CN102888381A - Recombinant CCR5[delta]32 genotype embryonic stem cell strain and preparation method thereof - Google Patents

Abstract

The invention relates to a recombinant CCR5[delta]32 genotype embryonic stem cell strain, and further relates to a preparation method of the stem cell strain. The method performs site-directed deletion and modification for 32 bases of the CCR5 gene of human embryonic stem cells by using a homologous recombination technology, and builds the immortalized primate embryonic stem cell strain with the CCR5[delta]32/[delta]32 genotype. The obtained cell strain can not only resist the intrusion of the virus, but also retain other functions of the CCR5 after being orientedly induced and differentiated to CD4 positive cells, thereby providing a new approach for treating AIDS.

Description

Recombinant C CR5 Δ 32 genotype embryonic stem cell strains and preparation method thereof

Technical field:

The present invention relates to the 32 genotype embryonic stem cell strains of a kind of recombinant C CR5 Δ 32/ Δ, the invention still further relates to the method that adopts the homologous gene recombinant technology to obtain described stem cell strain.

Background technology:

CCR5 is one of T cell surface associating acceptor of being combined with virus of AIDS, and researchists are seeking the method that changes or destroy the CCR5 function of receptors always, wishes to reach the purpose for the treatment of acquired immune deficiency syndrome (AIDS).Someone utilizes Zinc finger nuclease to destroy CCR5 genetic expression (the Nathalia Holt et al.Human hematopoietic stem/progenitor cells modified by zinc-finger nucleases targeted to CCR5control HIV-1in vivo.Nat Biotechnology28 (8): 839-47 of hemopoietic stem cell, 2010.), the CCR5 gene is undergone mutation.But the shortcoming of this method is to cause the CCR5 gene complete deactivation state of T cell, can not keep other function of CCR5.And the cell of this CCR5 gene inactivation does not possess immortality.

Found that CCR5 Δ 32/ Δ 32 genotypic crowds have natural immunizing power to acquired immune deficiency syndrome (AIDS).Document (Hutter, G.etal.Long-term control of HIV by CCR5Delta32/Delta32stem cell transplantation.N Engl JMed 360:692-698,2009) report is used with the marrow of the CCR5 gene of natural disappearance 32 bases and has successfully been cured the patient that a routine existing leukemia has again acquired immune deficiency syndrome (AIDS).CCR5 Δ 32 refers to the mutant of 32 bases of this genetically deficient, thereby produces immune deficiency because this sudden change causes virus of AIDS can't attack the T cell with the T Cell binding.

Regrettably, although there is this genotype in nature itself, really be in this genotype of homozygotic state (CCR5 Δ 32/ Δ 32) and acquired immune deficiency syndrome (AIDS) is had the individual few of natural immunity, in European crowd, only account for 1%, and at Asia and other ethnic groups so far there are no report.Therefore, want to utilize their marrow or Cord blood to treat acquired immune deficiency syndrome (AIDS) and substantially do not possess possibility and practicality.Moreover, no matter be marrow or Cord blood, all can't at amplification in vitro, increase especially its exclusive scarcity.

And the CCR5 Δ cell strain 32/ Δ 32 and that have immortality of 32 bases among the artificial fixed point deletion CCR5 there is not yet report so far.

The intestinal bacteria homologous recombination is a kind of new genetic engineering technique that grows up late 1990s, carry out in intestinal bacteria Escherichia coli at first, it can rely on restriction enzyme site and fix a point accurately to finish such as fragment insertion, deletion and sequence change etc. genetic modification.

The intestinal bacteria homologous recombination technique is usually used in the targeting modification-gene of chromosomal DNA to be knocked in and knocks out, and space (gap-repair) mode of repairing is obtained goal gene.The two something in common is all must be with the short homologous sequence of the synthetic both sides 50-70bp of PCR method, and the fragment that then will lack between homologous sequence by homologous recombination in the bacterium is inserted the target location of gene or extracted corresponding gene target fragment.

This shows, utilize the multiple genetic engineering procedures such as this technology can be carried out easily the knocking out of DNA target sequence, knocks in, cloned in the intestinal bacteria body, sudden change.In conjunction with embryonic stem cell (ES) technology of at present develop rapidly so that on the biological integral level directed change and the genetic material of modifying mammal be called possibility.

