD38-progenitor cells have decreased sensitivity to chemotherapy and Fas-induced apoptosis,reduced immunogenicity,and impaired dendritic cell transformation capacities.Cancer research 60,4403-4411.
9)Dahabreh,I.J.,et al.(2010).Somatic EGFR mutation and gene copy gain as predictive biomarkers for response to tyrosine kinase inhibitors in non-small cell lung cancer.Clin Cancer Res 16,291-303.
10)Dean,M.,Fojo,T.,and Bates,S.(2005).Tumour stem cells and drug resistance.Nature reviews 5,275-284.
11)Ding,L.,et al.(2008).Somatic mutations affect key pathways in lung adenocarcinoma.Nature 455,1069-1075.
12)Doebele,R.C.,et al.(2010).New strategies to overcome limitations of reversible EGFR tyrosine kinase inhibitor therapy in non-small cell lung cancer.Lung Cancer 69,1-12.
13)Dylla,S.J.,et al.(2008).Colorectal cancer stem cells are enriched in xenogeneic tumors following chemotherapy.PloS one 3,e2428.
14)Goffin,J.,et al.(2010).First-line systemic chemotherapy in the treatment of advanced non-small cell lung cancer:a systematic review.J Thorac Oncol 5,260-274.
15)Gollamudi,M.,et al.(2004).Autocrine activation of ErbB2/ErbB3receptor complex by NRG-1 in non-small cell lung cancer cell lines.Lung Cancer 43,135-143.
16)Gray,D.C.,et al.(2007).pHUSH:a single vector system for conditional gene expression.BMC Biotechnol 7,61.
17)Hirsch,F.R.,et al.(2007).Combination of EGFR gene copy number and protein expression predicts outcome for advanced non-small-cell lung cancer patients treated with gefitinib.Ann Oncol 18,752-760.
18)Holmes,W.E.,et al.(1992).Identification of heregulin,a specific activator of p185erbB2.Science(New York,NY 256,1205-1210.
19)Horner MJ,et al(eds)SEER Cancer Statistics Review，1975-2006.In,(National Cancer Institute.Bethesda,MD).
20)Jackson,E.L.,et al.(2001).Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras.Genes Dev 15,3243-3248.
21)Johnson,B.E.,and Janne,P.A.(2006).Rationale for a phase II trial of pertuzumab,a HER-2 dimerization inhibitor,in patients with non-small cell lung cancer.Clin Cancer Res 12,4436s-4440s.
22)Junttila,T.T.,et al.(2009).Ligand-independent HER2/HER3/PI3K complex is disrupted by trastuzumab and is effectively inhibited by the PI3K inhibitor GDC-0941.Cancer cell 15,429-440.
23)Kosaka,T.,et al.(2004).Mutations of the epidermal growth factor receptor gene in lung cancer:biological and clinical implications.Cancer research 64,8919-8923.
24)Kuyama,S.,et al.(2008).Impact of HER2 gene and protein status on the treatment outcome of cisplatin-based chemoradiotherapy for locally advanced non-small cell lung cancer.J Thorac Oncol 3,477-482.
25)Li,Q.,et al.(2004).Development of an autocrine neuregulin signaling loop with malignant transformation of human breast epithelial cells.Cancer research 64,7078-7085.
26)Liu,L.Z.,et al.(2007).AKT1 amplification regulates cisplatin resistance in human lung cancer cells through the mammalian target of rapamycin/p70S6K1 pathway.Cancer research 67,6325-6332.
27)Lynch,T.J.,et al.(2004).Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib.N Engl J Med 350,2129-2139.
28)Marchetti，A.,et al.(2005).EGFR mutations in non-small-cell lung cancer:analysis of a large series of cases and development of a rapid and sensitive method for diagnostic screening with potential implications on pharmacologic treatment.J Clin Oncol 23,857-865.
29)Matsui,W.,et al.(2004).Characterization of clonogenic multiple myeloma cells.Blood 103,2332-2336.
30)Novak,A.,et al.Z/EG,a double reporter mouse line that expresses enhanced green fluorescent protein upon Cre-mediated excision.Genesis 28,147-155.
31)Oliver,T.G.,et al.(2010).Chronic cisplatin treatment promotes enhanced damage repair and tumor progression in a mouse model of lung cancer.Genes Dev 24,837-852.
32)Paez,J.G.,et al.(2004).EGFR mutations in lung cancer:correlation with clinical response to gefitinib therapy.Science(New York,NY 304,1497-1500.
33)Pao,W.,et al(2005).Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain.PLoS Med 2,e73.
34)Patel,N.V.,et al.(2000).Neuregulin-1 and human epidermal growth factor receptors 2 and 3 play a role in human lung development in vitro.American journal of respiratory cell and molecular biology 22,432-440.
35)Phillips,T.M.,et al.(2006).The response of CD24(-/low)/CD44+breast cancer-initiating cells to radiation.Journal of the National Cancer Institute98,1777-1785.
36)Reissmann,P.T.,et al.(1999).Amplification and overexpression of the cyclin D1 and epidermal growth factor receptor genes in non-small-cell lung cancer.Lung Cancer Study Group.J Cancer Res Clin Oncol 125,61-70.
37)Schaefer,G.,et al.(1997).Gamma-heregulin:a novel heregulin isoform that is an autocrine growth factor for the human breast cancer cell line,MDA-MB-175.Oncogene 15,1385-1394.
38)Sheng,Q.,et al.(2010).An Activated ErbB3/NRG1 Autocrine Loop Supports In Vivo Proliferation in Ovarian Cancer Cells.Cancer cell 17,298-310.
39)Shi,D.,et al.(1992).Overexpression of the c-erbB-2/neu-encodedp185 protein in primary lung cancer.Mol Carcinog 5,213-218.
40)Shigematsu,H.,Lin,L.,et al.(2005).Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers.Journal of the National Cancer Institute 97,339-346.
41)Singh,M.,Lima,et al.(2010).Assessing therapeutic responses in Kras mutant cancers using genetically engineered mouse models.Nat Biotechnol 28,585-593.
42)Sinnberg,T.,et al.(2009).Inhibition of PI3K-AKT-mTOR signaling sensitizes melanoma cells to cisplatin and temozolomide.J Invest Dermatol 129,1500-1515.
43)Storey,J.D.,and Tibshirani,R.(2003).Statistical significance for genomewide studies.Proceedings of the National Academy of Sciences of the United States of America 100,9440-9445.
44)Tzahar,E.,et al.(1994).ErbB-3 and ErbB-4 function as the respective low and high affinity receptors of all Neu differentiation factor/heregulin isoforms.J Biol Chem 269,25226-25233.
45)Weiner，D.B.,et al.(1990).Expression of the neu gene-encoded protein(P185neu)in human non-small cell carcinomas of the lung.Cancer research 50,421-425.
46)Yarden,Y.,and Peles,E.(1991).Biochemical analysis of the ligand for the neu oncogenic recepto r.Biochemistry 30,3543-3550.
47)Yuste,L.,et al.(2005).Activation of ErbB2 by overexpression or by transmembrane neuregulin results in differential signaling and sensitivity to herceptin.Cancer research 65,6801-6810.
48)Zhou,B.B.,et al.(2006).Targeting ADAM-mediated ligand cleavage to inhibit HER3 and EGFR pathways in non-small cell lung cancer.Cancer cell10,39-50.
Figure IDA00002023879700011

Claims (11)

1. a method that extends the front time of tumor recurrence in the cancer patients, comprise the neuregulin antagonist of described patient being used to significant quantity.
2. the method for claim 1, it further comprises the agent of described patient's administering therapeutic.
3. the method for claim 2, wherein said therapeutical agent is chemotherapeutic or antibody.
4. the method for claim 3, wherein said chemotherapeutic is the combination of Taxol or cis-platinum or Taxol and cis-platinum.
5. the method for claim 3, wherein said antibody is EGFR, HER2, HER3 or HER4 antibody.
6. the process of claim 1 wherein that described cancer is selected from lower group: nonsmall-cell lung cancer, mammary cancer, ovarian cancer, head and neck cancer, cervical cancer, bladder cancer, the esophageal carcinoma, prostate cancer and colorectal carcinoma.
7. the process of claim 1 wherein before the prolongation of time before tumor recurrence is than the recurrence in the situation that there is no described neuregulin antagonist at least 1.25 times greatly of times.
8. the process of claim 1 wherein before the prolongation of time before tumor recurrence is than the recurrence in the situation that there is no described neuregulin antagonist at least 1.50 times greatly of times.
9. the process of claim 1 wherein that described neuregulin antagonist is antibody, small molecules, immunoadhesin or RNA.
10. the process of claim 1 wherein that described neuregulin antagonist is the NRG1 antagonist.
11. the process of claim 1 wherein that described neuregulin antagonist is anti-NRG1 antibody.
CN201180009922.3A 2010-02-18 2011-02-17 Neuregulin antagonist and the purposes in treatment cancer thereof Active CN102892779B (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US30587810P 2010-02-18 2010-02-18
US61/305,878 2010-02-18
PCT/US2011/025163 WO2011103242A1 (en) 2010-02-18 2011-02-17 Neuregulin antagonists and use thereof in treating cancer

Publications (2)

Publication Number Publication Date
CN102892779A true CN102892779A (en) 2013-01-23
CN102892779B CN102892779B (en) 2016-12-21

Family

ID=43927589

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201180009922.3A Active CN102892779B (en) 2010-02-18 2011-02-17 Neuregulin antagonist and the purposes in treatment cancer thereof

Country Status (19)

Country Link
US (1) US9556249B2 (en)
EP (1) EP2536748B1 (en)
JP (1) JP5981853B2 (en)
KR (1) KR20130000384A (en)
CN (1) CN102892779B (en)
AU (2) AU2011218125A1 (en)
BR (1) BR112012017405A2 (en)
CA (1) CA2784211C (en)
DK (1) DK2536748T3 (en)
ES (1) ES2519348T3 (en)
HK (1) HK1179997A1 (en)
MX (1) MX2012008958A (en)
MY (1) MY160556A (en)
PL (1) PL2536748T3 (en)
RU (1) RU2587619C2 (en)
SG (1) SG183333A1 (en)
SI (1) SI2536748T1 (en)
WO (1) WO2011103242A1 (en)
ZA (1) ZA201204423B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108563922A (en) * 2018-04-04 2018-09-21 中南大学 Predict method, system and the storage medium of protein RNA conjugate hot spots
CN109923128A (en) * 2016-11-15 2019-06-21 基因泰克公司 Administration for being treated with anti-CD20/ AntiCD3 McAb bispecific antibody

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103080134B (en) 2010-08-20 2015-11-25 诺华股份有限公司 The antibody of EGF-R ELISA 3 (HER3)
TW201302793A (en) 2010-09-03 2013-01-16 Glaxo Group Ltd Novel antigen binding proteins
CA2842375A1 (en) 2011-08-17 2013-02-21 Erica Jackson Neuregulin antibodies and uses thereof
JP6208131B2 (en) * 2011-09-12 2017-10-04 ユニヴェルシテイト ヘントＵｎｉｖｅｒｓｉｔｅｉｔ Ｇｅｎｔ Prognosis and treatment stratification based on neuregulin-1 in colorectal cancer
US20130251703A1 (en) 2011-12-05 2013-09-26 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3) directed to domain iii and domain iv of her3
AR094403A1 (en) 2013-01-11 2015-07-29 Hoffmann La Roche ANTI-HER3 ANTIBODY COMBINATION THERAPY
TW201601754A (en) 2013-09-30 2016-01-16 第一三共股份有限公司 Nucleic acid biomarker and use thereof
EP3087394A2 (en) 2013-12-27 2016-11-02 Merrimack Pharmaceuticals, Inc. Biomarker profiles for predicting outcomes of cancer therapy with erbb3 inhibitors and/or chemotherapies
US10184006B2 (en) 2015-06-04 2019-01-22 Merrimack Pharmaceuticals, Inc. Biomarkers for predicting outcomes of cancer therapy with ErbB3 inhibitors

Family Cites Families (255)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR760712A (en) 1932-09-29 1934-03-01 Dunlop Sa Process for manufacturing articles of rubber or the like
CU22545A1 (en) 1994-11-18 1999-03-31 Centro Inmunologia Molecular OBTAINING A CHEMICAL AND HUMANIZED ANTIBODY AGAINST THE RECEPTOR OF THE EPIDERMAL GROWTH FACTOR FOR DIAGNOSTIC AND THERAPEUTIC USE
US4935341A (en) 1986-06-04 1990-06-19 Whitehead Institute For Biomedical Research Detection of point mutations in neu genes
WO1984003506A1 (en) 1983-03-08 1984-09-13 Commw Serum Lab Commission Antigenically active amino acid sequences
NZ207394A (en) 1983-03-08 1987-03-06 Commw Serum Lab Commission Detecting or determining sequence of amino acids
EP0138854B1 (en) 1983-03-08 1992-11-04 Chiron Mimotopes Pty. Ltd. Antigenically active amino acid sequences
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4943533A (en) 1984-03-01 1990-07-24 The Regents Of The University Of California Hybrid cell lines that produce monoclonal antibodies to epidermal growth factor receptor
AU4434585A (en) 1985-03-30 1986-10-23 Marc Ballivet Method for obtaining dna, rna, peptides, polypeptides or proteins by means of a dna recombinant technique
NZ215865A (en) 1985-04-22 1988-10-28 Commw Serum Lab Commission Method of determining the active site of a receptor-binding analogue
US4737456A (en) 1985-05-09 1988-04-12 Syntex (U.S.A.) Inc. Reducing interference in ligand-receptor binding assays
US4676980A (en) 1985-09-23 1987-06-30 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Target specific cross-linked heteroantibodies
US7838216B1 (en) 1986-03-05 2010-11-23 The United States Of America, As Represented By The Department Of Health And Human Services Human gene related to but distinct from EGF receptor gene
US6548640B1 (en) 1986-03-27 2003-04-15 Btg International Limited Altered antibodies
US5401638A (en) 1986-06-04 1995-03-28 Oncogene Science, Inc. Detection and quantification of neu related proteins in the biological fluids of humans
US5763192A (en) 1986-11-20 1998-06-09 Ixsys, Incorporated Process for obtaining DNA, RNA, peptides, polypeptides, or protein, by recombinant DNA technique
US4968603A (en) 1986-12-31 1990-11-06 The Regents Of The University Of California Determination of status in neoplastic disease
IL85035A0 (en) 1987-01-08 1988-06-30 Int Genetic Eng Polynucleotide molecule,a chimeric antibody with specificity for human b cell surface antigen,a process for the preparation and methods utilizing the same
AU600575B2 (en) 1987-03-18 1990-08-16 Sb2, Inc. Altered antibodies
US5606040A (en) 1987-10-30 1997-02-25 American Cyanamid Company Antitumor and antibacterial substituted disulfide derivatives prepared from compounds possessing a methyl-trithio group
US5770701A (en) 1987-10-30 1998-06-23 American Cyanamid Company Process for preparing targeted forms of methyltrithio antitumor agents
US5824311A (en) 1987-11-30 1998-10-20 Trustees Of The University Of Pennsylvania Treatment of tumors with monoclonal antibodies against oncogene antigens
JP3040121B2 (en) 1988-01-12 2000-05-08 ジェネンテク，インコーポレイテッド Methods of treating tumor cells by inhibiting growth factor receptor function
US5720937A (en) 1988-01-12 1998-02-24 Genentech, Inc. In vivo tumor detection assay
AU3568289A (en) 1988-04-18 1989-11-24 Applied Biotechnology, Inc. Detection of neu gene expression and products
US5266684A (en) 1988-05-02 1993-11-30 The Reagents Of The University Of California Peptide mixtures
US5571689A (en) 1988-06-16 1996-11-05 Washington University Method of N-acylating peptide and proteins with diheteroatom substituted analogs of myristic acid
US5663143A (en) 1988-09-02 1997-09-02 Dyax Corp. Engineered human-derived kunitz domains that inhibit human neutrophil elastase
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
KR0184860B1 (en) 1988-11-11 1999-04-01 메디칼 리써어치 카운실 Single domain ligands receptors comprising said ligands methods for their production and use of said ligands
ATE155813T1 (en) 1989-05-19 1997-08-15 Genentech Inc HER2 EXTRACELLULAR DOMAIN
DE3920358A1 (en) 1989-06-22 1991-01-17 Behringwerke Ag BISPECIFIC AND OLIGO-SPECIFIC, MONO- AND OLIGOVALENT ANTI-BODY CONSTRUCTS, THEIR PRODUCTION AND USE
US5705157A (en) 1989-07-27 1998-01-06 The Trustees Of The University Of Pennsylvania Methods of treating cancerous cells with anti-receptor antibodies
AU645760B2 (en) 1989-08-04 1994-01-27 Berlex Laboratories, Inc. C-erbb-2 external domain: GP75
US6884418B1 (en) 1989-08-04 2005-04-26 Berlex Laboratories, Inc. Use of ligand-mimicking agents and anti-neoplastic drugs in cancer therapy
AU639726B2 (en) 1989-09-08 1993-08-05 Duke University Structural alterations of the egf receptor gene in human gliomas
JP3208427B2 (en) 1989-09-29 2001-09-10 オー・エス・アイ・ファーマシューテイカルズ・インコーポレイテッド Detection and quantification of neu-related proteins in human biological fluids
US5208020A (en) 1989-10-25 1993-05-04 Immunogen Inc. Cytotoxic agents comprising maytansinoids and their therapeutic use
CA2026147C (en) 1989-10-25 2006-02-07 Ravi J. Chari Cytotoxic agents comprising maytansinoids and their therapeutic use
US5959177A (en) 1989-10-27 1999-09-28 The Scripps Research Institute Transgenic plants expressing assembled secretory antibodies
US6075181A (en) 1990-01-12 2000-06-13 Abgenix, Inc. Human antibodies derived from immunized xenomice
US6150584A (en) 1990-01-12 2000-11-21 Abgenix, Inc. Human antibodies derived from immunized xenomice
US5427908A (en) 1990-05-01 1995-06-27 Affymax Technologies N.V. Recombinant library screening methods
US5475096A (en) 1990-06-11 1995-12-12 University Research Corporation Nucleic acid ligands
US5723286A (en) 1990-06-20 1998-03-03 Affymax Technologies N.V. Peptide library and screening systems
US5770429A (en) 1990-08-29 1998-06-23 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5698426A (en) 1990-09-28 1997-12-16 Ixsys, Incorporated Surface expression libraries of heteromeric receptors
US5770434A (en) 1990-09-28 1998-06-23 Ixsys Incorporated Soluble peptides having constrained, secondary conformation in solution and method of making same
CA2090860C (en) 1990-11-21 2003-09-16 Richard A. Houghten Synthesis of equimolar multiple oligomer mixtures, especially of oligopeptide mixtures
ATE164395T1 (en) 1990-12-03 1998-04-15 Genentech Inc METHOD FOR ENRICHMENT OF PROTEIN VARIANTS WITH MODIFIED BINDING PROPERTIES
US5571894A (en) 1991-02-05 1996-11-05 Ciba-Geigy Corporation Recombinant antibodies specific for a growth factor receptor
AU662311B2 (en) 1991-02-05 1995-08-31 Novartis Ag Recombinant antibodies specific for a growth factor receptor
US5834229A (en) 1991-05-24 1998-11-10 Genentech, Inc. Nucleic acids vectors and host cells encoding and expressing heregulin 2-α
IL101943A0 (en) 1991-05-24 1992-12-30 Genentech Inc Structure,production and use of heregulin
US5367060A (en) 1991-05-24 1994-11-22 Genentech, Inc. Structure, production and use of heregulin
LU91067I2 (en) 1991-06-14 2004-04-02 Genentech Inc Trastuzumab and its variants and immunochemical derivatives including immotoxins
WO1994004679A1 (en) 1991-06-14 1994-03-03 Genentech, Inc. Method for making humanized antibodies
US6800738B1 (en) 1991-06-14 2004-10-05 Genentech, Inc. Method for making humanized antibodies
GB9114948D0 (en) 1991-07-11 1991-08-28 Pfizer Ltd Process for preparing sertraline intermediates
US5939531A (en) 1991-07-15 1999-08-17 Novartis Corp. Recombinant antibodies specific for a growth factor receptor
CA2096417C (en) 1991-08-22 2000-10-10 Sarah S. Bacus Methods and compositions for cancer therapy and for prognosticating responses to cancer therapy
EP0604580A1 (en) 1991-09-19 1994-07-06 Genentech, Inc. EXPRESSION IN E. COLI OF ANTIBODY FRAGMENTS HAVING AT LEAST A CYSTEINE PRESENT AS A FREE THIOL, USE FOR THE PRODUCTION OF BIFUNCTIONAL F(ab') 2? ANTIBODIES
US5288477A (en) 1991-09-27 1994-02-22 Becton, Dickinson And Company Method for prognosticating response to cancer therapy
US5587458A (en) 1991-10-07 1996-12-24 Aronex Pharmaceuticals, Inc. Anti-erbB-2 antibodies, combinations thereof, and therapeutic and diagnostic uses thereof
US5270170A (en) 1991-10-16 1993-12-14 Affymax Technologies N.V. Peptide library and screening method
WO1993008829A1 (en) 1991-11-04 1993-05-13 The Regents Of The University Of California Compositions that mediate killing of hiv-infected cells
WO1993012220A1 (en) 1991-12-12 1993-06-24 Berlex Laboratories, Inc. RECOMBINANT AND CHIMERIC ANTIBODIES TO c-erbB-2
AU661533B2 (en) 1992-01-20 1995-07-27 Astrazeneca Ab Quinazoline derivatives
DE69333807T2 (en) 1992-02-06 2006-02-02 Chiron Corp., Emeryville MARKERS FOR CANCER AND BIOSYNTHETIC BINDEPROTEIN THEREFOR
AU4025193A (en) 1992-04-08 1993-11-18 Cetus Oncology Corporation Humanized C-erbB-2 specific antibodies
ZA932522B (en) 1992-04-10 1993-12-20 Res Dev Foundation Immunotoxins directed against c-erbB-2(HER/neu) related surface antigens
WO1994009022A1 (en) 1992-10-09 1994-04-28 Oncor, Inc. Methods for the detection of chromosome structural abnormalities by in situ hybridization to fixed tissue
WO1994011026A2 (en) 1992-11-13 1994-05-26 Idec Pharmaceuticals Corporation Therapeutic application of chimeric and radiolabeled antibodies to human b lymphocyte restricted differentiation antigen for treatment of b cell lymphoma
US5635483A (en) 1992-12-03 1997-06-03 Arizona Board Of Regents Acting On Behalf Of Arizona State University Tumor inhibiting tetrapeptide bearing modified phenethyl amides
US5780588A (en) 1993-01-26 1998-07-14 Arizona Board Of Regents Elucidation and synthesis of selected pentapeptides
DK0616812T3 (en) 1993-03-24 2000-04-25 Berlex Biosciences Combination of antihormone compounds and binding molecules to treat cancer
AU6527894A (en) 1993-03-30 1994-10-24 Trustees Of The University Of Pennsylvania, The Prevention of tumors with monoclonal antibodies against (neu)
EP0714409A1 (en) 1993-06-16 1996-06-05 Celltech Therapeutics Limited Antibodies
GB9314893D0 (en) 1993-07-19 1993-09-01 Zeneca Ltd Quinazoline derivatives
ATE207366T1 (en) 1993-12-24 2001-11-15 Merck Patent Gmbh IMMUNOCONJUGATES
IL112248A0 (en) 1994-01-25 1995-03-30 Warner Lambert Co Tricyclic heteroaromatic compounds and pharmaceutical compositions containing them
IL112249A (en) 1994-01-25 2001-11-25 Warner Lambert Co Pharmaceutical compositions containing di and tricyclic pyrimidine derivatives for inhibiting tyrosine kinases of the epidermal growth factor receptor family and some new such compounds
US5679683A (en) 1994-01-25 1997-10-21 Warner-Lambert Company Tricyclic compounds capable of inhibiting tyrosine kinases of the epidermal growth factor receptor family
US6811779B2 (en) 1994-02-10 2004-11-02 Imclone Systems Incorporated Methods for reducing tumor growth with VEGF receptor antibody combined with radiation and chemotherapy
US20030108545A1 (en) 1994-02-10 2003-06-12 Patricia Rockwell Combination methods of inhibiting tumor growth with a vascular endothelial growth factor receptor antagonist
US5773001A (en) 1994-06-03 1998-06-30 American Cyanamid Company Conjugates of methyltrithio antitumor agents and intermediates for their synthesis
US5910486A (en) 1994-09-06 1999-06-08 Uab Research Foundation Methods for modulating protein function in cells using, intracellular antibody homologues
US5804396A (en) 1994-10-12 1998-09-08 Sugen, Inc. Assay for agents active in proliferative disorders
US5846749A (en) 1994-10-12 1998-12-08 The Regents Of The University Of California Quantitative measurement of tissue protein identified by immunohistochemistry and standardized protein determination
US5789199A (en) 1994-11-03 1998-08-04 Genentech, Inc. Process for bacterial production of polypeptides
US6214388B1 (en) 1994-11-09 2001-04-10 The Regents Of The University Of California Immunoliposomes that optimize internalization into target cells
ATE170082T1 (en) 1994-11-10 1998-09-15 Univ Eberhard Karls METHOD FOR INHIBITING THE GROWTH OF LEUKEMIC CELLS BY HER-2 PROTEIN LINES
EP0794792A1 (en) 1994-12-02 1997-09-17 Chiron Corporation Method of promoting an immune response with a bispecific antibody
US5840523A (en) 1995-03-01 1998-11-24 Genetech, Inc. Methods and compositions for secretion of heterologous polypeptides
US5731168A (en) 1995-03-01 1998-03-24 Genentech, Inc. Method for making heteromultimeric polypeptides
US5783404A (en) 1995-04-13 1998-07-21 Amgen Inc. Methods and compositions for determining HER-2/neu expression using monoclonal antibodies
US5869046A (en) 1995-04-14 1999-02-09 Genentech, Inc. Altered polypeptides with increased half-life
GB9508538D0 (en) 1995-04-27 1995-06-14 Zeneca Ltd Quinazoline derivatives
US5747498A (en) 1996-05-28 1998-05-05 Pfizer Inc. Alkynyl and azido-substituted 4-anilinoquinazolines
US5712374A (en) 1995-06-07 1998-01-27 American Cyanamid Company Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates
US5714586A (en) 1995-06-07 1998-02-03 American Cyanamid Company Methods for the preparation of monomeric calicheamicin derivative/carrier conjugates
JPH11507535A (en) 1995-06-07 1999-07-06 イムクローン システムズ インコーポレイテッド Antibodies and antibody fragments that suppress tumor growth
US6410690B1 (en) 1995-06-07 2002-06-25 Medarex, Inc. Therapeutic compounds comprised of anti-Fc receptor antibodies
DE69638269D1 (en) 1995-06-14 2010-11-18 Univ California HIGH-AFFINE HUMAN ANTIBODY AGAINST TUMORANTIGENE
CZ1598A3 (en) 1995-07-06 1998-04-15 Novartis Ag Pyrrolopyrimidines and process for preparing thereof
US6267958B1 (en) 1995-07-27 2001-07-31 Genentech, Inc. Protein formulation
US6685940B2 (en) 1995-07-27 2004-02-03 Genentech, Inc. Protein formulation
US5783186A (en) 1995-12-05 1998-07-21 Amgen Inc. Antibody-induced apoptosis
US5760041A (en) 1996-02-05 1998-06-02 American Cyanamid Company 4-aminoquinazoline EGFR Inhibitors
GB9603095D0 (en) 1996-02-14 1996-04-10 Zeneca Ltd Quinazoline derivatives
GB9603256D0 (en) 1996-02-16 1996-04-17 Wellcome Found Antibodies
CN100503580C (en) 1996-04-12 2009-06-24 沃尼尔·朗伯公司 Irreversible inhibitor of tyrosine kinase
US5925519A (en) 1996-06-03 1999-07-20 The Regents Of The University Of California Genetic alterations associated with prostate cancer
US5922845A (en) 1996-07-11 1999-07-13 Medarex, Inc. Therapeutic multispecific compounds comprised of anti-Fcα receptor antibodies
NZ333325A (en) 1996-07-12 2000-06-23 Genentech Inc Recombinant chimeric heteromultimer adhesins comprising extracellular domains of ErbB receptors
DE69716916T2 (en) 1996-07-13 2003-07-03 Glaxo Group Ltd CONDENSED HETEROCYCLIC COMPOUNDS AS PROTEIN KINASE INHIBITORS
ID18494A (en) 1996-10-02 1998-04-16 Novartis Ag PIRAZOLA DISTRIBUTION IN THE SEQUENCE AND THE PROCESS OF MAKING IT
NZ519191A (en) 1996-10-18 2005-04-29 Univ Texas Antibodies that bind to domain 1 of ErbB2 useful for inducing cell death via apoptosis, and nucleic acids encoding such antibodies
US6468547B1 (en) 1996-10-30 2002-10-22 Uab Research Foundation Enhancement of tumor cell chemosensitivity and radiosensitivity using single chain secretory antibodies
AU5243198A (en) 1996-10-30 1998-05-22 Uab Research Foundation, The Enhancement of tumor cell chemosensitivity and radiosensitivity using single chain intracellular antibodies
DE69739673D1 (en) 1996-11-27 2009-12-31 Genentech Inc Affinity Purification of Polypeptide Proteins on a Protein A Matrix
AU737910B2 (en) 1997-01-31 2001-09-06 Regents Of The University Of California, The Chimeric antibody fusion proteins for the recruitment and stimulation of an antitumor immune response
US6002008A (en) 1997-04-03 1999-12-14 American Cyanamid Company Substituted 3-cyano quinolines
US20020076695A1 (en) 1997-04-04 2002-06-20 Jeffrey S. Ross Methods for treating prostate cancer
US5994071A (en) 1997-04-04 1999-11-30 Albany Medical College Assessment of prostate cancer
US6235883B1 (en) 1997-05-05 2001-05-22 Abgenix, Inc. Human monoclonal antibodies to epidermal growth factor receptor
AU7165698A (en) 1997-05-06 1998-11-27 American Cyanamid Company Use of quinazoline compounds for the treatment of polycystic kidney disease
US6171586B1 (en) 1997-06-13 2001-01-09 Genentech, Inc. Antibody formulation
DE69830315T2 (en) 1997-06-24 2006-02-02 Genentech Inc., San Francisco GALACTOSYLATED GLYCOPROTEIN CONTAINING COMPOSITIONS AND METHOD FOR THE PRODUCTION THEREOF
US6121415A (en) 1997-07-09 2000-09-19 Genentech, Inc. ErbB4 receptor-specific neuregolin related ligands and uses therefor
TW436485B (en) 1997-08-01 2001-05-28 American Cyanamid Co Substituted quinazoline derivatives
US6040498A (en) 1998-08-11 2000-03-21 North Caroline State University Genetically engineered duckweed
US6602677B1 (en) 1997-09-19 2003-08-05 Promega Corporation Thermostable luciferases and methods of production
EP1028751B1 (en) 1997-10-31 2008-12-31 Genentech, Inc. Methods and compositions comprising glycoprotein glycoforms
CN1278176A (en) 1997-11-06 2000-12-27 美国氰胺公司 Use of quinazoline derivatives as tyrosine kinase inhibitors for treating colonic polyps
US6610833B1 (en) 1997-11-24 2003-08-26 The Institute For Human Genetics And Biochemistry Monoclonal human natural antibodies
DK1034298T3 (en) 1997-12-05 2012-01-30 Scripps Research Inst Humanization of murine antibody
ZA9811162B (en) 1997-12-12 2000-06-07 Genentech Inc Treatment with anti-ERBB2 antibodies.
US6358682B1 (en) 1998-01-26 2002-03-19 Ventana Medical Systems, Inc. Method and kit for the prognostication of breast cancer
US20020192211A1 (en) 1998-03-17 2002-12-19 Hudziak Robert M. Method of treating tumor cells by inhibiting growth factor receptor function
IL138034A0 (en) 1998-03-27 2001-10-31 Genentech Inc Apo-2 ligand-anti-her-2 antibody synergism
US6194551B1 (en) 1998-04-02 2001-02-27 Genentech, Inc. Polypeptide variants
IL138608A0 (en) 1998-04-02 2001-10-31 Genentech Inc Antibody variants and fragments thereof
ES2340112T3 (en) 1998-04-20 2010-05-28 Glycart Biotechnology Ag ANTIBODY GLICOSILATION ENGINEERING FOR THE IMPROVEMENT OF DEPENDENT CELLULAR CYTOTOXICITY OF ANTIBODIES.
US7244826B1 (en) 1998-04-24 2007-07-17 The Regents Of The University Of California Internalizing ERB2 antibodies
CN103641885A (en) 1998-05-06 2014-03-19 基因技术股份有限公司 Protein purification by ion exchange chromatography
US6335155B1 (en) 1998-06-26 2002-01-01 Sunesis Pharmaceuticals, Inc. Methods for rapidly identifying small organic molecule ligands for binding to biological target molecules
US6573043B1 (en) 1998-10-07 2003-06-03 Genentech, Inc. Tissue analysis and kits therefor
GEP20032997B (en) 1998-11-19 2003-06-25 Warner Lambert Co N-[4-(3-Chloro-4-Fluoro-Phenylamino)-7-(3-Morpholin-4-Yl-Propoxy)-Quinazolin-6-Yl]-crylamide, as an Irreversible Inhibitor of Tyrosine Kinases
WO2000039585A1 (en) 1998-12-28 2000-07-06 Sunesis Pharmaceuticals, Inc. Identifying small organic molecule ligands for binding
US6737056B1 (en) 1999-01-15 2004-05-18 Genentech, Inc. Polypeptide variants with altered effector function
WO2000042072A2 (en) 1999-01-15 2000-07-20 Genentech, Inc. Polypeptide variants with altered effector function
EP1146789B1 (en) 1999-01-27 2009-03-18 Cornell Research Foundation, Inc. Treating cancers associated with overexpression of her-2/neu
EP1176195B1 (en) 1999-04-09 2013-05-22 Kyowa Hakko Kirin Co., Ltd. Method for controlling the activity of immunologically functional molecule
US6333348B1 (en) 1999-04-09 2001-12-25 Aventis Pharma S.A. Use of docetaxel for treating cancers
US6316462B1 (en) 1999-04-09 2001-11-13 Schering Corporation Methods of inducing cancer cell death and tumor regression
ATE415979T1 (en) 1999-05-14 2008-12-15 Genentech Inc TREATMENT WITH ANTI-ERBB2 ANTIBODIES
AUPQ105799A0 (en) 1999-06-18 1999-07-08 Victor Chang Cardiac Research Institute, The Cell growth inhibition
US20030086924A1 (en) 1999-06-25 2003-05-08 Genentech, Inc. Treatment with anti-ErbB2 antibodies
CN100340575C (en) 1999-06-25 2007-10-03 杰南技术公司 Humanized anti-ErbB2 antibodies and treatment with anti-ErbB2 antibodies
SI2803367T1 (en) 1999-06-25 2018-04-30 Immunogen, Inc. Methods of treatment using anti-ERBB antibody-maytansinoid conjugates
US20040013667A1 (en) 1999-06-25 2004-01-22 Genentech, Inc. Treatment with anti-ErbB2 antibodies
DK1189634T3 (en) 1999-06-25 2007-06-25 Genentech Inc Treatment of prostate cancer with anti-ErbB2 antibodies
GB9917012D0 (en) 1999-07-20 1999-09-22 Pharmacia & Upjohn Spa Combined preparations comprising antitumor agents
ATE384744T1 (en) 1999-07-29 2008-02-15 Medarex Inc HUMAN ANTIBODIES AGAINST HER2/NEW
ATE428719T1 (en) 1999-07-29 2009-05-15 Gilead Sciences Inc NUCLEIC ACID LIGANDS FOR HEPATOCYTIC GROWTH FACTOR/DISPERSION FACTOR (HGF/SF) AND ITS C-MET RECEPTOR
DK1210115T3 (en) 1999-08-27 2009-11-30 Genentech Inc Dosages for treatment with anti-ErB2 antibodies
CA2383615A1 (en) 1999-09-22 2001-03-29 Corixa Corporation Methods for diagnosis and therapy of hematological and virus-associated malignancies
US7125978B1 (en) 1999-10-04 2006-10-24 Medicago Inc. Promoter for regulating expression of foreign genes
KR100797667B1 (en) 1999-10-04 2008-01-23 메디카고 인코포레이티드 Method for regulating transcription of foreign genes
JP4668498B2 (en) 1999-10-19 2011-04-13 協和発酵キリン株式会社 Method for producing polypeptide
GB9925958D0 (en) 1999-11-02 1999-12-29 Bundred Nigel J Therapeutic use
WO2001044463A1 (en) 1999-12-15 2001-06-21 Genentech, Inc. Shotgun scanning, a combinatorial method for mapping functional protein epitopes
DK1242438T3 (en) 1999-12-29 2007-02-12 Immunogen Inc Cytotoxic agents comprising modified doxorubicins and daunorubicins and their therapeutic use
US20020041865A1 (en) 2000-01-20 2002-04-11 Richard Austin Methods for treating tumors
US20030022918A1 (en) 2000-02-29 2003-01-30 Horak Ivan David Farnesyl protein transferase inhibitor combinations with an her2 antibody
US6632979B2 (en) 2000-03-16 2003-10-14 Genentech, Inc. Rodent HER2 tumor model
US6767541B2 (en) 2000-03-20 2004-07-27 The Regents Of The University Of California HER-2/neu overexpression abrogates growth inhibitory pathways
GB0008368D0 (en) 2000-04-06 2000-05-24 Astrazeneca Ab Combination product
WO2001076630A1 (en) 2000-04-06 2001-10-18 Kyowa Hakko Kogyo Co., Ltd. Diagnostics and remedies for rheumatoid arthritis
LT2857516T (en) 2000-04-11 2017-09-11 Genentech, Inc. Multivalent antibodies and uses therefor
CA2409652A1 (en) 2000-05-15 2001-11-22 Giorgio Massimini Aromatase inhibitors and monoclonal anti-her2 antibodies as antitumors agents
US7306801B2 (en) 2000-05-15 2007-12-11 Health Research, Inc. Methods of therapy for cancers characterized by overexpression of the HER2 receptor protein
PL217410B1 (en) 2000-05-19 2014-07-31 Genentech Inc Gene detection assay for improving the likelihood of an effective response to an erbb antagonist cancer therapy
GB0017635D0 (en) 2000-07-18 2000-09-06 Pharmacia & Upjohn Spa Antitumor combined therapy
TWI317285B (en) 2000-07-28 2009-11-21 Dainippon Sumitomo Pharma Co New use and kit for remedies for cancer
AU2001295002B2 (en) 2000-08-09 2007-05-31 Imclone Systems Incorporated Treatment of hyperproliferative diseases with epidermal growth factor receptor antagonists
US6984494B2 (en) 2000-08-15 2006-01-10 Genentech, Inc. Analytical method
US7064191B2 (en) 2000-10-06 2006-06-20 Kyowa Hakko Kogyo Co., Ltd. Process for purifying antibody
US6946292B2 (en) 2000-10-06 2005-09-20 Kyowa Hakko Kogyo Co., Ltd. Cells producing antibody compositions with increased antibody dependent cytotoxic activity
PL218428B1 (en) 2000-10-06 2014-12-31 Kyowa Hakko Kogyo Kk Cells producing antibody compositions
US6596541B2 (en) 2000-10-31 2003-07-22 Regeneron Pharmaceuticals, Inc. Methods of modifying eukaryotic cells
US7041870B2 (en) 2000-11-30 2006-05-09 Medarex, Inc. Transgenic transchromosomal rodents for making human antibodies
US7005278B2 (en) 2001-03-02 2006-02-28 Danenberg Kathleen D Method of determining dihydropyrimidine dehydrogenase gene expression
MX2008005896A (en) 2000-12-01 2009-03-03 Response Genetics Inc Method of determining epidermal growth factor receptor and her2-neu gene expression and correlation of levels thereof with survival rates.
US6602670B2 (en) 2000-12-01 2003-08-05 Response Genetics, Inc. Method of determining a chemotherapeutic regimen based on ERCC1 expression
US20020142328A1 (en) 2000-12-01 2002-10-03 Danenberg Kathleen D. Method of determining a chemotherapeutic regimen by assaying gene expression in primary tumors
US6582919B2 (en) 2001-06-11 2003-06-24 Response Genetics, Inc. Method of determining epidermal growth factor receptor and HER2-neu gene expression and correlation of levels thereof with survival rates
WO2002045653A2 (en) 2000-12-08 2002-06-13 Uab Research Foundation Combination radiation therapy and chemotherapy in conjuction with administration of growth factor receptor antibody
SK9072003A3 (en) 2001-01-09 2003-11-04 Merck Patent Gmbh Combination therapy using receptor tyrosine kinase inhibitors and angiogenesis inhibitors
US20040138160A1 (en) 2001-04-27 2004-07-15 Kenichiro Naito Preventive/therapeutic method for cancer
RU2003134180A (en) 2001-05-08 2005-02-10 Мерк Патент ГмбХ (DE) COMBINED THERAPY USING AN EGFR ANTIBODY AND ANTIGORMONOUS MEANS
ITRM20010408A1 (en) 2001-07-10 2003-01-10 Univ Napoli Federico Ii CYTOTOXIC HUMAN MINI-ANTIBODY FOR CANCER CELLS THAT EXPRESS THE ERBB2 RECEPTOR.
