CN102876580A - Separation and application of Nectria fungi for promoting growth of Cymbidium wenshanense tissue culture plants - Google Patents
Separation and application of Nectria fungi for promoting growth of Cymbidium wenshanense tissue culture plants Download PDFInfo
- Publication number
- CN102876580A CN102876580A CN2010105777615A CN201010577761A CN102876580A CN 102876580 A CN102876580 A CN 102876580A CN 2010105777615 A CN2010105777615 A CN 2010105777615A CN 201010577761 A CN201010577761 A CN 201010577761A CN 102876580 A CN102876580 A CN 102876580A
- Authority
- CN
- China
- Prior art keywords
- orchid
- fungi
- wenshanense
- cymbidium
- tissue culture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to separation and an application of Nectria fungi for promoting growth of Cymbidium wenshanense tissue culture plants and belongs to the field of plant protection and biological technology. The produced strain is Neonectria macrodidyma spp. strain, and its collection number is CGMCC No.3929. The strain provided by the invention has an obvious characteristic of promoting the growth of orchid tissue culture plants. According to the invention, symbiotic fungi obtained by separation is inoculated to Cymbidium wenshanense tissue culture seedling by two methods; the separated strain undergoes preliminary identification through morphological features; and combining molecular biology such as ITS amplification, cloning and sequencing methods, etc., the screened symbiotic fungi which can promote the growth of Cymbidium wenshanense tissue culture plants is identified as the Neonectria macrodidyma spp. fungi. The invention can solve the problem of low survival rate of transplanting orchid tissue culture plants to a certain extent and has an active effect of promoting orchid industry development in future.
Description
Technical field:
Growth has promoter action to the Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling to the invention relates to the VA Mycorrhizal Fungi that is separated to from orchid root, belongs to plant protection and biological technical field.
Background technology:
The orchid family (Orchidaceae) plant is commonly called as orchid, and the whole world approximately has 700 to belong to kind more than 20000 and a large amount of mutation, mainly is distributed in the torrid zone, subtropics and Temperate Region in China, and especially the torrid areas in South America and Asia is many.Orchid can give birth to orchid, epiphytic orchid and saprophytic blue 3 classes according to the difference of growing environment with being divided into, as a kind of important ornamental flower and resources of medicinal plant, huge economic worth is arranged and utilize potential in flowers and natural drug industry.Along with the fast development of the modernization of Chinese medicine and orchid industry, the demand of orchid is increased rapidly.But Orchid Seeds is tiny, only the undifferentiated proembryo of tool; Root is thick, and the root hair is undeveloped.Seed can not normally be sprouted under field conditions (factors), and root can not satisfy plant materials to the demand of moisture and nutritive substance, makes the artificial culture difficult of orchid.In recent years, the tissue rapid propagation technology has been applied to orchid, realized the industrial seedling rearing of orchid, but the tissue cultured seedling transplanting survival rate is very low, poor growth, be difficult to spread, its major cause is that orchid can't form mycorhiza with relevant fungi in a short time, and mycorrhizal fungi has great significance for orchid.Studies show that, after the mycorhiza that only has fungi and Orchid Seeds or root to form symbiosis under the state of nature concerned, orchid could normally sprout and grow.
Mycorhiza is the symbiosis association of formed mutual reciprocity and mutual benefit between a class fungi in the soil and the root system of plant.Frank in 1885 has proposed " mycorhiza (Mycorrhiza) " this term and has described the symbiosis association of plant and fungi, and mycorrhizal research begins to develop rapidly thus.Link has at first confirmed to exist fungi in the orchid root, and afterwards, orchid and mycorhiza relation are confirmed, and have carried out broad research.Bernard reported first in 1903 relation of fungi and germination of arethusa seeds.Burgeff draws fungi and the research of the orchid family seed, the sprouting under the infecting of fungi of the orchid family seed, he separates and has named many fungies, develop the most important theories of digestion fungi as orchid growing nutrient source, in succession carried out in a large number afterwards the research of the relation between Orchid Mycorrhizae fungi and the orchid both at home and abroad.
China's orchid VA Mycorrhizal Fungi researchdevelopment is very fast, and the rhizoma Gastrodiae VA Mycorrhizal Fungi successfully has been applied to gastrodia seed germination and artificial culture.But still there are a lot of orchid VA Mycorrhizal Fungis to need research, understand kind and the characteristics of fungal component in depth, inquire into the interaction mechanism between orchid and fungi, screen good orchid symbiosis fungi, development the orchid family microbial inoculum has great importance for the batch production production that realizes orchid.