Although gene targeting is applied to transform the embryonic stem cell gene early, but because mostly being, former targeting vector utilizes restriction enzyme digestion technique construction targeting vector, because the homology arm length of the limitation targeting vector of restriction enzyme site is restricted, thereby so that the homologous recombination success ratio of embryonic stem cell is extremely low.And utilize recently homologous recombination technique in the bacterium on the basis of BACDNA, can construct the targeting vector of sufficiently long homology arm, therefore can improve significantly efficient (the Song et al.Modeling disease in human ESCs using an efficient BAC-based homologous recombination system.Cell Stem Cell of embryonic stem cell gene targeting, 6:80-89,2010).

To sum up, if can utilize homologous gene recombinant technology means, 32 bases of fixed point deletion CCR5 obtain CCR5 Δ 32, set up a kind of pure and mild state CCR5 Δ 32/ Δ 32 genotypic immortality cell strains that are in.This immortality cell strain under suitable condition, can directed differentiation be needed cell (such as the CD4 positive cell), can resist the intrusion of specific virus, has kept again other function of CCR5 simultaneously.And this process can infinitely repeat.The CCR5 Δ 32/ Δ 32 genotype embryonic stem cell strains of therefore, setting up immortality are significant.

Summary of the invention:

The objective of the invention is to 32 bases of the CCR5 gene of embryonic stem cell the deletion of fixing a point and transform, set up the CCR5 Δ 32/ Δ 32 genotype primate embryonic stem cell strains with immortality.Resulting cell strain be directed be induced to differentiate into the CD4 positive cell after, can resist the intrusion of specific virus, kept again other function of CCR5, and had immortality.

Another object of the present invention is to utilize homologous recombination technique to prepare above-mentioned cell strain.

The present invention fixes a point to delete to 32 bases of the CCR5 gene of human embryo stem cell and transforms, and has set up the CCR5 Δ 32/ Δ 32 genotype embryonic stem cell strains with immortality, has reached the foregoing invention purpose.

Therefore, the invention provides a kind of its CCR5 gene specific site and lacked 32 pairs of bases; Described specific site is 3321-3352, i.e. TATCAATTCTGGAAGAATTTCCAGACATTAAA (CCR5 gene NG 012637.1 is positioned at 3p21.31).

The present invention confirms CCR5 Δ 32/ Δ, 32 genotype (seeing embodiment) in the process of gene targeting hES.

The present invention proves according to multinomial human embryo stem cell strain identification experiment commonly used (expression of multipotency gene, embryoid body formation, teratoma form and karyotyping): the feature that has still kept human embryo stem cell through the human embryo stem cell strain after the genetic modification is active, that is, this cell strain has the ability that is divided into the CD4 positive T cell.The T cell surface marker is that CD3 is positive, and the T cell subsets that infects for the HIV virus attack is that CD4 is positive.If CCR5 Δ 32/ Δ 32 genotype hES cell strains become the CD4 positive T cell at Differentiation Induction in vitro, can carry out immunohistochemical experiment and flow cytometry evaluation by anti-CD3, CD4 antibody, prove that this cell strain has the ability that is divided into the CD4 positive T cell when experimental result shows noble cells when being the two positive of CD3, CD4.

The 32 genotype human embryo stem cell strains of resulting CCR5 Δ 32/ Δ of the present invention after directed differentiation is marrow hemopoietic stem cells (or CD4 positive cell), namely can be used as the cellularity medicine, are directly used in the gene therapy of HIV virus.

Because human embryo stem cell has totipotency, can be divided into the various histocytes of human body and comprise the CD4 positive T cell under external specified conditions; Human embryo stem cell has the stem cell characteristic simultaneously, can be in external infinite multiplication amplification.Therefore, the CCR5 Δ 32/ Δ 32 genotype human embryo stem cell strains that the present invention obtains are a kind of special human embryo stem cell strains, can infinitely increase and grow, and have again multi-lineage potential.When its directed differentiation is bone marrow stem cell (or CD4 positive cell), can be used for the treatment of acquired immune deficiency syndrome (AIDS).

Because CCR5 has participated in the immunologic function of body, when Δ 32 sudden change occurs when, only cause virus not invade, and it is substantially unaffected to other function, and because the immortality of embryonic stem cell and unlimited amplification ability, so that this process is able to unlimited repetition, has very strong practicality, for the treatment acquired immune deficiency syndrome (AIDS) provides a kind of new way.

On the other hand, the present invention also provides a kind of method that adopts homologous recombination technique to obtain the 32 genotype embryonic stem cell strains of CCR5 Δ 32/ Δ.

The technical way of present method is to adopt homologous recombination technique structure targeting vector in BAC DAN and the intestinal bacteria, and electricity is transformed the CCR5 gene after changing embryonic stem cell over to.