AU2002326531A1 (en) 2001-08-03 2003-02-17 The Trustees Of The University Of Pennsylvania Monoclonal antibodies to activated erbb family members and methods of use thereof
EP2180044A1 (en) 2001-08-03 2010-04-28 GlycArt Biotechnology AG Antibody glycosylation variants having increased anti-body-dependent cellular cytotoxicity
US20030068318A1 (en) 2001-09-28 2003-04-10 O'brien Timothy Treatment of uterine serous papillary cancer
WO2003035835A2 (en) 2001-10-25 2003-05-01 Genentech, Inc. Glycoprotein compositions
US20030096823A1 (en) 2001-11-16 2003-05-22 Beryl Asp Method for the treatment of cardiotoxicity induced by antitumor compounds
US20040093621A1 (en) 2001-12-25 2004-05-13 Kyowa Hakko Kogyo Co., Ltd Antibody composition which specifically binds to CD20
US20030175845A1 (en) 2002-03-13 2003-09-18 Kalbag Suresh M. Use of sulfitolysis in high performance peptide mapping
JP2005534623A (en) 2002-04-08 2005-11-17 スミスクライン ビーチャム コーポレーション ERB family inhibitors and methods of treating cancer comprising administering RAF and / or RAS inhibitors
US20050031613A1 (en) 2002-04-09 2005-02-10 Kazuyasu Nakamura Therapeutic agent for patients having human FcgammaRIIIa
ES2362419T3 (en) 2002-04-09 2011-07-05 Kyowa Hakko Kirin Co., Ltd. CELLS WITH DEPRESSION OR DELETION OF THE ACTIVITY OF THE PROTEIN THAT PARTICIPATES IN THE TRANSPORT OF GDP-FUCOSA.
PL373256A1 (en) 2002-04-09 2005-08-22 Kyowa Hakko Kogyo Co, Ltd. Cells with modified genome
US20040259150A1 (en) 2002-04-09 2004-12-23 Kyowa Hakko Kogyo Co., Ltd. Method of enhancing of binding activity of antibody composition to Fcgamma receptor IIIa
WO2003084569A1 (en) 2002-04-09 2003-10-16 Kyowa Hakko Kogyo Co., Ltd. Drug containing antibody composition
CA2481837A1 (en) 2002-04-09 2003-10-16 Kyowa Hakko Kogyo Co., Ltd. Production process for antibody composition
ES2401428T3 (en) 2002-04-10 2013-04-19 Genentech, Inc. Anti-HER2 antibody variants
ITTO20020340A1 (en) 2002-04-19 2003-10-20 Biother Di Contardi Gabriella LOCATION OF THE HER2 RECEPTOR BY HUMANIZED BIOTINYLATE ANTIBODY.
US20030202973A1 (en) 2002-04-29 2003-10-30 Dr. George Pieczenik Treatment of refractory human tumors with epidermal growth factor receptor and HER1 mitogenic ligand (EGFRML) antagonists
AU2003239966B9 (en) 2002-06-03 2010-08-26 Genentech, Inc. Synthetic antibody phage libraries
JP5069843B2 (en) 2002-07-15 2012-11-07 ジェネンテック， インコーポレイテッド Method for identifying tumors responsive to treatment with anti-ErbB2 antibodies
CA2496060C (en) 2002-09-11 2015-08-04 Genentech, Inc. Protein purification by ion exchange chromatography
US7361740B2 (en) 2002-10-15 2008-04-22 Pdl Biopharma, Inc. Alteration of FcRn binding affinities or serum half-lives of antibodies by mutagenesis
US20040258685A1 (en) 2002-11-21 2004-12-23 Genentech, Inc. Therapy of non-malignant diseases or disorders with anti-ErbB2 antibodies
AR042485A1 (en) 2002-12-16 2005-06-22 Genentech Inc HUMANIZED ANTIBODY THAT JOINS THE HUMAN CD20
CA2510003A1 (en) 2003-01-16 2004-08-05 Genentech, Inc. Synthetic antibody phage libraries
US20060104968A1 (en) 2003-03-05 2006-05-18 Halozyme, Inc. Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminogly ycanases
US7871607B2 (en) 2003-03-05 2011-01-18 Halozyme, Inc. Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases
US20080241884A1 (en) 2003-10-08 2008-10-02 Kenya Shitara Fused Protein Composition
AU2004280065A1 (en) 2003-10-09 2005-04-21 Kyowa Hakko Kirin Co., Ltd. Process for producing antibody composition by using RNA inhibiting the function of alpha1,6-fucosyltransferase
EA036531B1 (en) 2003-11-05 2020-11-19 Роше Гликарт Аг Type ii anti-cd20 humanized antibody (variants), pharmaceutical composition comprising these antibody variants, and use thereof
ZA200603619B (en) 2003-11-06 2008-10-29 Seattle Genetics Inc Monomethylvaline compounds capable of conjugation to ligands
WO2005053742A1 (en) 2003-12-04 2005-06-16 Kyowa Hakko Kogyo Co., Ltd. Medicine containing antibody composition
ZA200608130B (en) 2004-03-31 2008-12-31 Genentech Inc Humanized anti-TGF-beta antibodies
US7785903B2 (en) 2004-04-09 2010-08-31 Genentech, Inc. Variable domain library and uses
CA2561533C (en) 2004-04-13 2015-06-16 Yvo Graus Anti-p-selectin antibodies
AU2005271902B2 (en) * 2004-07-09 2011-12-08 Wayne State University Hybrid proteins with erbB4 extracellular domain and neuregulin heparin-binding domain for targeting
TWI309240B (en) 2004-09-17 2009-05-01 Hoffmann La Roche Anti-ox40l antibodies
NZ580115A (en) 2004-09-23 2010-10-29 Genentech Inc Cysteine engineered antibody light chains and conjugates
JO3000B1 (en) 2004-10-20 2016-09-05 Genentech Inc Antibody Formulations.
CN102580084B (en) * 2005-01-21 2016-11-23 健泰科生物技术公司 The fixed dosage of HER antibody is administered
CN103251946A (en) * 2005-02-23 2013-08-21 健泰科生物技术公司 Extending time to disease progression or survival in cancer patients using a her dimerization inhibitor
KR20080026562A (en) * 2005-06-02 2008-03-25 갤럭시 바이오테크, 엘엘씨 Methods of treating brain tumors with antibodies
US8679490B2 (en) 2005-11-07 2014-03-25 Genentech, Inc. Binding polypeptides with diversified and consensus VH/VL hypervariable sequences
WO2007064919A2 (en) 2005-12-02 2007-06-07 Genentech, Inc. Binding polypeptides with restricted diversity sequences
EP2016101A2 (en) 2006-05-09 2009-01-21 Genentech, Inc. Binding polypeptides with optimized scaffolds
NZ574093A (en) 2006-06-12 2011-03-31 Symphogen As Pan-cell surface receptor- specific therapeutics
US10118970B2 (en) 2006-08-30 2018-11-06 Genentech, Inc. Multispecific antibodies
US20080226635A1 (en) 2006-12-22 2008-09-18 Hans Koll Antibodies against insulin-like growth factor I receptor and uses thereof
CN100592373C (en) 2007-05-25 2010-02-24 群康科技(深圳)有限公司 Liquid crystal panel drive device and its drive method
EP2009114A1 (en) * 2007-06-29 2008-12-31 Bayer Schering Pharma Aktiengesellschaft Methods, kits, and compounds for determining responsiveness to treatment of a pathological disorder by epothilones
US20100278801A1 (en) 2007-10-16 2010-11-04 Shepard H Michael Compositions comprising optimized her1 and her3 multimers and methods of use thereof
ES2774337T3 (en) 2008-01-07 2020-07-20 Amgen Inc Method for manufacturing heterodimeric Fc molecules of antibodies using electrostatic conduction effects
MA33198B1 (en) 2009-03-20 2012-04-02 Genentech Inc ANTI-HER DI-SPECIFIC ANTIBODIES

