CN102851280A - Application of RNA (ribonucleic acid) and gene for generating RNA in regulating development of rice root system - Google Patents
Application of RNA (ribonucleic acid) and gene for generating RNA in regulating development of rice root system Download PDFInfo
- Publication number
- CN102851280A CN102851280A CN2012103477121A CN201210347712A CN102851280A CN 102851280 A CN102851280 A CN 102851280A CN 2012103477121 A CN2012103477121 A CN 2012103477121A CN 201210347712 A CN201210347712 A CN 201210347712A CN 102851280 A CN102851280 A CN 102851280A
- Authority
- CN
- China
- Prior art keywords
- gene
- sequence
- npcr1rna
- root system
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses application of an RNA (ribonucleic acid) and a gene for generating the RNA in regulating development of a rice root system, particularly application of an Os-npcR1 RNA or gene for generating the Os-npcR1 RNA in regulating development of a rice root system. The nucleotide sequence of the Os-npcR1 RNA is disclosed as Sequence 2 in the sequence table. The regulation of development of the plant root system is to inhibit or promote the development of the plant root system. The experiment proves that the development of the root system of the transgenic rice obtained by carrying out transgenic overexpression on the rice Os-npcR1 gene is inhibited, which indicates that the gene can reduce the root system of rice, but can not influence the growth and development of the overground part. Therefore, the gene can provide important reference for breeding related to crop close planting, or be used as a candidate gene.
Description
Technical field
The present invention relates to biological technical field, the application of gene in the adjusting and controlling rice root system development that relates in particular to a kind of RNA and produce this RNA.
Background technology
Plant absorbs moisture, mineral substance and other nutritive ingredient by root system from soil, therefore, root system is of crucial importance to growing of plant.And have significantly difference between the root system of single, double cotyledon plant, and such as the Arabidopis thaliana in the dicotyledons main root being arranged, and produce lateral root at main root, monocotyledon rice is main with huge adventive root then.Therefore, although in the research of Arabidopis thaliana root system development, obtained greater advance in recent years, the related mechanism of food crop paddy rice is understood also few.The gene of the participation root system development of having reported is less, CRL1(CROWN ROOTLESS1 is only arranged), WOX11 (WUSCHEL-relatedhomeoboxgene) and RSL4 (ROOT HAIR DEFECTIVE6-LIKE4) etc., they all are the functional genes of proteins encoded.Up to the present, also there is not long non-coding RNA (non-protein coding RNA, npcRNA) to participate in the report of root system development.The research of plant long non-coding RNA is the focus that rises recent years, successively has two pieces of article long non-coding RNAs of report (LDMAR) to have the important regulating and controlling effect in the photaesthesia nuclear of paddy rice is sterile in 2012.Shown and had a large amount of long non-coding RNAs in the plant although transcribe the group sequencing result, most of all Unknown Function.
Summary of the invention
An object of the present invention is to provide a kind of long RNA Os-npcR1RNA in the paddy rice and produce the purposes of the gene Os-npcR1 of this RNA.
Os-npcR1RNA provided by the invention or the application of gene in the regulating plant root system development that produces this RNA; The nucleotides sequence of described Os-npcR1RNA is classified the sequence 2 in the sequence table as.
In the above-mentioned application, the nucleotides sequence of the gene of described generation Os-npcR1RNA is classified in the sequence table sequence 1 as from 5 ' terminal 8-521 Nucleotide.
In the above-mentioned application, described regulating plant root system development is for suppressing plant root system development or promoting plant root system development.
In the above-mentioned application, described inhibition root system development is embodied in and reduces main root length; Described plant is monocotyledons or dicotyledons; Adopting in an embodiment of the present invention monocotyledons is paddy rice.
Another object of the present invention provides a kind of method of cultivating transgenic plant.
Method provided by the invention, for the gene that will produce Os-npcR1RNA imports the purpose plant, the transgenic plant of the root system development that is inhibited, the nucleotides sequence of described Os-npcR1RNA is classified the sequence 2 in the sequence table as.