Concrete grammar is: adopt homologous recombination technique structure targeting vector in BAC DAN and the intestinal bacteria, electricity is transformed the CCR5 gene after transforming embryonic stem cell.

Described structure targeting vector is to make up two with middle targeting vector and CCR5 Δ 32 targeting vectors without the screening sign of positive-negative selection PNS mark, obtains a kind of CCR5 Δ 32/ Δ 32 genotype embryonic stem cell strains of screening marker-free by mark and two step of displacement shooting method.

The contriver has used aforementioned BAC clone strain RP11-24F11 with CCR5 gene, and the test kit " counter-selection BAC modification Kit " of German genebridge company, this test kit can carry out homologous recombination in the bacterium to BAC DNA, thereby obtains quickly aforementioned three kinds of targeting vectors.Then by " mark and displacement " strategy, using these 3 kinds of targeting vectors through two step homologous recombination, is that the hES cell strain of CCR5 transform the CCR5 Δ 32/ Δ 32 genotypic hES cell strains of not being with any marker gene or external fragment as with genotype.

Method of the present invention not only can be used for 32 base fixed points deletion of the CCR5 gene of human embryo stem cell, also can be used for the genetic modification of other primate embryonic stem cells, sets up 32 genotypic other primate embryonic stem cell strains of CCR5 Δ 32/ Δ.

Description of drawings:

Fig. 1 inserts rpsl-neo cassette;

Fig. 2 CCR5 Δ 32DNA replaces rpsl-neo cassette;

Fig. 3 rpsl-neo cassette design and insertion point;

Fig. 4 CCR5 Δ 32DNA design and replacement site;

Fig. 5 targeting vector-3 linearizing;

Fig. 6 targeting vector 1 makes up;

1 linearizing of Fig. 7 targeting vector;

Fig. 8 targeting vector 2 makes up;

2 linearizings of Fig. 9 targeting vector;

Figure 10 hES is gene targeting for the first time;

Figure 11 hES is gene targeting for the second time;

Figure 12 CCR5 Δ 32DNA replaces the upper marker gene of hES for the first time;

Figure 13 CCR5 Δ 32DNA replaces the upper marker gene of hES for the second time.

Embodiment:

One, targeting vector makes up

(1) targeting vector 3 makes up (seeing Fig. 1,2,5)

1.PCR amplification contains the rpsl-neo fragment of homology arm

1.1 design of primers

1.1.1 primer (the seeing Fig. 3) upstream primer of selected marker gene Insert Fragment (rpsl-neo cassette) design comprises the 24bp primer of the rpsl-neo of the homology arm and 3 of 5 ' end 50bp ' end; Downstream primer design comprises the 22bp primer of the rpsl-neo of the homology arm and 3 of 5 ' end 50bp ' end.

Upstream primer

AATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTGGCCTGGTGATGATGGCGGGATCG

Downstream primer

AGCAGATGACCATGACAAGCAGCGGCAGGACCAGCCCCAAGATGACTATCCTCGAGTCAGAAGAACTCGTCAAGAAGG

1.1.2CCR5 Δ 32 oligonucleotide fragments (CCR5 Δ 32DNA) synthetic primer (seeing Fig. 4)

Upstream primer

GGTGGTGGCTGTGTTTGGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAG

Downstream primer

ACCGAAGCAGAGTTTTTAGGATTCCCGAGTAGCAGATGACCATGACAAGCAGCGGCAGGACCAGCCCCAAGATGACTATCCTGACTGTATGGAAAATGAG

It is that annealing PCR uses that these two primer back segments are drawn the oblique line place.

1.2PCR

1.2.1 selected marker gene Insert Fragment (rpsl-neo cassette)

1.2.2CCR5 Δ 32 oligonucleotide fragments (CCR5 Δ 32DNA)

2. pRedET plasmid electricity is transformed in the DH-10B bacterial strain that contains BAC

2.1 first day

2.1.1 RPCI-24F11 (BAC DNA) glycerol stock of Invitrogen company is got the collarium picking to 1.0ml LB (containing paraxin), 37 ℃, 250rpm, incubated overnight

2.1.2 simultaneously picking RPCI-24F11 (BAC DNA) is to agar plate (containing 50 μ g/ml Streptomycin sulphates), and 37 ℃, spend the night, test this clone and whether contain streptomycin resistance, contain in theory resistance.

2.2 second day

2.2.1 the BAC bacterium of cultivating in 1.0ml LB of incubated overnight was inoculated in the micro-EP pipe that contains 1.4ml LB (containing paraxin) with yesterday.

2.2.237℃，2-3h，1000rpm

2.2.3 preparation electrotransfection competent cell: with the EP pipe in 2 ℃ of whizzers with the centrifugal 30sec of 11000rpm, abandon supernatant, ice bath adds 0 ℃ of ddH2O of 1ml, mixing, the centrifugation step above repeating.Abandon supernatant, only stay 20-30 μ l volume, piping and druming is even, ice bath.

2.2.4 the pRedET plasmid 1 μ l in the test kit is added in the top cell mixing, ice bath.Then be transferred in the electric shock cup of ice bath precooling.

Cup places electric conversion instrument, 1350V, 5ms 2.2.5 will shock by electricity.

2.2.6 add rapidly 1ml LB (antibiotic-free), mixing is transferred to micro-EP pipe.

2.2.730℃，70min，1000rpm。

2.2.8 place on the agar plate and (contain 3 μ g/ml tsiklomitsins, 15 μ g/ml paraxin) with getting collarium picking 100 μ l bacteriums, 30 ℃, spend the night (surpassing at least 15h).Avoid illumination in the operating process, because tsiklomitsin is to photaesthesia as far as possible.

3. insert rpsl-neo cassette in RPCI-24F11 (BAC DNA)

3.1 the 3rd day

3.1.1 be cloned in 1.0ml LB (containing 3 μ g/ml tsiklomitsins, 15 μ g/ml paraxin) on several 2.2.8 flat boards of picking,

30 ℃, spend the night (surpassing at least 15h).

The 4th day

3.1.2 whether observe and grow next day, if growth gets wherein that each 30 μ l of a pipe bacterium liquid place two to contain in 1.4ml LB (containing 3 μ g/ml tsiklomitsins, 15 μ g/ml paraxin) the EP pipe, and 30 ℃, 2h, 1100rpm is until the OD value reaches about 0.3.

3.1.3 add 50 μ l 10%L-pectinoses in one of them EP pipe, so that its ultimate density is 0.3%-0.4%, to induce pRedET plasmid expression recombinant protein.Other EP pipe is not done and is induced to do negative control.37 ℃, jolting 45min to 1h.

3.1.4 preparation electrotransfection competent cell: with the EP pipe in 2 ℃ of whizzers with the centrifugal 30sec of 11000rpm, abandon supernatant, ice bath adds 0 ℃ of ddH2O of 1ml, mixing, the centrifugation step above repeating.Abandon supernatant, only stay 20-30 μ l volume, piping and druming is even, ice bath.

3.1.5 add the linear rpsl-neo cassette of 1-2 μ l (100-200ng) (induce and do not induce) in top two EP pipes, mixing is transferred in the electric shock cup.

Cup places electric conversion instrument, 1350V, 5ms 3.1.6 will shock by electricity.

3.1.7 add rapidly 1mlLB (antibiotic-free), mixing is transferred to micro-EP pipe.30℃，70min，1000rpm。

3.1.8 place on the agar plate and (contain 3 μ g/ml tsiklomitsins, 15 μ g/ml paraxin, 15 μ g/ml kantlex) with getting collarium picking 100 μ l bacteriums, 30 ℃, spend the night, surpass at least 20h to obtain enough large clone.Induce: ratio 〉=100 of clone's number of not inducing: 1.

Induce dull and stereotyped mono-clonal to be inoculated among the 100 μ l LB (containing 3 μ g/ml tsiklomitsins, 15 μ g/ml paraxin, 15 μ g/ml kantlex) 3.1.9 get 10.

3.1.10 a clone who gets abreast in the RPCI-24F11 flat board is inoculated among the 100 μ l LB (containing 15 μ g/ml paraxin).

3.1.1130℃，1100rpm，1-2h。To be used for 3.1.12,13,14 all steps of back.

3.1.12 after incubation time arrives, be inoculated in agar plate (containing 50 μ g/ml Streptomycin sulphates, 15 μ g/ml paraxin, 15 μ g/ml kantlex) with getting the collarium bacterium liquid that takes a morsel, 37 ℃, spend the night the function of the rpsl-neo cassette that inserts with test.

3.1.13 get the bacterium liquid 30 μ l of 3.1.11 step in 2ml LB substratum (containing 15 μ g/ml paraxin, 15 μ g/ml kantlex, or 15 μ g/ml paraxin), 37 ℃, 1100rpm spends the night.Identify with BAC DNA preparation or the PCR that is used for the back.

3.1.14 the fresh LB substratum of 300 μ l (containing 3 μ g/ml tsiklomitsins, 15 μ g/ml paraxin, 15 μ g/ml kantlex) is added in the bacterium liquid of 3.1.11 step, 30 ℃, 1100rpm spends the night.To be used for next round RedET homologous recombination, 32DNA displaces rpsl-neo cassette with the CCR5 Δ.

3.1.15 check the streptomycin resistance situation of cloning in the 3.1.12 step, determine which clone has Streptomycin sulphate susceptibility.

3.1.16 with 4 ℃ of preservations of clone of 3.1.15 step streptomycin resistance, until after BAC-rpsl-neo clone enzyme is cut or PCR identifies.

Only have the rpsl-neo of affirmation cassette insertion and rpsl gene not to suddenly change (function test: Streptomycin sulphate is responsive), just can carry out next step restructuring.

4. with CCR5 Δ 32DNA displacement rpsl-neo cassette (obtaining targeting vector 3 is RPCI-24F11-CCR5 Δ 32) first day

4.1 the mono-clonal bacterium liquid (namely having Streptomycin sulphate susceptibility) of insertion rpsl-neo cassette chosen successfully places in the LB substratum (containing 3 μ g/ml tsiklomitsins, 15 μ g/ml paraxin, 15 μ g/ml kantlex), 30 ℃, spends the night.Second day

4.2 place two to contain in 1.4ml LB (containing 3 μ g/ml tsiklomitsins, 15 μ g/ml paraxin, 15 μ g/ml kantlex) the EP pipe each 30 μ l of bacterium liquid next day, and 30 ℃, 2h, 1100rpm is until the OD value reaches about 0.3.

4.3 add 50 μ l 10%L-pectinoses in one of them EP pipe, so that its ultimate density is 0.3%-0.4%, to induce pRedET plasmid expression recombinant protein.Other EP pipe is not done and is induced to do negative control.37 ℃, jolting 45min to 1h.

4.4 preparation electrotransfection competent cell: with the EP pipe in 2 ℃ of whizzers with the centrifugal 30sec of 11000rpm, abandon supernatant, ice bath adds 0 ℃ of ddH2O of 1ml, mixing, the centrifugation step above repeating.Abandon supernatant, only stay 20-30 μ l volume, piping and druming is even, ice bath.

4.5 add the linear CCR5 Δ of 1-2 μ l (100-200ng) 32DNA (induce and do not induce) in top two EP pipes, mixing is transferred in the electric shock cup.

Cup places electric conversion instrument, 1350V, 5ms 4.6 will shock by electricity.

4.7 add rapidly 1ml LB (antibiotic-free), mixing is transferred to micro-EP pipe.30℃，70min，1000rpm。

4.8 place on the agar plate and (contain 15 μ g/ml paraxin, 50 μ g/ml Streptomycin sulphates) with getting collarium picking 20-100 μ l bacterium, flat board should not contain tsiklomitsin, otherwise RedET expression plasmid or existence or bacterium are dead.

4.937 ℃, spending the night, the RedET expression plasmid will disappear.

The experimenter should obtain to surpass 50 bacterial clones, induces: ratio 〉=10 of clone's number of not inducing: 1.According to the bacterium liquid measure of inoculating, perhaps the background growth conditions of minute quantity growth bacterium colony or dispersivity all can appear on two flat boards.In addition, can know at least on the flat board and see independent one by one bacterium colony inducing.

The second step homologous recombination efficiency surpasses 90% usually, although most of streptomycin resistance clone may contain correct BAC recon, the secondary restructuring also may occur, and mainly is the deletion of the upper internal repeat of BAC.Of this sort secondary recombination event incidence difference on each BAC is very large, very heterogeneity.If the BAC carrier that hits is because direct repeat sequence causes Genomic instability, so need to identify a large amount of clones, to verify their whether correct homologous recombination.

Do not occur to reset to modify in order to find out which clone, must separate BAC DNA.Picking 10-20 experiment clone and 2 contrast clones also can be the BAC clone preparation DNA of any modification some former beginning and end of picking so that comparison.Usually these BAC DNA are done following analysis: a) the little DNA of carrying enzyme is cut then electrophoresis, and this experiment can detect the secondary recombination event, so recommend to do this experiment; And/or b) utilizes the primer in the insertion point outside to do the PCR detection, then the dna sequencing analysis is done in the zone of striding recombination site.

5.PCR identify the BAC of correct restructuring

Can utilize clone PCR to identify (be that mono-clonal of picking is resuspended in 30 aqua sterilisas, 98 ℃ are boiled 5min, and getting wherein, 2 μ l do pcr template)

Be further checking, can do restriction analysis by the little BAC of carrying DNA.

(2) targeting vector 1 makes up (seeing Fig. 6,7)

1. synthesize neo-IRES-tk fragment (neo-IRES-tk cassette)

By the synthetic neo-IRES-tk fragment with 5 ' end and 3 ' each 50bp homology arm of end of company

2.neo-IRES-tk cassette inserts RPCI-24F11BAC

It is identical that experimentation and rpsl-neo cassette recited above insert among the RPCI-24F11 (BAC DNA), and finally obtaining targeting vector 1 is RPCI-24F11-neo-IRES-tk.

(3) targeting vector 2 makes up (seeing Fig. 8,9)

1. synthesize puro-IRES-CD fragment (puro-IRES-CD cassette)

By the synthetic puro-IRES-CD fragment with 5 ' end and 3 ' each 50bp homology arm of end of company

2.puro-IRES-CD cassette inserts RPCI-24F11BAC

It is identical that experimentation and rpsl-neo cassette recited above insert among the RPCI-24F11 (BAC DNA), and finally obtaining targeting vector 2 is RPCI-24F11-puro-IRES-CD.

Two, targeting vector electrotransfection hES cell

After above three targeting vectors of acquisition are RPCI-24F11-neo-IRES-tk, RPCI-24F11-puro-IRES-CD, RPCI-24F11-CCR5 Δ 32, import in the hES cell with targeting vector 1 (RPCI-24F11-) first and carry out homologous recombination, finish for the first time gene targeting (seeing Figure 10), utilize the successful hES clone of neo screening of medicaments G418 screening target practice, obtain CCR5/CCR5-neo-IRES-tk genotype hES; Import to finish for the first time gene targeting and to be verified as in the positive hES cell with targeting vector 2 (RPCI-24F11-puro-IRES-CD) subsequently and carry out homologous recombination, finish for the second time gene targeting (seeing Figure 11), utilize the successful hES clone of neo and puro screening of medicaments G418 and tetracycline screening target practice, obtain CCR5-neo-IRES-tk/CCR5-puro-IRES-CD genotype hES; Then import in the CCR5-neo-IRES-tk/CCR5-puro-IRES-CD genotype hES cell with targeting vector 3 (RPCI-24F11-CCR5 Δ 32) and carry out homologous recombination, finish for the first time CCR5 Δ 32 alternative label gene neo-IRES-tk (seeing Figure 12), with the successful hES clone of the negative screening of medicaments GANC screening of tk target practice, obtain CCR5 Δ 32/CCR5-puro-IRES-CD genotype hES; Again import in the CCR5 Δ 32/CCR5-puro-IRES-CD genotype hES cell with targeting vector 3 (RPCI-24F11-CCR5 Δ 32) and carry out homologous recombination, finish for the second time CCR5 Δ 32 alternative label gene puro-IRES-CD (seeing Figure 13), with tk and the negative screening of medicaments GANC of CD and the successful hES clone of 5-FC screening target practice, obtain CCR5 Δ 32/ Δ 32 genotype hES.Because the experimental technique process of above-mentioned four gene targetings is identical, the targeting vector that just imports in the hES cell is different with screening of medicaments, and what write below therefore is exactly the universal program of gene targeting, and does not repeat one by one four times.

With targeting vector DNA and the suspension hES cytomixis horizontal high voltage electricimpulse of going forward side by side, the hole that DNA can pass on the cytolemma is transferred in the hES cell.

(1) just carry out electrotransfection after the hES cell of recovery passes a generation at least, the hES passage carries out transfection after growing to 100% density.

(2) transfection is front 2 hours, renews bright substratum.

(3) substratum is abandoned in suction, washs culture dish 2 times with PBS.

(4) every diameter 90mm culture dish adds 1.5ml 0.25% trypsinase, 37 ℃, 5min; Perhaps add Dispase (just having covered cell), 37 ℃, 8min.

(5) add the 3.5mlhES cell culture medium, repeatedly aspirate into single cell suspension with suction pipe.Measure total cellular score with blood cell counting plate, the each transfection of per 100 μ g targeting vector DNA needs 2 * 10 usually ⁷Individual cell.

(6) 1000r/min, the centrifugal hES cell suspension of 2min.Supernatant is abandoned in suction, and cell is resuspended among the 10ml PBS.

(7) again centrifugal, 1000r/min, 2min.Cell is resuspended among the PBS, makes cell density reach 2 * 10 ⁷/ ml.

(8) with 100 μ g targeting vector DNA and 1ml cell mixing, in the electroporation groove of packing into, as on ice.

(9) in gene pulser, shock by electricity, 320V, 200 μ F place on ice.

(10) the hES cell culture medium mixing that the cell in the electroporation groove and 7ml is fresh is divided in 4 culture dish that covered with the trophocyte.

(11) the hES cell of 40 μ l untransfecteds is laid in another culture dish in contrast.

After (12) 2 days, change G418 (50 μ g/ml) or Puromycin (0.5 μ g/ml) hES cell screening substratum into, serve and change fresh screening culture medium every day.

Can begin selected clone after (13) 2 weeks.

Three, positive hES clone's selects

(1) the hES cell after the transfection after 2 weeks, is abandoned substratum in the drug screening culture medium culturing, washes once with PBS, changes 10ml PBS again.

(2) 200 μ l autospencers are adjusted to 20 μ l, select resistance hES clone with the rifle head at microscopically.

(3) shift in each 96 orifice plate of being cloned into a sky.Usually each culture dish can 30-50 clone of picking.

(4) add 50 μ l, 0.25% trypsinase-EDTA solution in the hole of each 96 hole culture dish, 37 ℃, effect 3-5min perhaps adds Dispase (just having covered cell), and 37 ℃, 8min.

(5) every hole adds 100 μ l hES cell culture mediums.100 μ l, eight passage autospencers are adjusted to 80 μ l, use repeatedly pressure-vaccum of rifle head, make the hES clone become single cell suspension.Each hES clone's single cell suspension five equilibrium to two has been inoculated in trophocyte's the 96 hole culture dish in advance.Position and the order of cloning in two culture dish are identical.

(6) renew bright hES cell culture fluid every day, behind the cultivation 7d, with wherein 96 hole culture dish are frozen by the cryopreservation methods of back.

(7) will remain a hES clone in the 96 hole culture dish and after trypsinase or Dispase digestion, be transferred in the 24 hole culture dish, and use trophocyte's culture medium culturing to substratum color yellowing.

Four, positive hES clone's is frozen

(1) substratum is abandoned in suction, adds 100 μ l PBS.

(2) inhale and to abandon PBS, add 50 μ l with 0.125% trypsinase of PBS dilution-EDTA solution, 37 ℃, effect 3-5min perhaps adds Dispase (just having covered cell), and 37 ℃, 8min.

(3) add the frozen substratum of 100 μ l (15%DMSO, 20% foetal calf serum, 65%DMEM).

(4) with eight passage autospencer rifle heads pressure-vaccum repeatedly, at least 10 times.Seal 96 hole culture dish with sealed membrane, and it is enclosed in the plastics bag, culture dish surface and plastic bag surface are all carried out mark.

(5) for the chilling rate that slows down, culture dish is put into foam box, place again-80 ℃ of refrigerators frozen.

Five, the preparation of hES cloned genomic dna

(1) cultivates the hES cell with 12 holes or 24 hole culture dish, for the hES cell for the preparation of genomic dna, need not in substratum, to add bFGF.

(2) every hole adds cell lysis buffer solution (0.5%SDS, 0.1mol/L NaCL, 0.01mol/L EDTA, 0.02mol/L Tris CL pH7.6, Proteinase K, 100 μ g/ml) 400 μ l.

(3) 50 ℃ of insulation 2h.

(4) every pipe adds the saturated 6mol/L NaCL of 200 μ l.

(5) the Eppendorf pipe is placed carton acutely rock 200 times.

(6) the Eppendorf pipe is placed on ice 10min.

(7) the centrifugal 10min of room temperature 14000r/min.

(8) supernatant 500 μ l are moved in the clean Eppendorf pipe, every pipe adds 0.8ml ethanol, mixing.

(9) the centrifugal 5min of 14000r/min abandons supernatant.

(10) with the Eppendorf mouth of pipe down, drying at room temperature.DNA is resuspended among the 50-100 μ l TE, 37 ℃ be incubated to DNA dissolve fully after (24-48h) can be used for PCR or Southern hybridization analysis.

Six, the PCR method is screened the hES cell that hits

(1) according to the susceptibility of PCR reaction with 20-50 hES cell genomic dna sample mix.

(2) by following prescription the PCR reaction is set:

(3) carry out the PCR reaction by following condition:

a.50℃，10min

b.94℃，2min

C.94 ℃, 30s-1min; 50-62 ℃, 1min; 60-72 ℃, 2-7min, 40 circulations.

d.72℃，10min

(4) getting 10 μ l PCR reactants analyzes by agarose gel electrophoresis.

(5) sepharose is carried out sex change, neutralizing treatment after transfer DNA to nitrocellulose filter.

(6) with the homology galianconism on the dna probe that separates hybridize.

(7) wash film post-exposure 5min-1h.The product of positive control band and correct homologous recombination should be behind exposure 15-30min as seen.

(8) sample that produces positive band is carried out indivedual PCR.Clone to the PCR positive should verify at last by Southern hybridization.

Seven, the Southern hybrid method screens the hES cell that hits

(1) with an amount of hES cell genomic dna of one or more digestion with restriction enzyme (about 10 μ g DNA and 30 μ l reaction volume).

(2) at the upper slow electrophoresis (voltage 22V) of sepharose (0.65%-0.8%), 24-48h.

(3) under UV-light, take pictures behind the electrophoresis, place a transparent fluorescence ruler along the gel edge, in order to can from photo, read the migration distance of DNA marker.

(4) gel is placed the 0.25mol/L HCL of several times volume soak 20min, and constantly leniently jolting.

(5) gel is soaked in the sex change damping fluid of several times volume (1.5mol/L NaCl, 0.5mol/L NaOH), soaks 30min, gentle jolting.

(6) discard the neutralization buffer (1mol/L, ph7.4,1.5mol/LNaCL) that the sex change damping fluid adds the several times volume, in the continuous jolting 30min of room temperature.

(7) gel is placed 20 * SSPE, room temperature 30min.

(8) with capillary transfer method or electrotransfer method agarose gel electrophoresis among the DNA is transferred on the nitrocellulose filter.

(9) after transfer finishes, with the position of pencil mark gel well.

(10) crosslinked (120mg/cm of UV irradiation ²)

(11) 2 * SSPE, the room temperature rinsing.

(12) filter membrane is placed in the middle of two groups of 3mm filter paper, do roasting 1h with vacuum oven in 80 ℃.

(13) filter membrane is placed prehybridization solution (10 * Denhardt ' s, 4 * SET, 0.1%SDS, 0.1%Na ₂H ₂P ₂O ₇, 100 μ g/ml) and the salmon sperm DNA of sex change), 65 ℃ of incubation 1h in the hybridization bottle.

(14) with dna probe and salmon sperm DNA, make its sex change in 100 ℃ of heating 5min, place rapidly 5min on ice.

(15) getting 200 μ l dna probes and 100 μ l (10mg/ml) salmon sperm DNAs adds in the new prehybridization solution of 10ml.

(16) prehybridization solution that will hybridize in the bottle discards, and adds the hybridization solution that contains the sex change probe.65 ℃ of hybridization are spent the night.

(17) filter membrane is transferred to rinsing damping fluid (0.4 * SET, 0.1%SDS, the 0.1%Na that fills hundreds of milliliters ₂H ₂P ₂O ₇) in, gentleness is shaken rinsing twice in 65 ℃ of shaking baths, each 10min.

(18) filter membrane is placed two 3mm paper pause drying, wrap filter membrane with preservative film, stick several fluorescence labels, in order to calibrate later on the position of radioautograph and filter membrane.

(19) filter membrane is placed the X-ray film folder add screen exposure 12-48h in-70 ℃.

20 * SET damping fluid: 3mol/L NaCL

0.4mol/L Tris·Cl，pH7.5

20mmol/L EDTA

Claims (8)

1. the CCR5 Δ 32/ Δ 32 genotype cell strains of a primate is characterized in that the CCR5 gene is positioned at 32 pairs of base deletions in 3321～3352 sites.

2. cell strain claimed in claim 1 is characterized in that the strain of gene recombination embryonic stem cell.

3. claim 1 or 2 described cell strains, described primate is the people.

4. cell strain claimed in claim 2 is characterized in that adopting the homologous gene recombinant technology to set up.

5. the preparation method of CCR5 Δ 32/ Δ 32 genotype embryonic stem cell strains is characterized in that adopting the homologous gene recombinant technology, directly to the deletion of fixing a point of 32 bases of the CCR5 gene of embryonic stem cell.

6. preparation method claimed in claim 5, described homologous gene recombinant technology is to adopt that homologous recombination technique makes up targeting vector in BAC DAN and the intestinal bacteria, electricity is transformed the CCR5 gene after transforming embryonic stem cell.

7. preparation method claimed in claim 6, described structure targeting vector is to make up two with middle targeting vector and CCR5 Δ 32 targeting vectors without the screening sign of positive-negative selection (PNS) mark, obtains a kind of CCR5 Δ 32/ Δ 32 genotype embryonic stem cell strains of screening marker-free by mark and two step of displacement shooting method.

8. claim 1 or the 2 described cell strains application in the medicine of preparation acquired immune deficiency syndrome (AIDS).

Images