Summary of the invention:
Main purpose of the present invention is that solution the orchid family tissue cultured seedling transplanting survival rate is low, filters out the fungal component that is conducive to the orchid growth.
The fungi that the present invention adopts is that Dali sheet Nectriaceae (Neonectria macrodidyma spp.) belongs to the Classification And Nomenclature of suggestion: Neonectria macrodidyma.Depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center; Address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City; Preservation date: on 06 17th, 2010; The numbering CGMCC No.3929 that preservation is registered on the books.
Fungal bacterial strain Nectriaceae of the present invention (Neonectria macrodidyma spp.) belongs to bacterial strain, separation is from orchid root inner tissue, through the cultivation proterties, morphology and Molecular Identification, this bacterial strain is that Nectriaceae (Neonectria macrodidyma spp.) belongs to.This bacterial strain has following characteristics: (1) this bacterial strain can be observed hyphae colorless at microscopically, multi-branched; (2) this bacterial strain can promote the growth of orchid tissue cultured seedling.
The present invention is achieved in that and separates fungi in the orchid root, the fungi that is separated to is carried out identification of morphology, and effective symbiosis fungi is screened in its inoculation of carrying out the orchid tissue cultured seedling, and effective strain is carried out ITS section cloning and sequencing.
The isolation and identification method that Nectriaceae of the present invention (Neonectria macrodidyma spp.) belongs to:
1, the separation of VA Mycorrhizal Fungi and purifying
PDA solid culture based formulas is: 20% potato, 2% glucose, 2% agar powder.
Take off healthy and strong root segment from the orchid plant, rinse well, put into beaker stand-by.On the Bechtop that has carried out sterilization and disinfected, the root segment in the beaker with 70% alcohol disinfecting 30s, is soaked 1min with 0.1% mercuric chloride solution again, use at last sterile water wash 3-5 time.Undercut is become small pieces, and drying is put into the PDA substratum.24 ℃ of constant temperature dark culturing.After growing mycelia around the root segment, choose mycelia and transfer in another culture dish, after bacterium colony grows up to, repeat to get the colony edge purifying of partly transferring.
2, the Morphological Identification of isolated strains
Bacterial strain behind the purifying was cultivated 5-7 days under 25 ℃ constant temperature, be placed on the slide glass the colony edge mycelia that takes a morsel with tweezers or dissecting needle, slide is made in KOH solution with 3% and the dyeing of 0.05% sarranine dye liquor, by its morphological specificity of microscopic examination, under the preliminary evaluation isolated strains.
3, the Molecular Identification of isolated strains
3.1DNA extraction
With mycelium inoculation in liquid PDA, be positioned over shaking table 25 ℃ of conditions and cultivated 10 days, blot mycelia moisture with thieving paper and take by weighing weight, change in the mortar of precooling, with liquid nitrogen it fully is ground to Powderedly, adds 1mlDAN Extraction buffer (100mM Tris-HCL PH8.0; 100mM EDTA; 250mM NaCl), 20%SDS, 5M NaCl, 10%CTAB, abundant mixing, insulation is 60 minutes under 60 ℃ of conditions, and 10,000rpm got supernatant liquor in centrifugal 5 minutes, add isopyknic saturated phenol, the centrifuging and taking supernatant liquor adds isopyknic 25: 24: 1 saturated phenol: chloroform: primary isoamyl alcohol, centrifuging and taking supernatant liquor, add isopyknic 24: 1 chloroform: the primary isoamyl alcohol concussion mixes, the centrifuging and taking supernatant liquor, the ice dehydrated alcohol that adds 2 times of volumes places-20 ℃ of refrigerators, precipitation DAN, centrifugal, keep precipitation, and ice ethanol rinsing 2 times, natural air drying or vacuum-drying with 70%, add TE damping fluid dissolving DAN, place-30 ℃ stand-by.
3.2 the 5.8S rDNA-ITS of isolated strains clone and order-checking
Carry out DNA cloning with ITS1 and ITS4 primer.Amplified reaction carries out at PCR instrument Perkin Elmer, and the PCR reaction system is 50uL.Following PCR circulation: 94 ℃ of denaturation 3min, circulate 1 time; 94 ℃ of sex change 1min, 51 ℃ of annealing 1min, 72 ℃ are extended 1min, 30 circulations; Last 72 ℃ are extended 10min.The PCR product detects with 1% agarose gel electrophoresis.Pcr amplification product carries out purifying with the test kit that the precious biology in Dalian provides, but purified product direct Sequencing, for subsequent use.Plasmid vector pGEM-T-easy and the ligation of PCR purified product, conversion are screened by recombinant plasmid PCR through red-hickie, choose at last positive recon and serve Hai Shenggong and carry out dna sequencing.
3.3 sequential analysis
Utilize the software analysis such as Bioxm, DNAMAN and BLAST, carry out homology relatively with the known array that logs among the GenBank.
Nectriaceae of the present invention (Neonectria macrodidyma spp.) belongs to fungi and promotes Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling growth test
1, test materials is prepared
The matter that fetches earth is soil preferably, sterilization; Select the blue tissue cultured seedling of the red bamboo of mountain of papers for for the examination material, carry out inoculation experiments with the fungi that separates in the orchid root material.
2, test method
2.1 mix the soil inoculation, cultured inoculation is had to kind in the soil of Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling, carry out symbiosis culture, and the orchid of being planted with the soil that does not connect bacterium in contrast, and repeated inoculation 3 times is observed the leaf look of orchid seedling after 2 months, growing way, the root growth situation filters out effective bacterium.
2.2 infect Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling root with the bacterial strain that separates, after the moisturizing inoculation after the week the orchid seed in the soil of sterilizing, carry out symbiosis culture, and the orchid of being planted with the soil that does not connect bacterium in contrast, repeated inoculation 3 times, the leaf look of observation orchid seedling after 2 months, growing way, the root growth situation filters out effective bacterium.
3, test-results
Table 1 Nectriaceae (Neonectria macrodidyma spp.) belongs to bacterial strain and Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling symbiosis culture situation
To belong to the Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling surviving rate of inoculation higher for Nectriaceae (Neonectria macrodidyma spp.) as can be seen from Table 1, mixes soil inoculation and bacterial strain and invade the average survival of root and reached 89.17% and 87.78%.The tissue cultured seedling transplanting survival rate is played apparent in view promoter action.
After 2 months, through screening, the leaf look of the Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling of discovery Nectriaceae (Neonectria macrodidyma spp.) genus inoculation and growing way are all obviously good than what contrast, blue seedling leaf look greener, well developed root system, grow fine, filter out the fungal component that is conducive to the orchid growth.
Description of drawings
Fig. 1 is that Nectriaceae (Neonectria macrodidyma spp.) belongs to the cultivation proterties figure of bacterial strain on the PDA substratum;
Fig. 2 is that Nectriaceae (Neonectria macrodidyma spp.) belongs to inoculation and to kind effect of inoculation and contrast figure in the Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling soil arranged;
Fig. 3 is that Nectriaceae (Neonectria macrodidyma spp.) belongs to the effect of inoculation figure that bacterial strain infects Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling root;
Fig. 4 is that Nectriaceae (Neonectria macrodidyma spp.) belongs to the inoculation contrast figure that bacterial strain infects Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling root.
Embodiment:
The separation of fungal component:
PDA solid culture based formulas is: 20% potato, 2% glucose, 2% agar powder.
Take off healthy and strong root segment from the orchid plant, rinse well, put into beaker stand-by.On the Bechtop that has carried out sterilization and disinfected, the root segment in the beaker with 70% alcohol disinfecting 30s, is soaked 1min with 0.1% mercuric chloride solution again, use at last sterile water wash 3-5 time.Undercut is become small pieces, and drying is put into the PDA substratum.PDA solid culture based formulas is: 20% potato, 2% glucose, 2% agar powder.24 ℃ of constant temperature dark culturing after growing mycelia around the root segment, are chosen mycelia and are transferred in another culture dish, after bacterium colony grows up to, repeat to get the colony edge purifying of partly transferring.
The identification of morphology of isolated strains: the bacterial strain behind the purifying was cultivated 5-7 days under 25 ℃ constant temperature, be placed on the slide glass the colony edge mycelia that takes a morsel with tweezers or dissecting needle, slide is made in KOH solution with 3% and the dyeing of 0.05% sarranine dye liquor, by its morphological specificity of microscopic examination, under the preliminary evaluation isolated strains.
The screening of effective strain:
Cultured inoculation is had to kind in the soil of Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling, carry out symbiosis culture, and the orchid of being planted with the soil that does not connect bacterium is in contrast, observe the leaf look of orchid seedling after 2 months, growing way, the root growth situation filters out effective bacterium;
Infect Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling root with the bacterial strain that separates, after the moisturizing inoculation after the week the orchid seed in the soil of sterilizing, carry out symbiosis culture, and the orchid of being planted with the soil that does not connect bacterium in contrast, observes the leaf look of orchid seedling after 2 months, growing way, the root growth situation filters out effective bacterium.
The Molecular Identification of bacterial strain:
The extraction of isolated strains DNA: with mycelium inoculation in liquid PDA, being positioned over shaking table 25 ℃ of conditions cultivated 10 days, blot mycelia moisture with thieving paper and take by weighing weight, change in the mortar of precooling, with liquid nitrogen it fully is ground to Powderedly, adds 1mlDAN Extraction buffer (100mM Tris-HCL PH8.0; 100mM EDTA; 250mM NaCl), 20%SDS, 5M NaCl, 10%CTAB, abundant mixing, insulation is 60 minutes under 60 ℃ of conditions, and 10,000rpm got supernatant liquor in centrifugal 5 minutes, add isopyknic saturated phenol, the centrifuging and taking supernatant liquor adds isopyknic 25: 24: 1 saturated phenol: chloroform: primary isoamyl alcohol, centrifuging and taking supernatant liquor, add isopyknic 24: 1 chloroform: the primary isoamyl alcohol concussion mixes, the centrifuging and taking supernatant liquor, the ice dehydrated alcohol that adds 2 times of volumes places-20 ℃ of refrigerators, precipitation DAN, centrifugal, keep precipitation, and ice ethanol rinsing 2 times, natural air drying or vacuum-drying with 70%, add TE damping fluid dissolving DAN, place-30 ℃ stand-by.
5.8S rDNA-ITS clone and the order-checking of isolated strains: carry out DNA cloning with ITS1 and ITS4 primer.Amplified reaction carries out at PCR instrument Perkin Elmer, and the PCR reaction system is 50uL.Following PCR circulation: 94 ℃ of denaturation 3min, circulate 1 time; 94 ℃ of sex change 1min, 51 ℃ of annealing 1min, 72 ℃ are extended 1min, 30 circulations; Last 72 ℃ are extended 10min.The PCR product detects with 1% agarose gel electrophoresis.Pcr amplification product carries out purifying with the test kit that the precious biology in Dalian provides, but purified product direct Sequencing, for subsequent use.Plasmid vector pGEM-T-easy and the ligation of PCR purified product, conversion are screened by recombinant plasmid PCR through red-hickie, choose at last positive recon and serve Hai Shenggong and carry out dna sequencing.Check order and classify as:
TCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTATTTGTTGCCTCGGCGGTGCCTGTTCCGACAGCCCGCCAGAGGACCCCAAACCCTGATTACATTTAAGAAGTCTTCTGAGTAAACCGATTAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAAGCCCCCGGGCTTGGTGTTGGGGATCGGCGAGCCTCCGCGCCCGCCGTCCCCTAAATCTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAGTAGCACACCTCGCACTGGGAAACAGCGCGGCCACGCCGTTAAACCCCCAACTTCTGAACGTTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
Utilize the software analysis such as Bioxm, DNAMAN and BLAST, carry out homology relatively with the known array that logs among the GenBank.Through comparison, this isolated strains belongs to Nectriaceae (Neonectria macrodidyma spp.) and belongs to fungi.Namely get symbiosis fungal bacterial strain of the present invention.
Claims (3)
1. symbiosis fungi that can promote Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling growth, it is characterized in that: this symbiosis fungal bacterial strain is that Nectriaceae (Neonectria macrodidyma spp.) belongs to preserving number CGMCC No.3929.
2. the described Nectriaceae of claim 1 (Neonectria macrodidyma spp.) belongs to the cultural method of bacterial strain, it is characterized in that, after the orchid root tissue disinfection is complete, portion of tissue is smashed to pieces, observe first and have or not hypha body, if any hypha body, orchid root thinly sliced to cultivate at water agar and PDA substratum to obtain, its water agar and PDA culture medium prescription are as follows:
(1) water agar prescription: agar 2.0%;
(2) PDA culture medium prescription: potato 20.0%, glucose 2.0%, agar 2.0%.
3. Nectriaceae claimed in claim 1 (Neonectria macrodidyma spp.) belongs to the application of bacterial strain in promoting the growth of Cymbidium wenshanense Y. S. Wu et F. Y. Liu tissue cultured seedling.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201010577761.5A CN102876580B (en) | 2010-12-08 | 2010-12-08 | Separation and application of Nectria fungi for promoting growth of Cymbidium wenshanense tissue culture plants |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201010577761.5A CN102876580B (en) | 2010-12-08 | 2010-12-08 | Separation and application of Nectria fungi for promoting growth of Cymbidium wenshanense tissue culture plants |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102876580A true CN102876580A (en) | 2013-01-16 |
CN102876580B CN102876580B (en) | 2014-12-10 |
Family
ID=47478102
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201010577761.5A Expired - Fee Related CN102876580B (en) | 2010-12-08 | 2010-12-08 | Separation and application of Nectria fungi for promoting growth of Cymbidium wenshanense tissue culture plants |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102876580B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108048334A (en) * | 2017-12-22 | 2018-05-18 | 中国林业科学研究院林业研究所 | It is a kind of to promote the blue screening of Tulasnella fungi sprouted with Bowring cattleya seed of sclerophyll and syntaxial system method for building up |
CN113943744A (en) * | 2021-11-02 | 2022-01-18 | 云南农业大学 | Application of RCA gene of cymbidium floribundum and vector construction method thereof |
-
2010
- 2010-12-08 CN CN201010577761.5A patent/CN102876580B/en not_active Expired - Fee Related
Non-Patent Citations (4)
Title |
---|
OLIVEIRA,H.等: "《GenBank登录号:AM419066》", 《GENBANK》 * |
OLIVERIA, H.等: "《GenBank登录号:AM419071》", 《GENBANK》 * |
OLIVERIA,H.等: "《GenBank登录号:AM419068》", 《GENBANK》 * |
OLIVERIA,H.等: "《GenBank登录号:AM419070》", 《GENBANK》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108048334A (en) * | 2017-12-22 | 2018-05-18 | 中国林业科学研究院林业研究所 | It is a kind of to promote the blue screening of Tulasnella fungi sprouted with Bowring cattleya seed of sclerophyll and syntaxial system method for building up |
CN108048334B (en) * | 2017-12-22 | 2021-01-08 | 中国林业科学研究院林业研究所 | Establishment method of symbiotic system of gloeosporium fungi for promoting germination of cymbidium and cattleya seeds |
CN113943744A (en) * | 2021-11-02 | 2022-01-18 | 云南农业大学 | Application of RCA gene of cymbidium floribundum and vector construction method thereof |
Also Published As
Publication number | Publication date |
---|---|
CN102876580B (en) | 2014-12-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Chen et al. | Isolation and identification of endophytic and mycorrhizal fungi from seeds and roots of Dendrobium (Orchidaceae) | |
CN101486970B (en) | Fungus strain and uses thereof | |
CN103087927B (en) | Fungus for promoting symbiotic germination of paphiopedilum hirsutissimum seed and application thereof | |
CN102839131B (en) | Trichoderma viride and application thereof | |
CN106399178B (en) | Bacillus amyloliquefaciens and its application with degradation Phos and bacteriostasis | |
CN107058160B (en) | One plant of peanut rhizosphere bacillus amyloliquefaciens and its application | |
Tian et al. | Effects of VA mycorrhizae and Frankia dual inoculation on growth and nitrogen fixation of Hippophae tibetana | |
CN113801808B (en) | Streptomyces albocongensis and application thereof | |
Naraghi et al. | Biological control of Verticillium wilt of greenhouse cucumber by Talaromyces flavus | |
CN103725637B (en) | Bacillus pumilus and cultural method thereof and application | |
CN105754864B (en) | Bletilla mycorrhizal fungi and its application | |
CN105238723B (en) | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention crop verticillium wilt | |
CN101558766B (en) | Trichoderma solid granules for preventing and controlling tobacco soil-borne fungus diseases and preparation method thereof | |
CN102925387B (en) | Bacillus simplex for inducing soybean to generate soybean cyst nematode resistance and application | |
CN102703333A (en) | Mycorrhizal fungi strain efficiently growing with rhododendron seedling | |
CN103981101B (en) | A kind of DSE bacterial strain and the application in sugarcane production thereof | |
CN109749953B (en) | Bacillus cereus, microbial inoculum and preparation method and application thereof | |
CN117417840B (en) | Exotomycorrhizal fungi Yunnan sclerotium lappa ZSS01 and application thereof | |
Vohník et al. | Inoculation of Rhododendron cv. Belle-Heller with two strains of Phialocephala fortinii in two different substrates | |
CN103146609B (en) | Pseudomonas fluorescens and method for preventing phytophthora capsici thereby | |
CN110317747A (en) | A kind of bacillus amyloliquefaciens JT68 and its application in prevention and treatment tea anthracnose | |
CN102876580B (en) | Separation and application of Nectria fungi for promoting growth of Cymbidium wenshanense tissue culture plants | |
CN102399698B (en) | Separation and application of verticillium spp. fungus capable of promoting cymbidium wenshanense tissue cultured seedling growth | |
CN114507618B (en) | Oncomelania mycorrhizal fungus strain TP-11 with dendrobium new leaf growth promoting capability and application thereof | |
CN114395486B (en) | Adhesive film fungus strain TP-3 with high growth promoting capability of dendrobium and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141210 Termination date: 20161208 |