In the aforesaid method, described inhibition root system development is embodied in the main root length of described transgenic plant less than described purpose plant.
The nucleotides sequence of the gene of described generation Os-npcR1RNA is classified in the sequence table sequence 1 as from 5 ' terminal 8-521 Nucleotide.The gene of described generation Os-npcR1RNA imports described purpose plant by expression vector.
In the aforesaid method, described expression vector is that the gene with described generation Os-npcR1RNA inserts among the pCAMBIA1300 carrier of the expression Os-npcR1RNA that obtains.In an embodiment of the present invention, expression vector is os-npcR1-1300, is specially the sequence 1 in the sequence table is inserted the carrier that obtains between the Xba I of pCAMBIA1300 and Sac I restriction enzyme site from 5 ' terminal 8-521 position Nucleotide.
In the aforesaid method, described purpose plant is dicotyledons or monocotyledons; Adopting in an embodiment of the present invention monocotyledons is paddy rice.
The 3rd purpose of the present invention provides a kind of expression vector.
Expression vector provided by the invention, for the gene that will produce Os-npcR1RNA inserts among the pCAMBIA1300, the carrier of the expression Os-npcR1RNA that obtains; The nucleotides sequence of described Os-npcR1RNA is classified the sequence 2 in the sequence table as; The nucleotide sequence of the gene of described generation Os-npcR1RNA is specially in the sequence table sequence 1 from 5 ' terminal 8-521 Nucleotide.In an embodiment of the present invention, expression vector is os-npcR1-1300, is specially the sequence 1 in the sequence table is inserted the carrier that obtains between the Xba I of pCAMBIA1300 and Sac I restriction enzyme site from 5 ' terminal 8-521 position Nucleotide.
Of the present invention experimental results show that, the gene that the present invention produces os-npcR1RNA with paddy rice carries out transgenosis and crosses expression, obtains transgenic paddy rice, and the root system development of this transgenic paddy rice is suppressed, illustrate that this gene can reduce the root system of paddy rice, but do not affect growing of its over-ground part.Therefore during this gene may be applied in the relevant breeding research of farm crop dense planting and produce.
Description of drawings
Fig. 1 is that pcr amplification obtains os-npcR1
Fig. 2 is that the PCR of transgenic paddy rice identifies
Fig. 3 is os-npcR1 adjusting and controlling rice root system development
Embodiment
Employed experimental technique is ordinary method if no special instructions among the following embodiment.
Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.
The acquisition of embodiment 1, os-npcR1RNA encoding gene
1, the extraction of rice total RNA
1) the Trizol method is extracted:
(1) (O.Sativa L.spp.japonica, varnipponbare below are also referred to as the wild-type paddy rice to get the fine paddy rice of an amount of Japan; Loss of Function of OsDCL1 Affects MicroRNA Accumulation and Causes Developmental Defects in Rice, Plant Physiology, 2005, V139 (1) 296-305; The public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity) material (0.1g) adding liquid nitrogen grinding 15min, to Powdered, pour powder into 2mL centrifuge tube (accounting for 1/2 pipe), then add immediately 1mL Trizol reagent.With powder and Trizol reagent mixing, at room temperature hatch 5min, so that the nucleic acid-protein complex body dissociates fully.
(2) with centrifuge tube in 4 ℃ of centrifugal 15min of 12000rpm.
(3) supernatant liquor is transferred in the new 2mL centrifuge tube, and to wherein adding equal-volume 0.5ml chloroform, manually behind the thermal agitation body 15s, room temperature is quiet to 2～3min.
(4) with centrifuge tube in 4 ℃ of centrifugal 15min of 12000rpm.
(5) water with the upper strata is transferred in the new centrifuge tube, to wherein adding isopyknic Virahol with precipitated rna.Behind the mixing, leave standstill 10min in-20 ℃.
(6) with centrifuge tube in 4 ℃ of centrifugal 10min of 12000rpm.
(7) outwell supernatant liquor, add 1mL 75% ethanol and clean the RNA precipitation, after the vibration, 4 ℃ of centrifugal 3min of 12000rpm.
(8) remove ethanolic soln, dry up at super clean bench.
(9) add the water dissolution precipitation that 20 μ l do not contain the RNA enzyme, obtain RNA solution.
2) purifying of RNA (except DNA)
(1) RNA solution is added water to 39 μ l, according to the form below adds all the other reagent, mixing.
Mixing solutions is in 37 ℃ of reaction 40min.
(2) manage the water 450 μ l that interior adding does not contain RNase to EP, make cumulative volume reach 500 μ l.
(3) to wherein adding 500 μ l water-saturated phenols, thermal agitation is in 4 ℃ of centrifugal 10min of 12000rpm.
(4) supernatant liquor is transferred in the new centrifuge tube, adds the equal-volume chloroform, thermal agitation is in 4 ℃ of centrifugal 10min of 12000rpm.
(5) supernatant liquor is transferred in the new centrifuge tube, adds the equal-volume Virahol, mixing.
(6) add 1/10V3M NaAc solution (pH 5.2) in centrifuge tube ,-70 ℃ of placements are spent the night.
(7) in 4 ℃ of centrifugal 10min of 12000rpm.
(8) outwell supernatant liquor, add 1mL 75% ethanol and clean the RNA precipitation, after the vibration, 4 ℃ of centrifugal 3min of 12000rpm.
(9) remove ethanolic soln, dry up at super clean bench.
(10) add the water dissolution precipitation that 20 μ l do not contain the RNA enzyme, obtain total RNA.
2, the reverse transcription of paddy rice RNA
Add total RNA5 microgram in the reverse transcription reaction system of 20 μ l.
(1) according to lower volume reagent and solution being added in the PCR tubule
Rapid ice bath 2min behind (2) 70 ℃ of heating 5min.
(3) in the tubule according to adding reagent with lower volume
(4) 42 ℃ were reacted 1 hour.
(5) 95 ℃ of heating 5min stop reverse transcription reaction, obtain cDNA.
3, the os-npcR1 encoding gene obtains
According to special primer P1 and the P2 of rice genome sequences Design os-npcR1, primer sequence is as follows:
P1：ATCTAGAATGGTCTGGATTCGCCTCGTC
P2：TGAGCTCTGCAGATGTACGCAGTACAGCCAAAGA
The rice cDNA that obtains take top reverse transcription is as template, this gene that increases, and reaction system is as follows:
Then carry out pcr amplification according to follow procedure,
PCR result as shown in Figure 1, M:Marker; The P:PCR amplified production obtains the PCR product of 528bp.
This PCR product is inserted in the EZ-T carrier (Beijing Kang Run is the industry bio tech ltd really), obtain recombinant plasmid os-npcR1-EZ-T, through order-checking, the nucleotides sequence of the PCR product on this plasmid is classified the Nucleotide shown in the sequence 1 in the sequence table as, wherein the sequence in the sequence table 1 is os-npcR1 from the unnamed gene shown in 5 ' the terminal 8-521 position Nucleotide, the nucleotides sequence of the RNA of this genetic transcription is classified the sequence 2 in the sequence table, called after os-npcR1 as.
One, turns the acquisition of os-npcR1 paddy rice
1, the structure that contains os-npcR1 overexpression recombinant vectors
The plasmid os-npcR1-EZ-T that embodiment 1 is obtained is with Xba I and Sac I digestion with restriction enzyme os-npcR1-EZ-T, reclaim the purpose segment of about 528bp, use simultaneously Xba I and Sac I digestion with restriction enzyme expression vector pCAMBIA1300(available from CAMBIA, Australia), reclaim the carrier segment, then with purpose segment and carrier-pellet connection breaking, obtain recombinant expression vector os-npcR1-1300, this recombinant expression vector is sent to order-checking, and this carrier is for inserting the carrier that obtains between the Xba I of pCAMBIA1300 and Sac I restriction enzyme site with the sequence 1 in the sequence table from 5 ' terminal 8-521 position Nucleotide as a result.
2, turn the acquisition of os-npcR1 paddy rice
Change above-mentioned recombinant expression vector os-npcR1-1300 over to Agrobacterium AGL1(ATCC No.BAA-101, available from ATCC) in, obtain recombinant bacterium, extract the plasmid of this recombinant bacterium and send to order-checking, this plasmid is os-npcR1-1300, will contain the recombinant bacterium called after AGL1/os-npcR1-1300 of this plasmid.
Be transformed into by agriculture bacillus mediated method in the callus of Japanese fine paddy rice by recombinant bacterium AGL1/os-npcR1-1300, cultivate, screen kanamycin-resistant callus tissue at the Totomycin substratum, obtain T0 for turning the os-npcR1 paddy rice.
3, turn the evaluation of os-npcR1 paddy rice
1) extraction of genomic dna
(1) gets a certain amount of wild-type rice leaf, add liquid nitrogen, after fully grinding, powder is poured in the 1.5ml centrifuge tube;
(2) after liquid nitrogen volatilizees fully in centrifuge tube, add immediately 500ul DNA extraction damping fluid (0.1mol/LTrisHCl(pH 8.0), 0.5mol/LNaCl, 0.05mol/L EDTA, 0.5%SDS), fully behind the mixing, 65 ℃ are incubated 30 minutes, the continuous gentleness centrifuge tube that turns upside down makes sample fully mix with damping fluid during this time;
(3) with 12,000rpm room temperature centrifugal 15 minutes;
(4) supernatant liquor is transferred to another centrifuge tube;
(5) add equal-volume tris-phenol, extracting one time;
(6) use again isopyknic chloroform extracting one time;
(7) get supernatant, add the equal-volume Virahol, softly rock centrifuge tube, make the abundant mixing of Virahol and supernatant liquor ,-20 left standstill 10 minutes, with 12,000rpm centrifugal 10 minutes;
(8) with 70% ethanol lotion, for subsequent use with the dissolving of sterilization distilled water after DNA is deposited in Bechtop and dries up, obtain genomic dna.
2) PCR of transgenic paddy rice identifies
For the genomic dna that turns the os-npcR1 rice leaf, then carry out the PCR evaluation of transgenic plant with the special primer P3 of 35S promoter and the special primer P2 of os-npcR1 with said extracted T0.The P3 primer sequence is as follows:
P3：AACAGAACTCGCCGTAAAGACTG。
The result as shown in Figure 2,1,2,3 are respectively T0 generation turns the PCR product of os-npcR1 paddy rice; +: the positive control of PCR reaction;-: the negative contrast of PCR reaction take the wild-type paddy rice as template, obtain the positive transgenic plant of 1034bp, obtain altogether the positive T0 of 20 strains for turning the os-npcR1 paddy rice.
Adopting uses the same method changes empty carrier pCAMBIA1300 in the wild-type paddy rice over to, obtains T0 for turning the empty carrier paddy rice, adopts above-mentioned primer to identify, does not have the purpose fragment, is illustrated as positive T0 for turning the empty carrier paddy rice.
Two, turn acquisition and the Function Identification of os-npcR1 paddy rice
Positive T0 for turning os-npcR1 paddy rice, wild-type paddy rice and T0 for turning the empty carrier paddy rice after planting the 15th day respectively, is observed root system; Each strain 6 strain, experiment triplicate, results averaged.
The result as shown in Figure 3, in positive T0 generation, turns os-npcR1 rice root (transgenic paddy rice) and obviously is weaker than wild-type paddy rice (contrast), but do not change the upgrowth situation of over-ground part.
Statistics main root length, positive T0 is 5 centimetres for the main root length that turns the os-npcR1 paddy rice;
The main root length of wild-type paddy rice is 2.4 centimetres;
Wild-type paddy rice and T0 are for turning the result of empty carrier paddy rice os-npcR1 without significant difference.
The above results explanation paddy rice os-npcR1 gene regulating the root system development of paddy rice, significant for transgenic breeding in the future.
Claims (10)
1.Os-npcR1RNA or the application of gene in the regulating plant root system development that produces Os-npcR1RNA; The nucleotides sequence of described Os-npcR1RNA is classified the sequence 2 in the sequence table as.
2. application according to claim 1 is characterized in that: the nucleotides sequence of the gene of described generation Os-npcR1RNA is classified in the sequence table sequence 1 as from 5 ' terminal 8-521 Nucleotide.
3. application according to claim 1 and 2 is characterized in that: described regulating plant root system development is for suppressing plant root system development or promoting plant root system development.
4. arbitrary described application according to claim 1-3 is characterized in that: described inhibition root system development is embodied in and reduces main root length;
Described plant is monocotyledons or dicotyledons; Described monocotyledons is specially paddy rice.
5. method of cultivating transgenic plant, for the gene that will produce Os-npcR1RNA imports the purpose plant, the transgenic plant of the root system development that is inhibited, the nucleotides sequence of described Os-npcR1RNA is classified the sequence 2 in the sequence table as.
6. method according to claim 5, it is characterized in that: described inhibition root system development is embodied in the main root length of described transgenic plant less than described purpose plant.
7. it is characterized in that according to claim 5 or 6 described methods: the nucleotides sequence of the gene of described generation Os-npcR1RNA is classified in the sequence table sequence 1 as from 5 ' terminal 8-521 Nucleotide;
The gene of described generation Os-npcR1RNA imports described purpose plant by expression vector.
8. method according to claim 7 is characterized in that: described expression vector inserts among the pCAMBIA1300 carrier of the expression Os-npcR1RNA that obtains for the gene with described generation Os-npcR1RNA.
9. arbitrary described method according to claim 5-8, it is characterized in that: described purpose plant is dicotyledons or monocotyledons; Described monocotyledons is specially paddy rice.
10. expression vector, for the gene that will produce Os-npcR1RNA inserts among the pCAMBIA1300, the carrier of the expression Os-npcR1RNA that obtains; The nucleotides sequence of described Os-npcR1RNA is classified the sequence 2 in the sequence table as; The nucleotide sequence of the gene of described generation Os-npcR1RNA is specially in the sequence table sequence 1 from 5 ' terminal 8-521 Nucleotide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210347712.1A CN102851280B (en) | 2012-09-18 | 2012-09-18 | RNA (ribonucleic acid) and application of gene for generating RNA in regulating development of rice root system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210347712.1A CN102851280B (en) | 2012-09-18 | 2012-09-18 | RNA (ribonucleic acid) and application of gene for generating RNA in regulating development of rice root system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102851280A true CN102851280A (en) | 2013-01-02 |
| CN102851280B CN102851280B (en) | 2014-12-31 |
Family
ID=47398259
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210347712.1A Active CN102851280B (en) | 2012-09-18 | 2012-09-18 | RNA (ribonucleic acid) and application of gene for generating RNA in regulating development of rice root system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102851280B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105463010A (en) * | 2014-09-05 | 2016-04-06 | 中国科学院植物研究所 | Application of SSR gene in regulating and controlling growth and development of roots of plants |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007029923A1 (en) * | 2005-09-05 | 2007-03-15 | Industry-Academic Cooperation Foundation Gyeongsang National University | A new gene controlling the development and growth of root and root hairs, and a transformed plant by the gene |
| CN101323853A (en) * | 2007-07-09 | 2008-12-17 | 华中农业大学 | Clone and use of transcription factor gene OsWOX20 forroot regulating rice growth and development |
| CN101891808A (en) * | 2010-03-18 | 2010-11-24 | 浙江大学 | Gene and protein encoded by rice root growth and development control gene OsSPR1 |
| WO2011108794A2 (en) * | 2010-03-03 | 2011-09-09 | 포항공과대학교 산학협력단 | Gene regulating cytokinesis, plants transformed with the gene, and method for regulating growth of plants using same |
| CN102242136A (en) * | 2011-04-26 | 2011-11-16 | 重庆大学 | Gene influencing root system development and yield of rice and application of gene |
-
2012
- 2012-09-18 CN CN201210347712.1A patent/CN102851280B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007029923A1 (en) * | 2005-09-05 | 2007-03-15 | Industry-Academic Cooperation Foundation Gyeongsang National University | A new gene controlling the development and growth of root and root hairs, and a transformed plant by the gene |
| CN101323853A (en) * | 2007-07-09 | 2008-12-17 | 华中农业大学 | Clone and use of transcription factor gene OsWOX20 forroot regulating rice growth and development |
| WO2011108794A2 (en) * | 2010-03-03 | 2011-09-09 | 포항공과대학교 산학협력단 | Gene regulating cytokinesis, plants transformed with the gene, and method for regulating growth of plants using same |
| CN101891808A (en) * | 2010-03-18 | 2010-11-24 | 浙江大学 | Gene and protein encoded by rice root growth and development control gene OsSPR1 |
| CN102242136A (en) * | 2011-04-26 | 2011-11-16 | 重庆大学 | Gene influencing root system development and yield of rice and application of gene |
Non-Patent Citations (1)
| Title |
|---|
| LIU,X.ET AL.: "GenBank: CT833201.1 Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI016E11, full insert sequence", 《GENBANK》, 8 April 2008 (2008-04-08) * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105463010A (en) * | 2014-09-05 | 2016-04-06 | 中国科学院植物研究所 | Application of SSR gene in regulating and controlling growth and development of roots of plants |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102851280B (en) | 2014-12-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109055399B (en) | Gene sequence related to flavone composition in scutellaria baicalensis and application thereof | |
| CN105087640B (en) | Adjust gene and its application of vegetable seeds development | |
| CN102234646B (en) | Promoter SbUbi1, preparation method and application thereof | |
| CN104745616B (en) | The arthrobacterium and its construction method of a kind of inosine dehydrogenase gene deficiency and application | |
| CN102250949B (en) | Application of rice miR166 in enhancing plant cadmium stress tolerance | |
| CN104480120B (en) | Plant salt tolerance related gene PpSIG2 and its encoding proteins and application | |
| CN102851280B (en) | RNA (ribonucleic acid) and application of gene for generating RNA in regulating development of rice root system | |
| CN107653249A (en) | A kind of barley Calmodulin gene HvCAM1 and its salt tolerant application | |
| CN110791487A (en) | Rice receptor kinase gene LOC _ Os11g47290, and coding protein and application thereof | |
| CN102864146A (en) | Application of ath-eTM160 in inhibiting functions of microRNA160 | |
| CN103146745B (en) | Plant RNA (Ribose Nucleic Acid) interference vector for inhibiting lignin from synthesizing, and construction method and application of plant RNA interference vector | |
| CN106434692A (en) | Applications of rice OsPCF7 gene in culturing high-tillering rice varieties | |
| CN102517284A (en) | Promoter miR390 and applications thereof | |
| CN102952821B (en) | Plant expression vector of alfalfa malic acid channel protein gene MsALMT1, and applications thereof | |
| CN102206640B (en) | Promoter SbUbi2, its preparation method and use | |
| CN103014023B (en) | Haynaldia villosa metal transport protein gene, protein coded by haynaldia villosa metal transport protein gene and application of haynaldia villosa metal transport protein gene | |
| CN103923917B (en) | MicroRNA444a or its encoding gene are in the application regulating in Salt Resistance of Rice | |
| CN102453718B (en) | Plant bidirectional promoter BIGDB2 | |
| CN104560998B (en) | A kind of albumen specific promoter and its application | |
| CN103614378B (en) | A kind of promotor OsP002, preparation method and application thereof | |
| CN103665128A (en) | Protein related with heat resistance of plants as well as encoding gene and application of protein | |
| CN101792764B (en) | Promoter BgIosP 525 and preparation method and application thereof | |
| CN110734911B (en) | Application of miR159b in regulation and control of rice bacterial leaf blight resistance | |
| CN102453717B (en) | Plant bidirectional promoter BIGDB3 | |
| CN102676539B (en) | WPGS5 or WPGS6 gene of eucalyptus and function of controlling and increasing plant biomass through overexpression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |