CN102864145A - Efficient inducible expression promoter and application - Google Patents

Efficient inducible expression promoter and application Download PDF

Info

Publication number
CN102864145A
CN102864145A CN2011101898422A CN201110189842A CN102864145A CN 102864145 A CN102864145 A CN 102864145A CN 2011101898422 A CN2011101898422 A CN 2011101898422A CN 201110189842 A CN201110189842 A CN 201110189842A CN 102864145 A CN102864145 A CN 102864145A
Authority
CN
China
Prior art keywords
sequence
gbp1
leaf
gus
pgbp1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN2011101898422A
Other languages
Chinese (zh)
Other versions
CN102864145B (en
Inventor
李文滨
王志新
赵琳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Northeast Agricultural University
Original Assignee
Northeast Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Northeast Agricultural University filed Critical Northeast Agricultural University
Priority to CN201110189842.2A priority Critical patent/CN102864145B/en
Publication of CN102864145A publication Critical patent/CN102864145A/en
Application granted granted Critical
Publication of CN102864145B publication Critical patent/CN102864145B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses an efficient inducible expression promoter and application. A deoxyribonucleic acid (DNA) segment (GBP1) comes from soybean (Glycine max (L.) Merrill.), and is any one of the DNA molecules of the following (1)-(5): (1) DNA molecules in sequence 1 in a sequence table; (2) nucleotide from the 8th to 1501st position at the tail end of 5' in the sequence 1 in the sequence table; (3) any one segment of DNA molecules containing nucleotide from the 1305th to 1501st position at the tail end of 5' in the sequence 1 in the sequence table; (4) DNA molecules which are hybridized with DNA sequences in the (1), (2) or (3) under the strict conditions and have promoter functions; and (5) DNA molecules which have more than 90% homology with the DNA sequences in the (1), (2) or (3) and have the promoter functions. The promoter has wide application prospects in agricultural production.

Description

A kind of efficient abduction delivering type promotor and application
Technical field
The present invention relates to biological technical field, relate in particular to a kind of efficient abduction delivering type promotor and application.
Background technology
Plant promoter is one section energy with RNA polymerase and transcription factor specific combination thereof, determines the dna sequence dna that genetic transcription is initial.Promotor is as a kind of important cis-acting elements of genetic expression, since the strain transgenic plant are come out from nineteen eighty-three first, be the study hotspot in the genetically engineered always, in gene expression regulation, play keying action, determine to a great extent the spatial and temporal expression characteristic of goal gene.Widespread use is constitutive promoter in the present plant genetic engineering, drive goal gene and organize at each of growth and development of plants period expression is all arranged, cause the waste of matter and energy, increase the plant metabolism burden, affect to a certain extent the growth of plant, even cause the change of phytomorph.
Therefore adopt specificity promoter to replace constitutive promoter, realization is to the anticipation regulation and control of genetic expression, thereby realize tissue and organ specificity, etap specificity, the specific accurate regulating and expressing of the inner hormone induction of outside atmosphere of gene, and attempt according to this as research cis-acting elements and the interactional method of trans-acting factor.
Soybean is the model plant of plant developmental biology and molecular biology research, and the finishing of soybean gene group examining order is the research of the soybean gene function condition of providing convenience, but at present very few about the work sutdy of the efficient abduction delivering isolation of promoter of soybean.Therefore, utilize the adverse circumstance inducible promoter to drive adversity gene becomes present research in the resistance of Crop Improvement focus.Yet, can be applied at present the inducible promoter of transgenic research still seldom.Therefore, for the interaction between the determining of new degeneration-resistant promoter related clone, the concrete sequence of cis-acting elements, each element, and the research of the transcription factor of doing mutually with these elements remains the emphasis of promotor research.
Summary of the invention
The purpose of this invention is to provide a kind of efficient abduction delivering type promotor and application.
Dna fragmentation provided by the invention derives from soybean (Glycine max (L.) Merrill.), is following 1)-8) in arbitrary described dna fragmentation:
1) dna molecular shown in the sequence 1 of sequence table; 2) sequence 1 of sequence table is from 5 ' terminal 8-1501 position Nucleotide; 3) sequence 1 457-1501 position Nucleotide from 5 ' end in the sequence table; 4) sequence 1 655-1489 position Nucleotide from 5 ' end in the sequence table; 5) sequence 1 768-1487 position Nucleotide from 5 ' end in the sequence table; 6) sequence 1 1305-1501 position Nucleotide from 5 ' end in the sequence table; 7) under stringent condition with 1)-6) and in arbitrary described dna sequence dna hybridization and have the dna fragmentation of promoter function; 8) with 1)-7) in arbitrary described dna sequence dna have 90% above homology, and have the dna fragmentation of promoter function.
Above-mentioned sequence 1 is comprised of 1512 Nucleotide.Above-mentioned stringent condition can be at 6 * SSC, in the solution of 0.5%SDS, 65 ℃ of lower hybridization, then uses 2 * SSC, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.
The recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium that contain above arbitrary described dna fragmentation all belong to protection scope of the present invention.Described recombinant vectors is the recombinant vectors that obtains between the HindIII of above-mentioned encoding gene insertion pBI 121 and Bam HI recognition site.
The primer of the above arbitrary described dna fragmentation of amplification is to also belonging to protection scope of the present invention.
Described primer is to for following arbitrary 1)-5) shown in primer pair: 1), a primer of described primer centering is the Nucleotide shown in the sequence 2, another primer is the Nucleotide shown in the sequence 3; 2): a primer of described primer centering is the Nucleotide shown in the sequence 4, and another primer is the Nucleotide shown in the sequence 5; 3): a primer of described primer centering is the Nucleotide shown in the sequence 6, and the sequence of another primer is the Nucleotide shown in the sequence 7; 4): a primer of described primer centering is the Nucleotide shown in the sequence 8, and another primer is the Nucleotide shown in the sequence 9; 5): a primer of described primer centering is the Nucleotide shown in the sequence 10, and another primer is the Nucleotide shown in the sequence 11.
Above-mentioned dna fragmentation is expressed goal gene in plant tissue application also is the scope of protection of the invention.In the above-mentioned application, described plant tissue is root, stem, leaf, flower or seed.In the above-mentioned application, described plant is monocotyledons or dicotyledons.In the above-mentioned application, described monocotyledons is tobacco, and described dicotyledons is Arabidopis thaliana.
Described expression is coerced by Illumination adjusting, hormone or high temperature stress is realized; Described hormone is preferably phytokinin, Plant hormones regulators,gibberellins, Whitfield's ointment or dormin; Described high temperature is 37 ℃ and/or 42 ℃.
The mode of described Illumination adjusting is following 1)-4) in any: 1) after cultivating 48 hours under 16h light/8h dark condition, continuous 48 hours photo-irradiation treatment; 2) after cultivating 48 hours under 16h light/8h dark condition, continuous 48 hours dark place reasons; 3) after cultivating 48 hours under 8h light/16h dark condition, continuous 48 hours photo-irradiation treatment; 4) after cultivating 48 hours under 8h light/16h dark condition, continuous 48 hours dark place reasons.
Of the present invention experimental results show that, with promotor GBP1 among the present invention after gus gene imports in tobacco or the Arabidopis thaliana, high temperature can promote the expression of promoter regulation gus gene in Plant hormones regulators,gibberellins, Whitfield's ointment, phytokinin processing and the certain limit: expressed by Induced by Salicylic Acid, show that this promotor works in the plant stress resistance; Be subjected to the phytokinin abduction delivering, show that this promotor works in cell fission propagation; Expressed by gibberellin inducement, show that this promotor works in the plant gibberellin inducement is bloomed approach; Expressed by high temperature induction, show that this promotor may participate in the Drought and heat resistance reaction.
With promotor of the present invention after gus gene imports Arabidopis thaliana, transgenosis seedling plant places the long day respectively (16h light/8h is dark), short day (8h light/16h is dark) is lower cultivates, find that this promotor is subjected to the short day abduction delivering, GUS expresses mean level (ML) and is about lower 2 times of long day.Research also find continuous light or continuously the dark place reason all broken the original daily rhythmicity of this promotor.
The GBP1 promotor that heat shock in this research is relevant imports in the plant; the plant of severe environment is resisted in cultivation, and (such as high temperature sweltering heat region) plantation improves crop yield under widely environment and condition; also can increase on desert, deserted mountain and other places greening, protection of the environment.In addition, utilize it to the effect of replying of exogenous hormone, the Crop Improvement kind, and then significantly improve the crop yield proterties, create higher economic worth.Because this promotor is subjected to Photoperiod simultaneously, short day is induced, long day suppresses, can be with the photoperiodic induction promotor in the introducing a fine variety of plant, breeding work, merge from different photoperiod effector and to import in the plant materials, by making a long driver moving goal gene control day, regulate the photoperiod sensitivity of plant, the flowering time of regulating plant, the planting range of change plant different latitude has very important meaning.Because this promotor is subjected to day long regulation and control, so can also merge with other goal gene, only need to change the expression amount that day long length is controlled goal gene, simple, convenient and easy.
Therefore, in transgenic breeding work, promotor of the present invention is replaced constitutive promoter, can realize the accurate regulation and control to destination gene expression, and then improve it to the adaptability of environment, in agriculture production, have broad application prospects.
Description of drawings
Fig. 1 is GBP1 gene promoter GBP1
Fig. 2 is the analysis of GBP1 gene promoter cis-acting elements
Fig. 3 is GBP1 gene promoter GBP1 and this promotor 5 ' end deletion fragment pBI121 plamid vector construction synoptic diagram
Fig. 4 is the pcr amplification synoptic diagram after GBP1 gene promoter GBP1 and this promotor 5 ' end deletion fragment transform Agrobacterium
Fig. 5 is that GBP1 gene promoter GBP1 T1 expresses synoptic diagram for the gus gene of transgene tobacco blade
Fig. 6 is Whitfield's ointment (SA), Plant hormones regulators,gibberellins (GA 3), phytokinin (6-BA), dormin (ABA) spray T1 for transgenic tobacco plant after GUS histochemical stain synoptic diagram in the root
Fig. 7 is Whitfield's ointment (SA), Plant hormones regulators,gibberellins (GA 3), phytokinin (6-BA), dormin (ABA) spray T1 for transgenic tobacco plant after GUS histochemical stain synoptic diagram in the stem
Fig. 8 is Whitfield's ointment (SA), Plant hormones regulators,gibberellins (GA 3), phytokinin (6-BA), dormin (ABA) sprays T1 for GUS histochemical stain synoptic diagram in the transgenic tobacco plant posterior lobe
Fig. 9 is for being Whitfield's ointment (SA), Plant hormones regulators,gibberellins (GA 3), phytokinin (6-BA), dormin (ABA) sprays T1 generation and turns the active synoptic diagram of GUS behind the tobacco plant
Figure 10 is that heat shock is processed rear T1 for the GUS histochemical stain synoptic diagram in the transgene tobacco blade
Figure 11 is that heat shock is processed rear T1 for the active synoptic diagram of the GUS in the transgene tobacco blade
Figure 12 is GBP1 gene promoter GBP1 T1 grows different times for transgenic arabidopsis GUS histochemical stain synoptic diagram
Figure 13 is the GUS histochemical stain synoptic diagram of GBP1 gene promoter GBP1 and 5 ' end deletion fragment transgenic arabidopsis growth after 6 days, 15 days
Figure 14 be Whitfield's ointment (SA) spray turn GBP1 promotor (A) and 5 ' end deletion fragment Arabidopis thaliana T1 for plant after the active synoptic diagram (B) of GUS
Figure 15 for spray for Plant hormones regulators,gibberellins (GA3) turn GBP1 promotor (A) and 5 ' end deletion fragment Arabidopis thaliana T1 for plant after GUS activity synoptic diagram (B)
Figure 16 be phytokinin (6-BA) spray turn GBP1 promotor (A) and 5 ' end deletion fragment Arabidopis thaliana T1 for plant after the active synoptic diagram (B) of GUS
Figure 17 is that the heat shock processing turns GBP1 promotor (A) and 5 ' end deletion fragment Arabidopis thaliana T1 for the active synoptic diagram (B) of plant GUS
Figure 18 turns GBP1 promotor Arabidopis thaliana T1 and expresses synoptic diagram (the empty frame of black represent the photophase, and black reality frame represents the dark phase, and light striped represents original dark phase and substituted by light) for lower gus gene of plant 96h photoperiod (behind the long day 48h continuously 48h illumination).
Figure 19 turns GBP1 promotor Arabidopis thaliana T1 and expresses synoptic diagram (the empty frame of black represent the photophase, and black reality frame represents the dark phase, and dark striped represents original photophase and secretly substituted) for lower gus gene of plant 96h photoperiod (behind the long day 48h continuously 48h dark)
Figure 20 turns GBP1 promotor Arabidopis thaliana T1 and expresses synoptic diagram (the empty frame of black represent the photophase, and black reality frame represents the dark phase, and light striped represents original dark phase and substituted by light) for lower gus gene of plant 96h photoperiod (behind the short day 48h continuously 48h illumination)
Figure 21 turns GBP1 promotor Arabidopis thaliana T1 and expresses synoptic diagram (the empty frame of black represent the photophase, and black reality frame represents the dark phase, and dark striped represents original photophase and secretly substituted) for lower gus gene of plant 96h photoperiod (behind the short day 48h continuously 48h dark)
Embodiment
Employed experimental technique is ordinary method if no special instructions among the following embodiment.
Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.
Dna fragmentation reclaims and adopts vast Imtech to reclaim test kit, and operates by its specification sheets.All inorganic chemical reagents and organic solvent are available from Solution on Chemical Reagents in Shanghai factory, and reagent is domestic analytical pure, and it is synthetic that primer is given birth to worker company by Shanghai, and Ependorf gradient type pcr amplification instrument is available from German Eppendorf company.
Vegetable material: soybean (Glycine max (L.) Merrill.) photaesthesia kind east farming 42 is documented in Chen Lijun, different sowing dates is to the soybean agricultural 42 Character of productivity and quality dynamic rule researchs in east, [J]. Soybean Science, 2008, (03). in, the public can obtain from Northeast Agricultural University.
Arabidopis thaliana (Arabidopsis thaliana) Columbia wild-type (Col-0, hereinafter to be referred as the wild-type Arabidopis thaliana) be documented in Sun Feng, Liu Peiqing, Dong Hansong. diel rhythm regulation and control Arabidopis thaliana riboflavin signal conduction [J]. the Jiangsu agricultural sciences, 2010 (2): the 17-20. public can obtain from Northeast Agricultural University.
Tobacco (Nicotiana tabacum) is documented in Legg, P.D., Collins, G.B., Litton, C.C., 1970.Registration of LA Burley 21 tobacco germplasm.Crop Sci.10, in 212., the public can obtain from Northeast Agricultural University.
The Agrobacterium LBA4404 bacterial strain is documented in the conversion of Agrobacterium tumefaciens mediated B.t. gene and CpTI gene pairs Cauliflower. and Mol.Biol. .2002,28 (3): among the 193-199, the public can obtain from Northeast Agricultural University.
PMD-18T vector is available from TAKARA company.
Carrier pBI 121 is documented in Chen P, Wang C, Soong S, To K.Complete sequence of the binary vector pBI 121 and its application in cloning T-DNA insertion from transgenic plants.Molecular Breeding.2003,11 (4): among the 287-293., the public can obtain from Northeast Agricultural University.
Restriction enzyme and T 4Dna ligases etc. are all available from TAKARA company.
Quantitative test in following examples all arranges repeated experiments three times, results averaged.
The clone of embodiment 1, promotor and vector construction
1, the extraction of plant genomic DNA:
Soybean (G1ycine max (L.) Merrill.) photaesthesia kind east farming 42 is incubated at 25 ℃ of illumination boxs, 250 μ molm -2Sec -1White light is grown under long day (LD) (16h light/8h the is dark) condition, and the 3rd ternately compound leaf of clip extracts soybean total DNA according to the CTAB method.
2, design of primers:
Sequence according to Phytozome soybean gene group library (www.phytozome.net) report, GBP1 gene start codon upstream sequence in location behind the Blast compare of analysis, use Primer Premier 5.0 designs 5 ' flanking sequence downstream primer, concrete primer sequence is as shown in table 1:
Table 1 primer sequence
The primer title Primer sequence (5 ' → 3 ')
pGBP1-F GCAAGCTT GAAAGCACATGGCATTATTAGAGG (sequence 2)
pGBP1-1F GCAAGCTT TTGCTGTGGTGTTAATTTTCTTTT (sequence 4)
pGBP1-2F GCAAGCTT GATATTGTAAGAAAGGGAGTTCATT (sequence 6)
pGBP1-3F GCAAGCTT CTTCTCATCAGATGGACATTTTAC (sequence 8)
pGBP1-4F GCAAGCTT CACTTATAAAAGGGCCAACACTACC (sequence 10)
pGBP1-1R GC GGA TCC GATTTTGCAGGAGGAAGAAGCT (sequence 5)
pGBP1-2R GC GGA TCC GGAAGAAGCTCTTTCAGAGTGG (sequence 7)
pGBP1-3R GC GGA TCC AAGAAGCTCTTTCAGAGTGGC (sequence 9)
pGBP1-4R GC GGA TCC GATTTTGCAGGAGGAAGAAGCT (sequence 11)
pGBP1-R GC GGA TCC GATTTTGCAGGAGGAAGAAGCT (sequence 3)
2, pcr amplification
Take soybean total DNA as template, carry out pcr amplification with primer pGBP1-F and pGBP1-R, obtain 1512bp PCR product;
Take soybean total DNA as template, carry out pcr amplification with primer pGBP1-1F and pGBP1-1R, obtain 1063bp PCR product;
Take soybean total DNA as template, carry out pcr amplification with primer pGBP1-2F and pGBP1-2R, obtain 851bp PCR product;
Take soybean total DNA as template, carry out pcr amplification with primer pGBP1-3F and pGBP1-3R, obtain 735bp PCR product;
Take soybean total DNA as template, carry out pcr amplification with primer pGBP1-4F and pGBP1-4R, obtain 215bp PCR product;
Above PCR condition is 94 ℃ of 5min, 94 ℃ of 30s, and 58 ℃ of 1min30s, 72 ℃ of 10min, 35 circulations, 1512bpPCR product result is as shown in Figure 1.Above-mentioned PCR product is all checked order, and the result is as follows: 1512bp PCR product have sequence 1 in the sequence table from 5 ' terminal 8-1501 position Nucleotide; The dna fragmentation called after GBP1 of this PCR product; 1063bp PCR product has sequence 1 457-1501 position Nucleotide from 5 ' end in the sequence table; The dna fragmentation called after GBP1-1 of this PCR product; The 851bpPCR product has sequence 1 655-1489 position Nucleotide from 5 ' end in the sequence table; The dna fragmentation called after GBP1-2 of this PCR product; 735bp PCR product has sequence 1 768-1487 position Nucleotide from 5 ' end in the sequence table; The dna fragmentation called after GBP1-3 of this PCR product; 215bp PCR product has sequence 1 1305-1501 position Nucleotide from 5 ' end in the sequence table; The dna fragmentation called after GBP1-4 of this PCR product.
5, the analysis of GBP1 promoter sequence:
Use the TSSP software analysis determine the GBP1 transcription initiation site ( Http:// linux1.softberry.com) be VITAMIN B4 (A), be positioned at the 126bp base place, initiator codon ATG upstream of gene, in this research with+1 of transcription initiation site place base location, and then determined promoter region be transcription initiation site upstream-1bp～-1336bp.Employing promoter prediction software Plant CARE ( Http:// bioinformatics.psb.ugent.be/webtools/plantcare/html/) the GBP1 sequence is carried out function prediction and analysis.Find that the GBP1 promotor also comprises a plurality of controlling elements except containing necessary initial transcription site, TATA-BOX, CAAT enhanser: 1) light response element: such as BOX-4, (5 ' ATTAAT 3 '), 6 copies; G-BOX, (5 ' CACATGG3 '), single copy; 2) Plant hormones regulators,gibberellins response element: P-BOX (5 ' GCCTTTTG3 '), single copy; 3) the single copy of Whitfield's ointment response element TCA (5 ' GAGAAGAATA3 '); 4) 3 copies of heat shock element: HSE (5 ' AAATTTC 3 '), and rhythm and pace of moving things clock Circadian (5 ' CAANNATC3 ') etc. (seeing Fig. 2).This promoter sequence is resolved into 4 different function sections, be sequence 1 457-1501 position Nucleotide (GBP1-1) from 5 ' end in the sequence table, sequence 1 655-1489 position Nucleotide (GBP1-2) from 5 ' end in the sequence table, sequence 1 768-1487 position Nucleotide (GBP1-3) from 5 ' end in the sequence table, sequence 1 1305-1501 position Nucleotide (GBP1-4) from 5 ' end in the sequence table.
6, promoter expression vector makes up:
Above-mentioned 1512bp PCR product is connected among the pMD-18T vector, obtain intermediate carrier pMD-18T-GBP1, again intermediate carrier pMD-18T-GBP1 is cut through HindIII and Bam HI enzyme, the small segment that obtains is connected with the pBI121 carrier large fragment (cutting 35S promoter) of cutting through same enzyme, obtains connecting product.Should connect product and transform the bacillus coli DH 5 alpha competent cell, carry out the kalamycin resistance screening, with the transformant that obtains in 37 ℃ of overnight incubation of shaking table, extract plasmid, sequence verification, this plasmid is for being inserted into the plasmid that obtains between the HindIII of pBI121 and Bam HI restriction enzyme site with sequence in the sequence table 1 from 5 ' terminal 8-1501 position Nucleotide, this plasmid is named pGBP1::GUS-nos (making up flow process as shown in Figure 3), contains the recombinant bacterium called after PBI121/pGBP1::GUS-nos of this plasmid.
Adopt and use the same method, 1063bp PCR product is connected on the pBI121 carrier, obtain recombinant vectors, through order-checking, the carrier that obtains between the recognition site of this recombinant vectors for the HindIII that sequence in the sequence table 1 457-1501 position Nucleotide from 5 ' end inserted the pBI121 carrier and Bam HI, called after pGBP1-1::GUS-nos; The recombinant bacterium called after pBI121/pGBP1-1::GUS-nos that contains this plasmid.
Adopt and use the same method, 851bp PCR product is connected on pBI 121 carriers, obtain recombinant vectors, through order-checking, the carrier that obtains between the recognition site of this recombinant vectors for the HindIII that sequence in the sequence table 1 655-1489 position Nucleotide from 5 ' end inserted the pBI121 carrier and Bam HI, called after pGBP1-2::GUS-nos; The recombinant bacterium called after pBI121/pGBP1-2::GUS-nos that contains this plasmid.
Adopt and use the same method, 735bp PCR product is connected on pBI 121 carriers, obtain recombinant vectors, through order-checking, the carrier that obtains between the recognition site of this recombinant vectors for the HindIII that sequence in the sequence table 1 768-1487 position Nucleotide from 5 ' end inserted the pBI121 carrier and Bam HI, called after pGBP1-3::GUS-nos; The recombinant bacterium called after pBI121/pGBP1-3::GUS-nos that contains this plasmid.
Adopt and use the same method, 215bp PCR product is connected on pBI 121 carriers, obtain recombinant vectors, through order-checking, the carrier that obtains between the recognition site of this recombinant vectors for the HindIII that sequence in the sequence table 1 1305-1501 position Nucleotide from 5 ' end inserted the pBI121 carrier and Bam HI, called after pGBP1-4::GUS-nos; The recombinant bacterium called after pBI121/pGBP1-4::GUS-nos that contains this plasmid.
7, preparation and the evaluation of restructuring Agrobacterium
Tri-parent conjugation method transforms agrobacterium tumefaciens, and method is as follows:
1) Agrobacterium LBA4404 is put into contained corresponding microbiotic (Streptomycin sulphate, the final concentration of described microbiotic in substratum is 50mg/L, Rifampin, the final concentration of described microbiotic in substratum is 25mg/L) the YEP liquid nutrient medium in 28 ℃ cultivated 1-2 days.With pRK2013 (Use of the plasmid pRK 2013 as a vehicle for transposition in Azotobacter vinelandii S.H.PHADNIS and H.K.DAS, J.Biosci., 1987,12 (2): 131-135, the public can obtain from Northeast Agricultural University.) put into 37 ℃ of incubated overnight in the LB liquid nutrient medium that contains kantlex (described microbiotic is 50mg/L at the final concentration of substratum).PBI121/pGBP1::GUS-nos is put into 37 ℃ of incubated overnight in the LB liquid nutrient medium that contains kantlex microbiotic (described microbiotic is 50mg/L at the final concentration of substratum).2) when three kinds of bacterium liquid reach the 0D value and are 0.6, respectively it is taken out from shaking table.Respectively get 1000 μ L and join in the centrifuge tube, the centrifugal 5min of 12000rpm abandons supernatant liquor.Adding respectively 1000 μ L, not contain accordingly antibiotic YEP liquid nutrient medium resuspended, and 12000rpm is centrifugal 5min again, abandons supernatant liquor.And then adding 1000 μ L, not contain accordingly antibiotic liquid nutrient medium resuspended.3) getting respectively three kinds of bacterium liquid, 100 μ L is mixed in the EP pipe.Gradient volume (10ul, 20ul, 30ul) will mix drop in not containing on the antibiotic LB solid medium 28 ℃ of incubated overnight.4) pick a small amount of bacterium colony with connecing collarium at the LB solid medium, mode with line is inoculated in and contains corresponding microbiotic (Streptomycin sulphate, the final concentration of described microbiotic in substratum is 50mg/L, Rifampin, the final concentration of described microbiotic in substratum is 25mg/L, kantlex, the final concentration of described microbiotic in substratum is 50mg/L) the LB solid medium on, cultivated 1-2 days for 28 ℃.5) the single bacterium colony of picking white is containing suitable antibiotic YEP liquid nutrient medium (Streptomycin sulphate, the final concentration of described microbiotic in substratum is 50mg/L, Rifampin, the final concentration of described microbiotic in substratum is 25mg/L, kantlex, the final concentration of described microbiotic in substratum is 50mg/L) in 28 ℃ of cultivations, PCR identifies positive colony.Primer is pGBP1-F and pGBP1-R, the result obtains the purpose fragment (Fig. 4 A) of 1512bp, the positive bacterial strain of this bacterium, this bacterial strain is extracted plasmid, send to order-checking, the result proves further that for this plasmid is pGBP1::GUS-nos this bacterial strain is positive, called after LBA4404/pGBP 1::GUS-no s.
Adopt aforesaid method respectively pGBP1-1::GUS-nos, pGBP1-2::GUS-nos, pGBP1-3::GUS-nos and pGBP1-4::GUS-nos all to be forwarded in the Agrobacterium, obtain respectively cloning 1, clone 2, clone 3, clone 4;
Adopt following method to identify, the result is shown in Fig. 4 B-4E, and B identifies for clone 1, C identifies that for clone 2 D identifies that for clone 3 E identifies for clone 4, the result is as follows: the primer that clone 1 PCR identifies is pGBP1-1F and pGBP1-1R, the result obtains the purpose fragment of 1063bp, and the positive bacterial strain of this bacterium extracts plasmid with this bacterial strain, send to order-checking, the result proves that further this bacterial strain is positive, called after LBA4404/pGBP1-1::GUS-nos for this plasmid is pGBP1-1::GUS-nos; The primer that clone 2 PCR identifies is pGBP1-2F and pGBP1-2R, the result obtains the purpose fragment of 851bp, the positive bacterial strain of this bacterium, this bacterial strain is extracted plasmid, send to order-checking, the result proves that further this bacterial strain is positive, called after LBA4404/pGBP1-2::GUS-nos for this plasmid is pGBP1-2::GUS-nos; The primer that clone 3 PCR identifies is pGBP1-3F and pGBP1-3R, the result obtains the purpose fragment of 735bp, the positive bacterial strain of this bacterium, this bacterial strain is extracted plasmid, send to order-checking, the result proves that further this bacterial strain is positive, called after LBA4404/pGBP1-3::GUS-nos for this plasmid is pGBP1-3::GUS-nos; The primer that clone 4 PCR identifies is pGBP1-4F and pGBP1-4R, the result obtains the purpose fragment of 215bp, the positive bacterial strain of this bacterium, this bacterial strain is extracted plasmid, send to order-checking, the result proves that further this bacterial strain is positive, called after LBA4404/pGBP1-4::GUS-nos for this plasmid is pGBP1-4::GUS-nos.
Embodiment 2, turn the acquisition of GBP1 tobacco and the Function Identification of GBP1
One, turns the acquisition of GBP1 tobacco
1, turns the acquisition of GBP1 tobacco
1) (Nicotiana tabacum is hereinafter to be referred as wild-type tobacco, to get the tobacco of young tender health.) blade, use distilled water flushing one time, 70% ethanol cleaned 45 seconds, volume fraction 10% aqueous sodium hypochlorite solution sterilization 6-8 minute, aseptic water washing 5 times, aseptic filter paper suck dry moisture.
2), aseptic blade is cut into the fritter of 0.5cm * 0.5cm, the blade adaxial and its surface is downward, (substratum is to add naphthylacetic acid NAA among the MS to be seeded in callus inducing medium, 6-benzyl purine 6-BA and agarose, the concentration of described NAA in substratum is 0.2mg/L, the concentration of 6-BA in substratum is 3.0mg/L, and agarose volume fraction in substratum is 0.8%.) on, preculture 2-3 days, obtain the leaf dish, as explant.
3), the single bacterium colony of picking LBA4404/pGBP1::GUS-nos, be inoculated into 20ml and be added with corresponding microbiotic (kantlex, the final concentration of described microbiotic in substratum is 50mg/L, Streptomycin sulphate, the final concentration of described microbiotic in substratum is 50mg/L, Rifampin, the final concentration of described microbiotic in substratum is 25mg/L.) the YEP liquid nutrient medium in, cultivating the OD value at 27 ℃ of constant-temperature tables is 0.6-0.8.Get above-mentioned culture in the ratio of 1%-2%, change in the fresh YEP liquid nutrient medium without antibiotic, continue to cultivate 6 hours, when the OD value is 0.2-0.5, can be used for transforming.
4), on Bechtop, bacterium liquid is poured in the aseptic 50ml centrifuge tube, 4000rpm 10min removes supernatant, the resuspended bacterium liquid of MS1 liquid nutrient medium is poured in the aseptic little culture dish, with pre-incubated explant, puts into bacterium liquid and soaks 8-10 minute.Take out explant and suck the bacterium liquid that adheres at aseptic filter paper, the leaf dish back side after blotting is upwards lain in the MS1 that is covered with one deck filter paper be total on the culture medium, 28 ℃ of dark cultivations 3 days.
5), will use successively aseptic washing 15 minutes through the explant of cultivating altogether, the aseptic washing of bacteriostatic agent cephamycin (final concentration of described microbiotic in substratum is 500mg/L) 15 minutes, MS2 flushing substratum was washed 20 minutes, wash the Agrobacterium of leaf panel surface off, frequently shake therebetween, make and fully contact solution in the leaf dish.
6) the medication spoon is pulled the leaf dish out, is put on the thieving paper, blots excessive moisture.
7) the leaf dish back side is downward, be placed on the MS3 bud and induce on the solid medium, make its growth and induce differentiation, the leaf plate edge gently is pressed in the substratum, and 25 ℃ (16h light/8h is dark) cultivated.
8) infect the leaf dish and constantly expand, grow green callus after about 10 days, downcut the leaf margins with bud after about two weeks, be inserted in the MS3 bud inducing culture, continue to cultivate, 2 all subcultures once induce indefinite bud behind twice of the subculture.
9) young shoot that leaf margin is grown cuts from base portion and leaf dish, eliminates Albino Seedling and lopsided seedling, selects the vigorous resistance seedling of form normal growth, and when treating that the long 2-3cm of arriving of indefinite bud is long, scalper downcuts, and is inserted into root induction in the MS4 root media.
10) grow adventive root about two weeks, namely move into after the domestication in the soil and hot-house culture, obtain 30 strain T0 generation and turn the GBP1 tobacco.
Above-mentioned used medium forms: MS0 is the MS minimum medium; MS1 is the resuspended altogether culture medium that reaches of bacterium: substratum is to add naphthylacetic acid NAA among the MS, 6-benzyl purine 6-BA, the fungistat cephamycin, Syringylethanone and agarose, the concentration of NAA in substratum is 0.2mg/L, and the concentration of 6-BA in substratum is 3.0mg/L, and the concentration of fungistat cephamycin in substratum is 500mg/L, the concentration of Syringylethanone in substratum is 100uM, and the volume fraction of agarose in substratum is 0.8%.)。MS2 is the flushing substratum: substratum is to add the fungistat cephamycin among the MS1, and the concentration of fungistat cephamycin in substratum is 500mg/L.MS3 is differentiation and screening culture medium: substratum is to add naphthylacetic acid NAA among the MS0,6-benzyl purine 6-BA, resistance screening agent kantlex kan, fungistat cephamycin cef and agarose, the concentration of NAA in substratum is 0.2mg/L, and the concentration of 6-BA in substratum is 1.0mg/L, and the concentration of kan in substratum is 100mg/L, the concentration of cef in substratum is 500mg/L, and the volume fraction of agarose in substratum is 0.8%.MS4 is root media: substratum is to add resistance screening agent kantlex and fungistat cephamycin among the 1/2MS.The concentration of kantlex in substratum is 80mg/L, and the concentration of fungistat cephamycin in substratum is 400mg/L.
T from above-mentioned acquisition 0In generation, turn GBP1 tobacco results seed, after planting obtains 25 strain T 1In generation, turn the GBP1 tobacco.
With the positive T of 20 strains obtained above 1In generation, turns the GBP1 tobacco and extracts genomic dna, and take pGBP1-F and pGBP1-R as primer, that obtain about 1512bp (order-checking is to contain sequence 1 from 5 ' terminal 8-1501 position Nucleotide) is positive T 1In generation, turn the GBP1 tobacco, obtains altogether the positive T of 20 strains 1In generation, turn the GBP1 tobacco.
Two, the functional verification of promotor GBP1
Respectively with 25 strain T 1In generation, turns the GBP1 tobacco leaf and puts into and fill X-gluc reaction solution (1M pH 7.0 sodium phosphate buffer 500ul, 0.033g/ml Tripotassium iron hexacyanide 100ul, 0.042g/ml yellow prussiate of potash 100ul, 0.5M PH 8.0 ethylenediamine tetraacetic acid (EDTA) 20ul, Triton X-10010ul and 2.5mg X-gluc, water-solublely obtain GUS histochemical stain reaction solution to 10ml) centrifuge tube in, vacuumize, 37 ℃ of dyeing 16h, then will organize and use 70% ethanol decolorization, observation is taken pictures.Take wild-type tobacco as contrast.
The result as shown in Figure 5, the visible promotor GBP1 of GUS histochemical stain makes goal gene GUS turn in the GBP1 tobacco leaf in T1 generation and expresses, screening obtains the positive T of 20 strains altogether 1In generation, turn the GBP1 tobacco.Express without GUS in the blade of wild-type tobacco.Above result shows: the GBP1 in the transgene tobacco can start GUS to express, and proves that this fragment is promotor.
Three, the functional verification of promotor GBP1 experiment 2
1, detection method
The extraction of A:GUS albumen: taking by weighing the positive T1 of 0.1g generation turns GBP1 Tissues of Tobacco (root, stem or blade), adds 400 μ L enzymes and carries damping fluid (adding water by 100ul beta-mercaptoethanol, 2ml 0.5M PH 8.0EDTA disodium, 100ul Triton X-100,0.1g sarcosyl and 50ml 1M pH 7.0 phosphoric acid buffers is settled to 100ml and is mixed to get).In ice bath, wear into homogenate.Get supernatant liquor behind 4 ℃, the centrifugal 10min of 12000rpm/min and obtain the thick enzyme solution of GUS.
B: determining the protein quantity: get 20 μ L steps 1) the thick enzyme solution of GUS that obtains adds H 2O to 4mL adds 1mL Xylene Brilliant Cyanine G solution again, mixing, 25 ℃ of lower 2min that place.Measure the 595nm absorbance value, according to typical curve calculation sample protein content.
C:GUS enzyme reaction: in the reaction buffer of 1mL37 ℃ of preheating, (add 50mg 4-methyl umbelliferone acyl-β-D-galactopyranoside in the 72mlGUS zyme extract (the same A of compound method), available from sigma company, catalog number L10287 is mixed to get reaction buffer, making the concentration of 4-MUG in reaction buffer is 2mmol/L), add again the thick enzyme solution of GUS that 100 μ L are obtained by A, mixing, in 37 ℃ of lower insulation 30min, then take out 100 μ L reaction solutions and join 900 μ L 0.2mol/L Na 2CO 3Termination reaction in the aqueous solution is with FL-2500 fluorescent spectrophotometer assay Ex365nm/Em455nm fluorescent value.The required enzyme amount that generates 1pmol 4-MU take 1min hydrolysis 4-MUG is as an enzyme activity unit, represents that with the enzyme activity of every milligram of albumen GUS is active.
2, detected result:
I, hormone Stress treatment:
Positive T1 generation of above-mentioned acquisition turned carry out the GUS histochemical stain the tender plant of GBP1 tobacco children is cultivated 4h respectively in nutrient solution 1,2,3 or 4 after, and be taken at positive T1 generation of cultivating respectively in the nutrient solution 1,2,3 or 4 behind the 4h and turn the tender plant of GBP1 tobacco children and carry out GUS enzyme activity spectrophotofluorometer and detect and analyze.To be incubated at 25 ℃ of illumination boxs, the positive T1 that processes without nutrient solution under long day (LD) (16h light/8h the is dark) condition is for turning the GBP1 tobacco children negative contrast of tender plant (CK).
Nutrient solution 1 (6-BA) is comprised of 1/2MS nutrient solution and phytokinin 6-BA, and the concentration of described 6-BA in described nutrient solution is 1mg/L.
Nutrient solution 2 (GA 3) by 1/2MS nutrient solution and Plant hormones regulators,gibberellins GA 3Form described GA 3Concentration in described nutrient solution is 2mM.
Nutrient solution 3 (SA) is comprised of 1/2MS nutrient solution and Whitfield's ointment SA, and the concentration of described SA in described nutrient solution is 2mM.
Nutrient solution 4 (ABA) is comprised of 1/2MS nutrient solution and dormin ABA, and the concentration of described ABA in described nutrient solution is 2mM.
Plant after the above-mentioned processing is divided into 5 groups:
6-BA: positive T1 processes through nutrient solution 1 for turning the GBP1 tobacco;
GA 3: positive T1 processes through nutrient solution 2 for turning the GBP1 tobacco;
SA: positive T1 processes through nutrient solution 3 for turning the GBP1 tobacco;
ABA: positive T1 processes through nutrient solution 4 for turning the GBP1 tobacco;
CK: positive T1 normally cultivates (CK) for turning the GBP1 tobacco.
Adopt respectively above-mentioned GUS histochemical staining method to dye in root, stem and the blade of 5 groups of plant, the result is shown in Fig. 6,7,8.
Adopt the A method to extract respectively 6-BA group, GA 3Root, stem and the blade gus protein of group, SA group, ABA group, CK group are measured respectively gus protein concentration (adopting the B method) and are carried out GUS enzyme reaction (adopting the C method),
The result is as follows: 6-BA group gus protein concentration is respectively 0.0012mg/g (root), 0.0012mg/g (stem), 0.0011mg/g (leaf); GA 3Group gus protein concentration is respectively 0.0010mg/g (root), 0.0011mg/g (stem), 0.0016mg/g (leaf); SA group gus protein concentration is respectively 0.0009mg/g (root), 0.0008mg/g (stem), 0.0017mg/g (leaf); ABA group gus protein concentration is respectively 0.0010mg/g (root), 0.0010mg/g (stem), 0.0009mg/g (leaf); CK group gus protein concentration is respectively 0.0011mg/g (root), 0.0010mg/g (stem), 0.0010mg/g (leaf).
6-BA group GUS enzyme specific activity is respectively 9897.6374-MUG pmol/min/mg albumen (root), 24726.934-MUGpmol/min/mg albumen (stem), 16926.314-MUG pmol/min/mg albumen (leaf); GA 3Group GUS enzyme specific activity is respectively 10224.584-MUG pmol/min/mg albumen (root), 13469.644-MUG pmol/min/mg albumen (stem), 3807.3354-MUG pmol/min/mg albumen (leaf); SA group GUS enzyme specific activity is respectively 8731.3254-MUG pmol/min/mg albumen (root), 10738.244-MUG pmol/min/mg albumen (stem), 5060.4534-MUG pmol/min/mg albumen (leaf); ABA group GUS enzyme specific activity is respectively 8181.3934-MUG pmol/min/mg albumen (root), 10408.524-MUG pmol/min/mg albumen (stem), 4211.8734-MUG pmol/min/mg albumen (leaf).CK group GUS enzyme specific activity is respectively 8068.6054-MUG pmol/min/mg albumen (root), 10877.434-MUG pmol/min/mg albumen (stem), 4451.0964-MUG pmol/min/mg albumen (leaf);
The enzyme slip-knot is really made Fig. 9, can find out in conjunction with Fig. 6-8, compared with the control, the phytokinin of 1mg/L (6-BA) is very strong for the inductive effect that turns the GBP1 tobacco to T1, and mainly concentrates in blade and the stem.Be about 3.8 times of contrast in the GUS enzyme blades, be about 2.3 times of contrast in the stem, root is without obvious increase; Plant hormones regulators,gibberellins (GA 3) promote root, the GUS of stem to express; Whitfield's ointment (SA) promotes that GUS expresses in root, the blade, yet increasing degree obviously reduces than 6-BA; Dormin (ABA) has no obvious impact to the GUS expression amount.Above hormone induction is expressed experiment and is shown that promotor GBP1 mainly participates in the phytokinin approach.
II, high temperature heat-inducible
The positive T1 of above-mentioned acquisition is placed illumination box for turning GBP1 tobacco (being grown in the MS solid medium), respectively at 37 ℃, 42 ℃ lower processing, carry out GUS histochemical stain and GUS enzyme activity spectrophotofluorometer behind the 20min and detect to analyze, turn the GBP1 tobacco seedling as negative control CK with the positive T1 generation without thermal treatment (25 ℃).
Plant after the above-mentioned processing is divided into 6 groups:
37 ℃: process positive T1 for turning the GBP1 tobacco for 37 ℃;
42 ℃: process positive T1 for turning the GBP1 tobacco for 42 ℃;
Process positive T1 for turning the GBP1 tobacco for CK:25 ℃;
Adopt respectively above-mentioned GUS histochemical staining method to dye in the blade of 3 groups of plant, the result as shown in figure 10.
The blade of 3 groups of plant is extracted respectively gus protein (adopting above-mentioned A method), measure respectively protein concentration (adopting above-mentioned B method) and carry out GUS enzyme reaction (adopting above-mentioned C method), the result is as follows:
37 ℃ of group gus protein concentration are 0.0009mg/g (leaf); 42 ℃ of group gus protein concentration are 0.0014mg/g (leaf); CK group gus protein concentration is 0.0008mg/g (leaf);
37 ℃ of group GUS enzyme specific activity are 9270.8254-MUG pmol/min/mg albumen (leaf); 42 ℃ of group GUS enzyme specific activity are 12775.814-MUG pmol/min/mg albumen (leaf); CK group GUS enzyme specific activity is 4593.5214-MUG pmol/min/mg albumen (leaf);
The GUS enzyme reaction as shown in figure 11, the result shows: compared with the control, when T1 generation turns the GBP1 tobacco work of GUS enzyme is about contrast (25 ℃) after 37 ℃ are processed 20min 2.0 times; The GUS expression amount is significantly increased after 42 ℃, is about 2.8 times of contrast.Infer that the GBP1 promotor may participate in the Drought and heat resistance defensive raction, this motif ATTTGGG with the concrete heat that the promoter Analysis sequence shows is consistent.
Embodiment 3, the acquisition that turns the GBP1 Arabidopis thaliana and Function Identification
One, the acquisition of transgenic arabidopsis
1, the preparation of acceptor Arabidopis thaliana
With Arabidopis thaliana (Arabidopsis thaliana) Columbia (col-0, wild-type (wild-type Arabidopis thaliana) seed with distilled water immersion after, 4 ℃ after vernalization 2-4 days, broadcast sowing the Nutrition Soil in 1: 1: in the vermiculite, (temperature is 22 ℃ ± 2 ℃, and intensity of illumination is 0.3-0.4mmolm in culturing room's cultivation -2S -1), the light of growth/dark cycle is 16h/8h, relative humidity is about 80%.)。When plant strain growth during to the high about 3cm of stem, remove its terminal inflorescence, with the growth of stimulation axillary inflorescence.When treating that axillary inflorescence grows, its underpart spend existing a small amount of fruit pod to occur the time transform.Before the conversion, the fruit pod that has grown is removed.
2, bacterium solution preparation and penetration operation
Picking Agrobacterium pBI121/pGBP1::GUS-nos, pBI121/pGBP1-1::GUS-nos, pBI121/pGBP1-2::GUS-nos, pBI121/pGBP1-3::GUS-nos and pBI121/pGBP1-4::GUS-nos mono-clonal are put in the YEP nutrient solution that 5ml contains Streptomycin sulphate (final concentration of described microbiotic in substratum is 50mg/L), Rifampin (final concentration of described microbiotic in substratum is 25mg/L), kantlex (final concentration of described microbiotic in substratum is 50mg/L) respectively, 28 ℃, the 220rpm concussion is cultured to OD 600Be about 0.5.Transforming the day before yesterday, change over to 50ml same contain overnight incubation (12h) in the antibiotic YEP nutrient solution, second day is as bacterium liquid OD 600When 1.6-2.0, take out and use.25 ℃, the centrifugal 5min of 10000rpm abandons supernatant liquor, and precipitation is suspended in the 1/2MS infiltration nutrient solution (the adding massfraction is 5% sucrose in the 1/2MS nutrient solution, and volume fraction is 0.02% tensio-active agent silwet-17).Resuspended liquid is poured in the little porcelain dish, the earthen bowl of cultivating Arabidopis thaliana is laid across on the porcelain dish limit, plant is immersed in the suspension, must guarantee to be partially submerged in the liquid more than the lotus throne leaf, soaks 30s.Take out plant, be disposed across on the plastic film, in the above keeping humidity, and on preservative film, cover again one deck tinfoil lucifuge with preservative film cover.Being placed on thermostatic chamber (24 ℃) cultivates.Second day is opened paper and preservative film, vertically cultivates.Behind the 4-5d, contaminate one to secondary according to the growing state continuation of Arabidopis thaliana.Cultivation 3-4 is all, obtains 30 strain T0 for turning GBP1 Arabidopis thaliana, 30 strain T0 for turning GBP1-1 Arabidopis thaliana, 30 strain T0 for turning GBP1-2 Arabidopis thaliana, 30 strain T0 for turning GBP1-3 Arabidopis thaliana and 30 strain T0 for turning the GBP1-4 Arabidopis thaliana.
Respectively above-mentioned plant being carried out PCR identifies: extract T0 for turning the DNA of GBP1 Arabidopsis leaf as template, primer is pGBP1-F and pGBP1-R, obtains the positive T0 of about 1512bp (order-checking is for containing sequence 1 from 5 ' terminal 8-1501 position Nucleotide) for turning the GBP1 Arabidopis thaliana; Obtain the positive T0 of 27 strains for turning the GBP1 Arabidopis thaliana;
As template, primer is pGBP1-1F and pGBP1-1R to extraction T0 for the DNA that turns the GBP1-1 Arabidopsis leaf, obtains the positive T0 of about 1063bp (order-checking is for containing sequence 1 from 5 ' terminal 457-1501 position Nucleotide) for turning the GBP1-1 Arabidopis thaliana; Obtain the positive T0 of 25 strains for turning the GBP1-1 Arabidopis thaliana;
As template, primer is pGBP1-2F and pGBP1-2R to extraction T0 for the DNA that turns the GBP1-2 Arabidopsis leaf, obtains the positive T0 of about 851bp (order-checking is for containing sequence 1 from 5 ' terminal 655-1489 position Nucleotide) for turning the GBP1-2 Arabidopis thaliana; Obtain the positive T0 of 27 strains for turning the GBP1-2 Arabidopis thaliana;
As template, primer is pGBP1-3F and pGBP1-3R to extraction T0 for the DNA that turns the GBP1-3 Arabidopsis leaf, obtains the positive T0 of about 735bp (order-checking is for containing sequence 1 from 5 ' terminal 768-1487 position Nucleotide) for turning the GBP1-3 Arabidopis thaliana; Obtain the positive T0 of 25 strains for turning the GBP1-3 Arabidopis thaliana;
As template, primer is pGBP1-4F and pGBP1-4R to extraction T0 for the DNA that turns the GBP1-4 Arabidopsis leaf, obtains the positive T0 of about 215bp (order-checking is for containing sequence 1 from 5 ' terminal 1305-1501 position Nucleotide) for turning the GBP1-4 Arabidopis thaliana; Obtain the positive T0 of 28 strains for turning the GBP1-4 Arabidopis thaliana;
After above positive T0 is for seed maturity, collect respectively seed and namely be respectively T1 for turning GBP1 Arabidopis thaliana seed, T1 for turning GBP1-1 Arabidopis thaliana seed, T1 for turning GBP1-2 Arabidopis thaliana seed, T1 for turning GBP1-3 Arabidopis thaliana seed, T1 for the seed that turns the GBP1-4 Arabidopis thaliana, will deposit in these seed driers.
Two, the functional verification of promotor
1) method: A, B, C in the extraction of gus protein, determining the protein quantity, the GUS enzyme reaction method reference example 2.
2) experiment:
Choose respectively positive T1 for turning GBP1 Arabidopis thaliana seed, positive T1 is for turning GBP1-1 Arabidopis thaliana seed, positive T1 is for turning GBP1-2 Arabidopis thaliana seed, positive T1 is for turning GBP1-3 Arabidopis thaliana seed, positive T1 is an amount of for the seed that turns the GBP1-4 Arabidopis thaliana, be respectively charged into and add an amount of sterilized water in the 1.5mL centrifuge tube of sterilization, 4 ℃ vernalization 2-4 days, alcohol flushing 30s with 75%, after aseptic washing 2-3 time, be 10% clorox (NaClO) flushing 8-10min with volume fraction again, constantly vibration, suck supernatant, then add rapidly sterilized water Eddy diffusion seed, so repeat 3-5 time, with the thimerosal on the flush away seed; Again use a small amount of sterilized water suspension seed, pick up seed suspension, as far as possible uniformly it is taped against (containing the final concentration of the described microbiotic of kantlex in substratum is 50mg/L) on the 1/2MS solid culture substrate, substratum to be dried, after film (Parafilm) sealing, illumination cultivation, 250 μ mol m -2Sec -1White light, the long day (LD) (16h light/8h is dark).
I, GUS histochemical stain:
1, GBP1 promotor
For turning the GBP1 Seed Germination of Arabidopsis Pumila, culture condition is 250 μ mol m with positive T1 -2Sec -1White light, the long day (LD) (16h light/8h is dark).0, the rear plant different sites that gathers respectively that bore pods in 2,4,6,10,15 days and 30 days carries out the GUS histochemical stain (see Figure 12, A-F represents that respectively transgenic seed sprouts the expression of gus gene in 0 day, 2 days, 4 days, 6 days, 10 days, 15 days big or small seedling; The expression of gus gene in the transfer-gen plant stem leaf that G-K represents to grow 30 days, root, the terminal inflorescence; L-Q represents the expression of transgenic arabidopsis seed maturity process mesosperm gus gene; R-T represents in the seed maturity process GUS expression in the exocarp.), take the wild-type Arabidopis thaliana as contrast.
The result shows: the GBP1 Arabidopis thaliana is whole to grow period for turning at T1, the GBP1 promotor all can drive gus gene and express, higher (Figure 12 A of expression amount in the seed and seedling hypocotyl that sprouts, B), follow the further growth of transgenic arabidopsis seedling, the GUS expression amount weakens (Figure 12 C-F) gradually, the transfer-gen plant of 30 days sizes, and gus gene then is predominant expression (Figure 12 G, H) in stem leaf arteries and veins, the root; Petal in the terminal inflorescence, filigree, express at flower pesticide and column cap position all high-visible GUS, and upper blade GUS expresses and weakens (Figure 12 I-K); In the process of Seed Development, plant the skin zone position and detect the GUS expression, along with seed is further ripe, GUS expresses diminuendo (Figure 12 L-T) in the fruit pod.Withered to pericarp, the seed fully matured, staining agent can't enter organization internal, fails to provide reference frame.Above result shows: the GBP1 in the transgenic arabidopsis can start GUS to express, and proves that this fragment is promotor.The wild-type Arabidopis thaliana is expressed without GUS.
2, GBP1 promotor and this promotor 5 ' end deletion fragment promotor
T1 is for turning GBP1 Arabidopis thaliana seed, T1 is for turning GBP1-1 Arabidopis thaliana seed, T1 is for turning GBP1-2 Arabidopis thaliana seed, T1 is for turning GBP1-3 Arabidopis thaliana seed, T1 is seeded on the MS solid medium that contains kantlex (the final concentration 50mg/L of described microbiotic in substratum) after turning GBP1-4 Arabidopis thaliana seed disinfection sterilization, treat each transgenic seed sprouting 6 days, gathering whole strain after 15 days carries out the GUS histochemical stain and (sees Figure 13, a-e is for changing GBP1 promotor full length sequence GBP1 and each deletion fragment GBP1-1 over to, GBP1-2, GBP1-3, Arabidopsis thaliana Seedlings growth GUS histochemical stain after 6 days of GBP1-4, A-E is for changing promotor full length sequence GBP1 and each deletion fragment GBP1-1 over to, GBP1-2, GBP1-2, Arabidopsis thaliana Seedlings growth GUS histochemical stain after 15 days of GBP1-4.)。Take the wild-type Arabidopis thaliana as contrast.
The result shows: grow after 6 days, T1 is for turning GBP1 Arabidopis thaliana cotyledon, the hypocotyl place all has GUS to express, lacking to the T1 of 1063bp (namely containing sequence 1 457-1501 position Nucleotide from 5 ' end in the sequence table) generation turns in two cotyledons of GBP1-1 Arabidopis thaliana and the GUS at hypocotyl place expresses obviously and strengthens, lack to the T1 of 851bp (namely containing sequence 1 655-1489 position Nucleotide from 5 ' end in the sequence table) generation and turn the GBP1-2 Arabidopis thaliana, the GUS expression weakens to some extent but slightly is better than 1512bp, lack and turn in the GBP1-3 Arabidopis thaliana GUS to the T1 of 735bp (namely containing sequence 1 768-1487 position Nucleotide from 5 ' end in the sequence table) generation and express and obviously weaken, in the T1 of (containing sequence 1 1305-1501 position Nucleotide from 5 ' end in the sequence table) generation, turns the cotyledon of GBP1-4 Arabidopis thaliana and hypocotyl and is connected with radicle a little and locates during to the shortest deletion fragment 215bp, GUS expresses to strengthen and be better than and lacks to 735bp, a little less than the GUS of hypocotyl place expresses.After growing to 15 days, T1 has faint GUS to express for the newborn blade that turns the GBP1 Arabidopis thaliana and root; It is slightly strong that lotus throne leaf GUS expresses, during with 6 days dyeing similar, contain the Arabidopis thaliana that length is 1063bp promoter deletion fragment, lotus throne leaf and hypocotyl part GUS expression amount are maximum, be 215bp secondly, and among 851bp and the 735bp GUS expression all a little less than.
Analyzed as seen by above histochemical stain, the 215bp promoter fragment namely contains in the sequence table sequence 1 1305-1501 position Nucleotide (T1 generation turn the GBP1-4 Arabidopis thaliana) from 5 ' end and can drive gus reporter gene and express in this experiment, and has certain expression level, infer that may there be enhancer element in this section, may there be negative regulatory element at the 215bp-735bp place, and may has the positive controlling element that strengthens promoter expression at the 851bp-1063bp place.Not yet can clearly be which kind of element is playing regulating and controlling effect at present actually, remain further to be verified.The wild-type Arabidopis thaliana is expressed without GUS.Above result shows: the GBP1 in the transgenic arabidopsis, GBP1-1, GBP1-2, GBP1-3, GBP1-4 all can start GUS to express, and proves that these fragments are promotor.
II, hormone Stress treatment:
In view of example 1 promoter element analytical results, GBP1 promotor inside is without the dormin response element; Histochemical stain shows transgene tobacco also to the dormin nonreply in the example 2, abandons the dormin treatment group in the experiment so coerce at the transgenic arabidopsis hormone, selects following 3 kinds of hormones to carry out the GUS enzyme activity and detects and analyze.Detection method is identical with embodiment 2.
1, Whitfield's ointment (SA) is induced the impact on promotor in the transfer-gen plant
(temperature is 22 ℃ ± 2 ℃ to Figure 14 A experimental group (SA): T1, and intensity of illumination is 0.3-0.4mmolm under normal operation for turning GBP1 Arabidopis thaliana seed -2S -1), the light of growth/dark cycle is 16h/8h, relative humidity is about 80%.) cultivated 16 days, (be comprised of 1/2MS nutrient solution and SA, the concentration of described SA in described nutrient solution is 2mM with the nutrient solution that contains 2mM Whitfield's ointment (SA).) spray plant leaf, get blade at processing 0.5 (30min), 1,2,4,6,8,12,24,48h respectively and detect the GUS activity.
The control group of Figure 14 A (CK): basic identical with the method for experimental group, different is that T1 sprays not salicylated 1/2MS nutrient solution for turning GBP1 Arabidopis thaliana seed.
The result of protein concentration is as follows: 14A experimental group gus protein concentration: 0.5h is 0.0021mg/g (leaf); 1h is 0.0021mg/g (leaf); 2h is 0.0022mg/g (leaf); 4h is 0.0021mg/g (leaf); 6h is 0.0021mg/g (leaf); 8h is 0.0020mg/g (leaf); 12h is 0.0021mg/g (leaf); 24h is 0.0021mg/g (leaf); 48h is 0.0019mg/g (leaf); 14A control group gus protein concentration: ck is 0.0021mg/g (leaf)
14A experimental group GUS enzyme specific activity: 0.5h is 6085.4614-MUG pmol/min/mg albumen (leaf); 1h is 4371.634-MUG pmol/min/mg albumen (leaf); 2h is 4527.7144-MUG pmol/min/mg albumen (leaf); 4h is 7702.8124-MUG pmol/min/mg albumen (leaf); 6h is 3024.5564-MUG pmol/min/mg albumen (leaf); 8h is 4374.5224-MUG pmol/min/mg albumen (leaf); 12 is 3989.5924-MUG pmol/min/mg albumen (leaf); 24h is 3645.344-MUG pmol/min/mg albumen (leaf); 48h is 2754.1284-MUG pmol/min/mg albumen (leaf); 14A control group GUS enzyme specific activity: ck is 1620.664-MUG pmol/min/mg albumen (leaf).
The result shows, Whitfield's ointment can induce GUS to express, and the GUS activity of promoter regulation improves with the prolongation of the time of processing, reaches maximum value at 4h, and the GUS activity is 4.7 times before processing, and then begins to descend.Accordingly can be tentatively definite, Whitfield's ointment is the inductor of GBP1 gene promoter.
(temperature is 22 ℃ ± 2 ℃ to the experimental group of Figure 14 B (SA): T1, and intensity of illumination is 0.3-0.4mmolm under normal operation respectively for the Arabidopis thaliana seed that changes GBP1 promoter deletion fragment over to for turning GBP1 Arabidopis thaliana and T1 -2S -1, the light of growth/dark cycle is 16h/8h, relative humidity is about 80%.) cultivated 16 days, spray plant leaf with the nutrient solution (be comprised of 1/2MS nutrient solution and SA, the concentration of described SA in described nutrient solution is 2mM) that contains 2mM Whitfield's ointment (SA), process 4h, get blade and detect the GUS activity.T1 is respectively T1 for turning GBP1-1 Arabidopis thaliana, T1 for turning GBP1-2 Arabidopis thaliana, T1 for turning GBP1-3 Arabidopis thaliana, T1 for turning the GBP1-4 Arabidopis thaliana for the Arabidopis thaliana that changes GBP1 promoter deletion fragment over to.
The control group of Figure 14 B (CK): spray not salicylated 1/2MS nutrient solution such as the transgenic arabidopsis under the above-mentioned cultivation, obtain T1 for turning GBP1 Arabidopis thaliana control group, T1 for turning GBP1-1 Arabidopis thaliana control group, T1 for turning GBP1-2 Arabidopis thaliana control group, T1 for turning GBP1-3 Arabidopis thaliana control group, T1 for turning GBP1-4 Arabidopis thaliana control group.
14B experimental group gus protein concentration: T1 is 0.002078mg/g (leaf) for turning the GBP1 Arabidopis thaliana; T1 is 0.001692mg/g (leaf) for turning the GBP1-1 Arabidopis thaliana; T1 is 0.001732mg/g (leaf) for turning the GBP1-2 Arabidopis thaliana; T1 is 0.001712mg/g (leaf) for turning the GBP1-3 Arabidopis thaliana; T1 is 0.00174mg/g (leaf) for turning the GBP1-4 Arabidopis thaliana;
14B control group gus protein concentration: T1 is 0.002112mg/g (leaf) for turning GBP1 Arabidopis thaliana control group; T1 is 0.001724mg/g (leaf) for turning GBP1-1 Arabidopis thaliana control group; T1 is 0.001709mg/g (leaf) for turning GBP1-2 Arabidopis thaliana control group; T1 is 0.001762mg/g (leaf) for turning GBP1-3 Arabidopis thaliana control group; T1 is 0.002086mg/g (leaf) for turning GBP1-4 Arabidopis thaliana control group.
14B experimental group GUS enzyme specific activity:
T1 is 7702.8124-MUG pmol/min/mg albumen (leaf) for turning GBP1 Arabidopis thaliana (pGBP1); T1 is 9064.4634-MUG pmol/min/mg albumen (leaf) for turning GBP1-1 Arabidopis thaliana (pGBP1-1); T1 is 7088.3054-MUG pmol/min/mg albumen (leaf) for turning GBP1-2 Arabidopis thaliana (pGBP1-2); T1 is 2334.5344-MUG pmol/min/mg albumen (leaf) for turning GBP1-3 Arabidopis thaliana (pGBP1-3); T1 is 1302.9064-MUGpmol/min/mg albumen (leaf) for turning GBP1-4 Arabidopis thaliana (pGBP1-4);
14B control group GUS enzyme specific activity:
T1 is 1205.2584-MUG pmol/min/mg albumen (leaf) for turning GBP1 Arabidopis thaliana control group ((ck) pGBP1);
T1 is 1456.5994-MUG pmol/min/mg albumen (leaf) for turning GBP1-1 Arabidopis thaliana control group ((ck) pGBP1-1);
T1 is 1176.2844-MUG pmol/min/mg albumen (leaf) for turning GBP1-2 Arabidopis thaliana control group ((ck) pGBP1-2);
T1 is 809.33884-MUG pmol/min/mg albumen (leaf) for turning GBP1-3 Arabidopis thaliana control group ((ck) pGBP1-3);
T1 is 281.5494-MUG pmol/min/mg albumen (leaf) for turning GBP1-4 Arabidopis thaliana control group ((ck) pGBP1-4);
The result shows that Whitfield's ointment can significantly be induced GBP1-1::GUS-nos, GBP1-2::GUS-nos, and the promoter activity among the GBP1-3::GUS-nos, after this element disappearance, promoter fragment is replied a little less than effect embodies salicylic.Accordingly can be tentatively definite, salicylic response original paper is between-590-490bp, and this response original paper GGAACTAGC with promoter Analysis is consistent.
2, Plant hormones regulators,gibberellins (GA 3) induce the impact on promotor in the transfer-gen plant
Experimental group (the GA of Figure 15 A 3): (temperature is 22 ℃ ± 2 ℃ to T1, and intensity of illumination is 0.3-0.4mmolm under normal operation for turning GBP1 Arabidopis thaliana (pGBP1) seed -2S -1, the light of growth/dark cycle is 16h/8h, relative humidity is about 80%.) cultivated 16 days, with containing the Plant hormones regulators,gibberellins nutrient solution of 2mM (by 1/2MS nutrient solution and GA 3Form described GA 3Concentration in described nutrient solution is 2mM.) spray plant leaf, get blade at processing 0.5,1,2,4,6,8,12,24,48h respectively and detect the GUS activity.The control group of Figure 15 A (CK): spray the 1/2MS nutrient solution (CK) that does not contain Plant hormones regulators,gibberellins such as the transgenic arabidopsis under the above-mentioned cultivation.
15A experimental group gus protein concentration: 0.5h is 0.002051mg/g (leaf); 1h is 0.002063mg/g (leaf); 2h is 0.002052mg/g (leaf); 4h is 0.002058mg/g (leaf); 6h is 0.002043mg/g (leaf); 8h is 0.002097mg/g (leaf); 12h is 0.002102mg/g (leaf); 24h is 0.002147mg/g (leaf); 48h is 0.001828mg/g (leaf); 15A control group gus protein concentration: ck is 0.0021mg/g (leaf)
15A experimental group GUS enzyme specific activity: 0.5h is 4230.1474-MUG pmol/min/mg albumen (leaf); 1h is 4768.014-MUG pmol/min/mg albumen (leaf); 2h is 2524.9324-MUG pmol/min/mg albumen (leaf); 4h is 7976.394-MUG pmol/min/mg albumen (leaf); 6h is 5600.5924-MUG pmol/min/mg albumen (leaf); 8h is 3221.7494-MUG pmol/min/mg albumen (leaf); 12 is 2638.3784-MUG pmol/min/mg albumen (leaf); 24h is 3328.7754-MUG pmol/min/mg albumen (leaf); 48h is 2468.134-MUG pmol/min/mg albumen (leaf); 15A control group GUS enzyme specific activity: ck is 1620.664-MUG pmol/min/mg albumen (leaf).
The result shows, Plant hormones regulators,gibberellins can induce GUS to express, and active prolongation with the time of processing improves, and reaches maximum value at 4h, and the GUS activity is 4.9 times before processing, and then reduces gradually.Accordingly can be tentatively definite, Plant hormones regulators,gibberellins is the inductor of GBP1 gene promoter.
Experimental group (the GA of Figure 15 B 3): (temperature is 22 ℃ ± 2 ℃ to T1, and intensity of illumination is 0.3-0.4mmolm under normal operation for the Arabidopis thaliana seed that changes GBP1 promoter deletion fragment over to for turning GBP1 Arabidopis thaliana (pGBP1) and T1 -2S -1, the light of growth/dark cycle is 16h/8h, relative humidity is about 80%.) cultivated 16 days, with containing the Plant hormones regulators,gibberellins nutrient solution of 2mM (by 1/2MS nutrient solution and GA 3Form described GA 3Concentration in described nutrient solution is 2mM.) spray plant leaf, process 4h, get blade and detect the GUS activity.T1 is respectively T1 for turning GBP1-1 Arabidopis thaliana (pGBP1-1), T1 for turning GBP1-2 Arabidopis thaliana (pGBP1-2), T1 for turning GBP1-3 Arabidopis thaliana (pGBP1-3), T1 for turning GBP1-4 Arabidopis thaliana (pGBP1-4) for the Arabidopis thaliana that changes GBP1 promoter deletion fragment over to.
The control group of Figure 15 B (CK): spray the 1/2MS nutrient solution that does not contain Plant hormones regulators,gibberellins such as the transgenic arabidopsis under the above-mentioned cultivation, obtain T1 for turning GBP1 Arabidopis thaliana control group (ck-pGBP1), T1 for turning GBP1-1 Arabidopis thaliana control group (ck-pGBP1-1), T1 for turning GBP1-2 Arabidopis thaliana control group (ck-pGBP1-2), T1 for turning GBP1-3 Arabidopis thaliana control group (ck-pGBP1-3), T1 for turning GBP1-4 Arabidopis thaliana control group (ck-pGBP1-4).
15B experimental group gus protein concentration: pGBP1 is 0.002058mg/g (leaf); PGBP1-1 is 0.001709mg/g (leaf); PGBP1-2 is 0.001743mg/g (leaf); PGBP1-3 is 0.001821mg/g (leaf); PGBP1-4 is 0.001714mg/g (leaf) 15B control group gus protein concentration: ck-pGBP1 is 0.002112mg/g (leaf); Ck-pGBP1-1 is 0.001724mg/g (leaf); Ck-pGBP1-2 is 0.001709mg/g (leaf); Ck-pGBP1-3 is 0.001762mg/g (leaf); Ck-pGBP1-4 is 0.002086mg/g (leaf)
15B experimental group GUS enzyme specific activity: pGBP1 is 7976.394-MUG pmol/min/mg albumen (leaf); PGBP1-1 is 3962.7944-MUG pmol/min/mg albumen (leaf); PGBP1-2 is 2482.6194-MUG pmol/min/mg albumen (leaf); PGBP1-3 is 1839.8994-MUG pmol/min/mg albumen (leaf); PGBP1-4 is 1668.2274-MUG pmol/min/mg albumen (leaf);
15B control group GUS enzyme specific activity: (ck) pGBP1 is 1205.2584-MUG pmol/min/mg albumen (leaf); (ck) pGBP1-1 is 1456.5994-MUG pmol/min/mg albumen (leaf); (ck) pGBP1-2 is 1176.2844-MUGpmol/min/mg albumen (leaf); (ck) pGBP1-3 is 809.33884-MUG pmol/min/mg albumen (leaf); (ck) pGBP1-4 is 281.5494-MUG pmol/min/mg albumen (leaf);
The result shows, Plant hormones regulators,gibberellins can significantly induce GUS express in the activity of promotor, after this element disappearance, promoter fragment is replied a little less than effect embodies Plant hormones regulators,gibberellins.Accordingly can be tentatively definite, the response original paper of Plant hormones regulators,gibberellins-1110～-1180bp between, this response original paper GCCTTTTG with promoter Analysis is consistent.
3, phytokinin is induced the impact on promotor in the transfer-gen plant
(temperature is 22 ℃ ± 2 ℃ to the experimental group of Figure 16 A (6-BA): T1, and intensity of illumination is 0.3-0.4mmolm under normal operation for turning GBP1 Arabidopis thaliana (pGBP1) seed -2S -1, the light of growth/dark cycle is 16h/8h, relative humidity is about 80%.) cultivated 16 days, (be comprised of 1/2MS nutrient solution and 6-BA, the concentration of described 6-BA in described nutrient solution is 1mg/L with the nutrient solution of the phytokinin (6-BA) that contains 1mg/L.) spray plant leaf, get blade at processing 0.5,1,2,4,6,8,12,24,48h respectively and detect the GUS activity.The control group of Figure 16 A (CK): spray the 1/2MS nutrient solution (CK) that does not contain phytokinin such as the transgenic arabidopsis under the above-mentioned cultivation.
Protein concentration: 16A experimental group gus protein concentration: 0.5h is 0.001997mg/g (leaf); 1h is 0.00206mg/g (leaf); 2h is 0.002111mg/g (leaf); 4h is 0.002112mg/g (leaf); 6h is 0.002121mg/g (leaf); 8h is 0.002142mg/g (leaf); 12h is 0.002547mg/g (leaf); 24h is 0.00208mg/g (leaf); 48h is 0.001783mg/g (leaf); 16A control group gus protein concentration: ck is 0.0021mg/g (leaf)
The GUS enzyme reaction: 16A experimental group GUS enzyme specific activity: 0.5h is 3344.9354-MUG pmol/min/mg albumen (leaf); 1h is 2359.5144-MUG pmol/min/mg albumen (leaf); 2h is 2892.1734-MUG pmol/min/mg albumen (leaf); 4h is 5280.3384-MUG pmol/min/mg albumen (leaf); 6h is 5166.5174-MUG pmol/min/mg albumen (leaf); 8h is 3774.6244-MUG pmol/min/mg albumen (leaf); 12h is 3213.4574-MUG pmol/min/mg albumen (leaf); 24h is 3441.3714-MUG pmol/min/mg albumen (leaf); 48h is 2743.2614-MUG pmol/min/mg albumen (leaf); 16A control group GUS enzyme specific activity: ck is 1620.664-MUG pmol/min/mg albumen (leaf).
The result shows, phytokinin can induce GUS to express, and active prolongation with the time of processing improves, and reaches maximum value at 6h, and the GUS activity is 3.2 times before processing, and then reduces gradually.Accordingly can be tentatively definite, phytokinin is the inductor of GBP1 gene promoter.
The experimental group of Figure 16 B: T1 cultivated 16 days for the Arabidopis thaliana seed that changes GBP1 promoter deletion fragment under normal operation for turning GBP1 Arabidopis thaliana (pGBP1) and T1, (formed by 1/2MS nutrient solution and 6-BA with the phytokinin nutrient solution that contains 1mg/L, the concentration of described 6-BA in described nutrient solution is 1mg/L) spray plant leaf, process 6h, get blade and detect the GUS activity.T1 is respectively T1 for turning GBP1-1 Arabidopis thaliana (pGBP1-1), T1 for turning GBP1-2 Arabidopis thaliana (pGBP1-2), T1 for turning GBP1-3 Arabidopis thaliana (pGBP1-3), T1 for turning GBP1-4 Arabidopis thaliana (pGBP1-4) for the Arabidopis thaliana that changes GBP1 promoter deletion fragment over to.The control group of Figure 16 B: spray the 1/2MS nutrient solution that does not contain phytokinin such as the transgenic arabidopsis under the above-mentioned cultivation, obtain T1 for turning GBP1 Arabidopis thaliana control group ((CK) pGBP1), T1 for turning GBP1-1 Arabidopis thaliana control group ((CK) pGBP1-1), T1 for turning GBP1-2 Arabidopis thaliana control group ((CK) pGBP1-2), T1 for turning GBP1-3 Arabidopis thaliana control group ((CK) pGBP1-3), T1 for turning GBP1-4 Arabidopis thaliana control group ((CK) pGBP1-4).
16B experimental group gus protein concentration: pGBP1 is 0.002112mg/g (leaf); PGBP1-1 is 0.001712mg/g (leaf); PGBP1-2 is 0.001806mg/g (leaf); PGBP1-3 is 0.00183mg/g (leaf); PGBP1-4 is 0.001799mg/g (leaf); 16B control group gus protein concentration: (CK) pGBP1 is 0.002112mg/g (leaf); Ck-pGBP1-1 is 0.001724mg/g (leaf); (CK) pGBP1-2 is 0.001709mg/g (leaf); Ck-pGBP1-3 is 0.001762mg/g (leaf); (CK) pGBP1-4 is 0.002086mg/g (leaf)
16B experimental group GUS enzyme specific activity: pGBP1 is 5280.3384-MUG pmol/min/mg albumen (leaf); PGBP1-1 is 2752.7474-MUG pmol/min/mg albumen (leaf); PGBP1-2 is 2991.5954-MUG pmol/min/mg albumen (leaf); PGBP1-3 is 2183.5044-MUG pmol/min/mg albumen (leaf); PGBP1-4 is 1540.9064-MUGpmol/min/mg albumen (leaf); 16B control group GUS enzyme specific activity: (CK) pGBP1 is 1205.2584-MUG pmol/min/mg albumen (leaf); (CK) pGBP1-1 is 1456.5994-MUG pmol/min/mg albumen (leaf); (CK) pGBP1-2 is 1176.2844-MUG pmol/min/mg albumen (leaf); (CK) pGBP1-3 is 809.33884-MUG pmol/min/mg albumen (leaf); (CK) pGBP1-4 is 281.5494-MUG pmol/min/mg albumen (leaf);
The result shows, phytokinin can significantly induce GUS to express, and after this element disappearance, promoter fragment is replied a little less than effect embodies Plant hormones regulators,gibberellins.Tentatively infer accordingly the response original paper position of phytokinin, may be positioned at the same area with the response element of Plant hormones regulators,gibberellins, software analysis is not determined its particular location yet, awaits doing further checking.
III high temperature heat-inducible:
(temperature is 22 ℃ ± 2 ℃ to Figure 17 A experimental group (every row are respectively 37 ℃, 42 ℃ of Temperature Treatment): T1, and intensity of illumination is 0.3-0.4mmolm under normal operation for turning GBP1 Arabidopis thaliana (pGBP1) seed -2S -1, the light of growth/dark cycle is 16h/8h, relative humidity is about 80%.) cultivated 16 days, change over to respectively under 37 ℃, 42 ℃ and coerce, process for every group and behind 20min, get blade and carry out the GUS histochemical stain.
Figure 17 A control group: such as the transgenic arabidopsis under the above-mentioned cultivation, do not do high temperature stress (25 ℃, contrast).
Protein concentration: 17A experimental group gus protein concentration: 37 ℃ for the treatment of group are 0.001758mg/g (leaf); 42 ℃ for the treatment of group are 0.001764mg/g (leaf); 17A control group gus protein concentration: ck is 0.001484mg/g (leaf);
17A experimental group GUS enzyme specific activity: 37 ℃ for the treatment of group are 6723.7994-MUG pmol/min/mg albumen (leaf); 42 ℃ for the treatment of group are 9273.7564-MUG pmol/min/mg albumen (leaf); 17A control group GUS enzyme specific activity: ck is 4661.069
4-MUG pmol/min/mg albumen (leaf).
The result shows: behind the Stress treatment 20min, 37 ℃ of high temperature can induce GUS to express, and expression amount is about 1.4 times of contrast, and 42 ℃ of lower GUS expression amounts are about 2.0 times of contrast.
(temperature is 22 ℃ ± 2 ℃ to Figure 17 B experimental group (37 ℃): T1, and intensity of illumination is 0.3-0.4mmolm under normal operation for the Arabidopis thaliana seed that changes GBP1 promoter deletion fragment over to for turning GBP1 Arabidopis thaliana (pGBP1) and T1 -2S -1), the light of growth/dark cycle is that 16h light/8h is dark, relative humidity is about 80%.) cultivated 16 days, change under 37 ℃ and coerce, behind 20min, get blade and carry out the detection of GUS enzyme activity.T1 is respectively T1 for turning GBP1-1 Arabidopis thaliana (pGBP1-1), T1 for turning GBP1-2 Arabidopis thaliana (pGBP1-2), T1 for turning GBP1-3 Arabidopis thaliana (pGBP1-3), T1 for turning GBP1-4 Arabidopis thaliana (pGBP1-4) for the Arabidopis thaliana that changes GBP1 promoter deletion fragment over to.
Figure 17 B control group (CK): such as the Arabidopis thaliana that turns GBP1 promoter deletion fragment under the above-mentioned cultivation, do not do high temperature stress, obtain T1 for turning GBP1 Arabidopis thaliana control group ((CK) pGBP1), T1 for turning GBP1-1 Arabidopis thaliana control group ((CK) pGBP1-1), T1 for turning GBP1-2 Arabidopis thaliana control group ((CK) pGBP1-2), T1 for turning GBP1-3 Arabidopis thaliana control group ((CK) pGBP1-3), T1 for turning GBP1-4 Arabidopis thaliana control group ((CK) pGBP1-4).
17B experimental group gus protein concentration: pGBP1 is 0.001758mg/g (leaf); PGBP1-1 is 0.001757mg/g (leaf); PGBP1-2 is 0.001785mg/g (leaf); PGBP1-3 is 0.00172mg/g (leaf); PGBP1-4 is 0.001715mg/g (leaf) 17B control group gus protein concentration: (CK) pGBP1 is 0.002112mg/g (leaf); Ck-pGBP1-1 is 0.001724mg/g (leaf);
(CK) pGBP1-2 is 0.001709mg/g (leaf); Ck-pGBP1-3 is 0.001762mg/g (leaf);
(CK) pGBP1-4 is 0.002086mg/g (leaf).
The GUS enzyme reaction:
17B experimental group GUS enzyme specific activity: pGBP1 is 6723.7994-MUG pmol/min/mg albumen (leaf); PGBP1-1 is 3929.5984-MUG pmol/min/mg albumen (leaf); PGBP1-2 is 3258.9544-MUG pmol/min/mg albumen (leaf); PGBP1-3 is 2098.0784-MUG pmol/min/mg albumen (leaf); PGBP1-4 is 605.27874-MUGpmol/min/mg albumen (leaf); 17B control group GUS enzyme specific activity: (CK) pGBP1 is 1205.2584-MUG pmol/min/mg albumen (leaf); (CK) pGBP1-1 is 1456.5994-MUG pmol/min/mg albumen (leaf); (CK) pGBP1-2 is 1176.2844-MUG pmol/min/mg albumen (leaf); (CK) pGBP1-3 is 809.33884-MUG pmol/min/mg albumen (leaf); (CK) pGBP1-4 is 281.5494-MUG pmol/min/mg albumen (leaf);
The result shows that 37 ℃ of high temperature can significantly be induced the GBP1 promoter activity, and along with 5 ' end disappearance gradually, the heat shock element of 3 different positionss is deleted successively, the diminuendo of GUS expression amount, tentatively determined the position-480 of 3 heat shock controlling elements～-380bp;-780～-680bp;-1160～-1080bp, this response original paper AAATTTC with promoter Analysis is consistent.
IV, sensitivity of light experiment:
1, the lower different photoperiods of long day (16h light/8h is dark) are on the impact of GBP1 promotor daily rhythmicity:
T1 generation turn be seeded into after the seed disinfection of GBP1 Arabidopis thaliana place light/dark cycle to be that 16h light/8h is dark in the MS substratum, temperature is to cultivate about 12d in 18-22 ℃, the illumination box of 20000lx, grow 2-4 sheet true leaf, then transfer in the soil, 16h light/8h is dark, and culture temperature is 18-22 ℃.Plant to be planted well-grown after 28 days, carrying out sensitivity of light detects, minute two groups of processing: cultivate under (1) long day condition after 48 hours continuous 48 hours photo-irradiation treatment (be LD-LL, in cultivation under 16h light/8h dark condition after 48 hours, continuous 48 hours photo-irradiation treatment.), drew materials once in per 3 hours in 96 hours periods, count 32 samples.(2) cultivate under the long day condition that continuous 48 hours dark place reasons (are LD-DD after 48 hours; After cultivating 48 hours under 16h light/8h dark condition, continuous 48 hours dark place reasons.), drew materials once in per 3 hours in 96 hours periods, count 32 samples, spectrophotofluorometer detects the GUS enzyme activity.
The result shows: under the long day condition, from the photophase, T1 generation turns the GUS expression amount of GBP1 Arabidopis thaliana progressively reduces, minimum about 12 hours, raises in after this 3 hours, arrives the photophase maximum about 15 hours, falls after rise to lower level again before entering the dark phase.The dark phase begins rear GUS activity and strengthens gradually, arrives the maximum under the dark phase about 4 hours, and the dark phase maintains initial level when finishing nearly, enters next photoperiod expression pattern.
Being in the long day cultivates lower T1 generation and turns GBP1 Arabidopis thaliana plant, continues to give illumination after the photoperiod end, and the GUS activity significantly strengthens, continuous illumination after 3 hours the GUS vigor obviously strengthen, level slightly is better than maximum under the photophase in normal light cycle; Behind the continuous light 27 hours, second peak value express to appear in GUS, is about 1.5 times of maximum under the photophase in normal light cycle.Be down to subsequently initial mean level (ML), as seen from the figure, continuous photo-irradiation treatment has been broken the original diel rhythm of this promotor, and at specified time adjusted GUS expression amount (see Figure 18, specifically see Table 2) to a certain degree.
Being in the long day cultivates lower T1 generation and turns the GBP1 Arabidopis thaliana, continues to give dark after the dark phase end, and the GUS activity is in rising trend in 12 hours, after this irregular up and down fluctuation, until dark processing in the time of 84 hours, second peak value occur, be 1.2 times of maximum under the dark phase in normal light cycle.Gradually downward modulation in 12 hours subsequently, but still be higher than normal light mean value under the cycle.(see Figure 19, specifically see Table 2).
2, the lower different photoperiods of short day (8h light/16h is dark) are on the impact of GBP1 promoter activity:
T1 is seeded in the MS substratum for after turning the seed disinfection of GBP1 Arabidopis thaliana, place light/dark cycle to be that 16h light/8h is dark, temperature is to cultivate about 12d in 18-22 ℃, the illumination box of 20000lx, grows 2-4 sheet true leaf, then transfers in the soil, 8h light/16h is dark, and culture temperature is 18-22 ℃.Plant to be planted well-grown after 28 days carries out sensitivity of light and detects, minute two groups of processing: under (1) short day condition cultivation after 48 hours continuous 48 photo-irradiation treatment (be SD-LL; After cultivating 48 hours under 8h light/16h dark condition, continuous 48 hours photo-irradiation treatment.), drew materials once in per 3 hours in 96 hours periods, count 32 samples.(2) cultivate under the short day condition that continuous 48 dark places reason (is SD-DD after 48 hours; After cultivating 48 hours under 8h light/16h dark condition, continuous 48 hours dark place reasons.), drew materials once in per 3 hours in 96 hours periods, count 32 samples, spectrophotofluorometer detects the GUS enzyme activity.
The result shows: be subjected to the GUS enzyme average activity of GBP1 promoter regulation to be higher than the long day under the short day condition, be about 2 times of long day, and still can present certain rhythmicity.But with different under the long day be: along with the shortening of short day lower photophase of condition, GUS expressed and namely build up to higher level about 3 hour under photophase, after this began downward modulation, began to raise after entering about dark 7 hours phases, reach maximum about 9 hours, level and under the photophase maximum suitable.Along with the dark phase finishes gradually decline of GUS expression, fall back to initial level, continue to enter next photoperiod expression pattern.
Be in the transfer-gen plant under the short day cultivation, normal light continues to give illumination after the cycle, 16 hours Natural promoter activity of continuous light are kept constant substantially, fail to embody corresponding rule, after this GUS expression amount sharply strengthens, and is about 1.8 times of maximum under the photophase in normal light cycle.Again be adjusted downward to respective horizontal in afterwards 20 hours, but the GUS enzyme activity still is higher than normal light mean value (see Figure 20, specifically see Table 2) under the cycle.
Be in the transfer-gen plant under the short day cultivation, after finishing, the dark phase continues to give dark, similar with performance in the dark phase under the normal short day, GUS expresses obviously and raises in 9 hours, maximum is about 1.3 times of maximum under the dark phase in normal light cycle, and after this GUS expression amount presents irregular fluctuation, until dark processing is when finishing, the level that GUS expresses is a little higher than normal light mean value (see Figure 21, specifically see Table 2) under the cycle still.
Shown in result's table 2 specific as follows of photaesthesia experiment:
Table 2 photosensitivity test data statistics:
Figure BDA0000074357590000181
Figure BDA0000074357590000191
As seen from Table 2: 1, transcribing of GBP1 is subjected to day long regulation and control: in 2 days under SD expression amount all be higher than under the LD, GUS expression amount mean level (ML) is about 2 times under the LD; SD promotes the expression of this gene.The length (8h or 16h) of two kinds of photoperiod (LD/SD) lower dark phases has affected this promotor light moment that peak value occurs under dark period.Under the short day condition, the photophase shortens 8 hours, and then gus gene is in accordingly in advance appearance in about 9 hours of the peak value of expressing under the photophase; The dark phase increases by 8 hours, and then the gus gene peak value of expressing under the dark phase has been postponed accordingly about 6 hours and having been occurred.2, transcribing of GBP1 regulated and control by physiological clock: be transferred to respectively under the LL by LD and SD, phraseology illustrates that to similar under LD and SD respectively physiological clock regulates and control the diel rhythm phraseology of this gene under the LL.
Comprehensive above-mentioned 2 points, transcribing of this gene is subjected to physiological clock and day long common regulation and control, and SD induces the expression of this gene, thereby infers that this gene is the cone production factor of the short day approach of soybean.Above serial experiment is found, in different photoperiod types (long day; Short day; Optical processing in continuous 48 hours after long day; Continuous 48 hours dark place reasons after long day; Optical processing in continuous 48 hours behind the short day; Continuous 48 hours dark place reasons behind the short day) under, the activity of GBP1 promotor has produced change in various degree, can find out from the expression amount variation of GUS.Yet plant is to photoperiodic reaction multiple transcription factor and cis-acting elements inside and outside molecular level relates to cell, at present, for fixed in the model plant Arabidopis thaliana and photoperiod rhythm and pace of moving things genes involved such as LATE ELONGA TED HYPOCOTYL (LHY), CIRCADIAN CLOCK-ASSOCIA TED1 (CCA 1), TIMING OF CAB EXPRESSION 1 (TOC1), CONSTANS (CO), FLOWERING TIME (FT) etc., the realization of rhythmicity depends on such as the interaction of said gene and classification regulation and control, and wherein the change of arbitrary factor all can exert an influence to the embodiment of plant rhythmicity.Give transgenic arabidopsis in this research with the Different Light-dark cycle, the GUS expression amount presents different variations under every group of photoperiod, infer transcription factor relevant with photoperiod rhythm and pace of moving things clock in the plant body or albumen etc. accordingly with certain ad hoc fashion in conjunction with on the GBP1 promotor interior lights controlling element, and guide its activity, and then induce or suppressed the reply effect of GBP1 promotor to light, thereby be subjected to the gus gene expression amount of promoters driven to be presented as in various degree variation thereupon.Goal gene GUS only is reporter gene in this research, can not participate in the expression pattern system of photoperiod related gene, be difficult to infer the upstream and downstream gene with its function association, the spatial and temporal expression characteristics of gus gene can only show this gene independent daily rhythmicity of expressing under the light regulation and control, not yet can reflect strictly according to the facts the definite effect in the optical signal delivery network of GBP1 promotor or GBP1 gene, follow-up work will as reference, confirm that further this gene participates in the molecule mechanism of photoperiodic reaction.
Figure IDA0000074357680000011
Figure IDA0000074357680000021
Figure IDA0000074357680000031

Claims (9)

1.DNA fragment is following 1)-9) in arbitrary described dna fragmentation:
1) dna molecular shown in the sequence 1 of sequence table;
2) sequence 1 of sequence table is from 5 ' terminal 8-1501 position Nucleotide;
3) sequence 1 457-1501 position Nucleotide from 5 ' end in the sequence table;
4) sequence 1 655-1489 position Nucleotide from 5 ' end in the sequence table;
5) sequence 1 768-1487 position Nucleotide from 5 ' end in the sequence table;
6) sequence 1 1305-1501 position Nucleotide from 5 ' end in the sequence table;
7) under stringent condition with 1)-6) and in arbitrary described dna sequence dna hybridization and have the dna fragmentation of promoter function;
8) with 1)-7) in arbitrary described dna sequence dna have 90% above homology, and have the dna fragmentation of promoter function.
2. the recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium that contain dna fragmentation described in the claim 1.
3. the primer pair of dna fragmentation described in the amplification claim 1.
4. primer according to claim 3 pair is characterized in that:
Described primer is to being following arbitrary 1)-5) shown in primer pair:
1): a primer of described primer centering is the Nucleotide shown in the sequence 2, and another primer is the Nucleotide shown in the sequence 3;
2): a primer of described primer centering is the Nucleotide shown in the sequence 4, and another primer is the Nucleotide shown in the sequence 5;
3): a primer of described primer centering is the Nucleotide shown in the sequence 6, and another primer is the Nucleotide shown in the sequence 7;
4): a primer of described primer centering is the Nucleotide shown in the sequence 8, and another primer is the Nucleotide shown in the sequence 9;
5): a primer of described primer centering is the Nucleotide shown in the sequence 10, and another primer is the Nucleotide shown in the sequence 11.
5. the described dna fragmentation of claim 1 makes the application of goal gene in expressing in plant tissue.
6. the application described in according to claim 5, it is characterized in that: described plant tissue is root, stem, leaf, flower or seed.
7. according to claim 5 or the application described in 6, it is characterized in that: described plant is monocotyledons or dicotyledons.
8. arbitrary described application according to claim 5-7 is characterized in that: described monocotyledons is tobacco, and described dicotyledons is Arabidopis thaliana.
9. arbitrary described application according to claim 5-8 is characterized in that: described expression is coerced by Illumination adjusting, hormone or high temperature stress is realized; Described hormone is preferably phytokinin, Plant hormones regulators,gibberellins, Whitfield's ointment, dormin, and described high temperature is 37 ℃ and/or 42 ℃;
The mode of described Illumination adjusting is following 1)-4) in any:
1) after cultivating 48 hours under 16h light/8h dark condition, continuous 48 hours photo-irradiation treatment;
2) after cultivating 48 hours under 16h light/8h dark condition, continuous 48 hours dark place reasons;
3) after cultivating 48 hours under 8h light/16h dark condition, continuous 48 hours photo-irradiation treatment;
4) after cultivating 48 hours under 8h light/16h dark condition, continuous 48 hours dark place reasons.
CN201110189842.2A 2011-07-07 2011-07-07 Efficient inducible expression promoter and application Expired - Fee Related CN102864145B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201110189842.2A CN102864145B (en) 2011-07-07 2011-07-07 Efficient inducible expression promoter and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201110189842.2A CN102864145B (en) 2011-07-07 2011-07-07 Efficient inducible expression promoter and application

Publications (2)

Publication Number Publication Date
CN102864145A true CN102864145A (en) 2013-01-09
CN102864145B CN102864145B (en) 2014-02-12

Family

ID=47443276

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201110189842.2A Expired - Fee Related CN102864145B (en) 2011-07-07 2011-07-07 Efficient inducible expression promoter and application

Country Status (1)

Country Link
CN (1) CN102864145B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112442502A (en) * 2020-12-08 2021-03-05 河南大学 Application of promoter GmLHY in regulating gene time specificity response light signal
CN112481264A (en) * 2020-12-08 2021-03-12 河南大学 Application of promoter GmLCLa1 in response to abscisic acid treatment and water stress of regulatory gene

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101831425A (en) * 2009-11-25 2010-09-15 东北农业大学 Plant promoter related to photoperiod and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101831425A (en) * 2009-11-25 2010-09-15 东北农业大学 Plant promoter related to photoperiod and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
王志新 等: "植物诱导型启动子的研究进展", 《大豆科技》 *
郝迪萩 等: "克隆启动子方法的比较及应用", 《东北农业大学学报》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112442502A (en) * 2020-12-08 2021-03-05 河南大学 Application of promoter GmLHY in regulating gene time specificity response light signal
CN112481264A (en) * 2020-12-08 2021-03-12 河南大学 Application of promoter GmLCLa1 in response to abscisic acid treatment and water stress of regulatory gene
CN112442502B (en) * 2020-12-08 2022-06-21 河南大学 Application of promoter GmLHY in regulating gene time specificity response light signal
CN112481264B (en) * 2020-12-08 2022-11-22 河南大学 Application of promoter GmLCLa1 in regulation and control of gene response abscisic acid treatment and water stress

Also Published As

Publication number Publication date
CN102864145B (en) 2014-02-12

Similar Documents

Publication Publication Date Title
Liau et al. Agrobacterium tumefaciens-mediated transformation of an Oncidium orchid
CN101528934B (en) Methods for producing transgenic plants
US8076142B2 (en) Rooted plant assay system
Anuradha et al. Genetic transformation of peanut (Arachis hypogaea L.) using cotyledonary node as explant and a promoterless gus:: npt II fusion gene based vector
US20140223607A1 (en) Transformation system in camelina sativa
EP0275069A2 (en) Pollen-mediated gene transformation in plants
US20090151023A1 (en) Transformation system for Camelina sativa
Cho et al. Agrobacterium rhizogenes-mediated transformation and regeneration of the legume Astragalus sinicus (Chinese milk vetch)
Pan et al. Agrobacterium tumefaciens-mediated transformation of biofuel plant Jatropha curcas using kanamycin selection
US20060212973A1 (en) Agrobacterium-mediated transformation of turfgrass
CN108085334A (en) A kind of Agrobacterium-mediated Transformation barley microspore method of improvement
Tsai et al. Plant regeneration and stable transformation in the floricultural plant Cleome spinosa, a C 3 plant closely related to the C 4 plant C. gynandra
Espasandin et al. Agrobacterium tumefaciens-mediated transformation of Lotus tenuis and regeneration of transgenic lines
CN102864145B (en) Efficient inducible expression promoter and application
WO1996025504A1 (en) Genetic modification of plants
CN102010864B (en) Maize pollen tissue specific promoter and expression vector thereof
Cui et al. A rapid Agrobacterium-mediated transformation of Antirrhinum majus L. by using direct shoot regeneration from hypocotyl explants
Lim et al. High plant regeneration, genetic stability of regenerants, and genetic transformation of herbicide resistance gene (bar) in chinese cabbage (Brassica campestris ssp. pekinensis)
CN103255112B (en) Peanut GA20-oxidase protein as well as coding gene AhGA20ox1 and application thereof
Handberg et al. Transgenic plants: Agrobacterium-mediated transformation of the diploid legume Lotus japonicus
CN100381574C (en) Gentic transforming method of perennial rye grass
US20040210958A1 (en) A Novel Culture Method for Corn Transformation
CN107475174B (en) Method for transforming rape
KR101677067B1 (en) Seedspecific promoter derived from Oryza sativa and use thereof
JP2003000082A (en) Method for preparing recombinant plant not containing selected marker and recombinant plant prepared by the method

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20140212

Termination date: 20150707

EXPY Termination of patent right or utility model