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
JAVIER A. MENENDEZ ET AL: "Trastuzumab in Combination With Heregulin", 《JOURNAL OF CLINICAL ONCOLOGY》 *
LISA TURIN, ET AL,: "Human epidermal growth factor receptor (HER-1:HER-3) Fc-mediated heterodimer has broad antiproliferative activity in vitro and in human tumor xenografts", 《MOL CANCER THERAPEUTICS》 *
TSAL MIAW-SHEUE ETAL: "Blockage of heregulin expression inhibits tumorigenicity and metastasis of breast cancer", 《ONCOGENE》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109923128A (en) * 2016-11-15 2019-06-21 基因泰克公司 Administration for being treated with anti-CD20/ AntiCD3 McAb bispecific antibody
CN108563922A (en) * 2018-04-04 2018-09-21 中南大学 Predict method, system and the storage medium of protein RNA conjugate hot spots

Also Published As

Publication number Publication date
MX2012008958A (en) 2012-08-23
SI2536748T1 (en) 2014-12-31
ZA201204423B (en) 2015-03-25
AU2016201848A1 (en) 2016-04-21
AU2011218125A1 (en) 2012-07-19
CN102892779B (en) 2016-12-21
DK2536748T3 (en) 2014-10-13
CA2784211A1 (en) 2011-08-25
ES2519348T3 (en) 2014-11-06
US9556249B2 (en) 2017-01-31
CA2784211C (en) 2019-12-24
KR20130000384A (en) 2013-01-02
EP2536748A1 (en) 2012-12-26
JP5981853B2 (en) 2016-08-31
US20110229493A1 (en) 2011-09-22
RU2012139825A (en) 2014-03-27
BR112012017405A2 (en) 2018-08-14
MY160556A (en) 2017-03-15
EP2536748B1 (en) 2014-08-20
JP2013520431A (en) 2013-06-06
PL2536748T3 (en) 2015-01-30
WO2011103242A1 (en) 2011-08-25
HK1179997A1 (en) 2013-10-11
RU2587619C2 (en) 2016-06-20
SG183333A1 (en) 2012-09-27

Similar Documents

Publication Publication Date Title
CN102892779B (en) Neuregulin antagonist and the purposes in treatment cancer thereof
CN103080136B (en) Anti-Axl antibody and using method
CN102906117B (en) Anti-LRP6 antibody
CN103596983B (en) Anti-FGFR4 antibody and using method
CN105209919B (en) The biomarker and method for treating PD-1 and PD-L1 related disorders
CN110418851A (en) The treatment of cancer and diagnostic method
CN103890007A (en) Neuregulin antibodies and uses thereof
CN107667119A (en) Treatment and diagnostic method for cancer
CN109154613A (en) For monitoring and the method for the treatment of cancer
CN109196121A (en) Treatment and diagnostic method for cancer
CN106132439A (en) Comprise antiangiogenic agent and OX40 combines the combination treatment of agonist
CN105143264A (en) Compositions and methods for diagnosis and treatment of hepatic cancers
CN104487087A (en) Methods of treating FGFR3 related conditions
CN105246511A (en) Methods of treating and preventing cancer drug resistance
CN105307683A (en) Methods of treating cancer and preventing cancer drug resistance
CN103781493A (en) Anti-c-met antibody formulations
CN107787331A (en) Anti-HER 2 and application method
CN103025353A (en) Treatment methods
CN109154027A (en) For monitoring and the method for the treatment of cancer
CN105744954A (en) Anti-rsp02 and/or anti-rsp03 antibodies and their uses
CN104994879A (en) Methods of treating cancer and preventing drug resistance
JP2022512744A (en) Diagnosis and treatment for sarcomatoid kidney cancer
CN106456627A (en) Methods of treating cancer and preventing cancer drug resistance

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant