CN102234646B - Promoter SbUbi1, preparation method and application thereof - Google Patents
Promoter SbUbi1, preparation method and application thereof Download PDFInfo
- Publication number
- CN102234646B CN102234646B CN201010156932.7A CN201010156932A CN102234646B CN 102234646 B CN102234646 B CN 102234646B CN 201010156932 A CN201010156932 A CN 201010156932A CN 102234646 B CN102234646 B CN 102234646B
- Authority
- CN
- China
- Prior art keywords
- rice
- promotor
- anhui
- nucleotide sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the field of plant molecular biology, and relates to a promoter, especially a promoter of a plant such as saccharine sorghum BT*623, and a preparation method and applications of the promoter. The promoter in the invention has a nucleotide sequence represented by SEQ ID NO: 1, or has a nucleotide sequence, which is functioned as a promoter, selected from the following derivatives: (1) a nucleotide sequence hybridized with the nucleotide sequence represented by SEQ ID NO: 1 under a high stringent condition; (2) a nucleotide sequence obtained after the nucleotide sequence represented by SEQ ID NO: 1 is processed through substitution, deletion and addition modifications of one ore more bases; and (3) a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence represented by SEQ ID NO: 1. The invention also relates to the preparation method of the promoter, and applications of the promoter in the controlling of plant genetic expression and paddy breeding.
Description
Technical field
The invention belongs to molecular biology of plants field, relate to a kind of promotor, the particularly kind of plant promotor of sweet sorghum for example, and the Preparation method and use of described promotor.
Background technology
Promotor is an integral part of gene, is usually located at structure gene 5 ' end upstream, is the section of DNA sequence of RNA polymerase identification, combination and transcriptional start.Promotor can instruct holoenzyme (holoenzyme) with template correct combination, activation RNA polymerase, and promotor gene is transcribed, thus controlling gene is expressed the initial time of (transcribing) and the degree of expression.In transgenic plant, promotor is one of important factor affecting transgene expression efficiency, and selecting high efficiency promotor is the key of high-efficient expression foreign gene.
According to the transcriptional profile of promotor, can be divided into 3 classes: constitutive promoter, tissue or organ specific promoters and inducible promoter.So-called constitutive promoter refers to that the genetic expression of different tissues organ and etap does not have notable difference, thereby is referred to as constitutive promoter under constitutive promoter regulation and control.
A kind of constitutive promoter of widespread use is at present CaMV35S, it all produces the expression of greater efficiency in monocotyledons and dicotyledons, but Ajith Anand etc. proceeds to wheat by rice chitinase gene chitinase, while finding to use CaMV35S as promotor, the plant proceeding to during to the s-generation chitinase all show gene silencing, and use corn ubiquitin Ubiquitin promotor, when the 4th generation, the expression amount of this gene is large (AjithAnand etc. still, Plant Biotechnology Journal, 2003 (1): 241-251).
People pay much attention to the constitutive promoter from plant clone itself.For example ubiquitin (Ubiquitin) and the isogenic promotor of Actin muscle (Actin) are cloned.By these promotors, replace CaMV 35S promoter, can more effectively in plant, drive transcribing of foreign gene.
Ubiquitin (Ubiquitin, Ubi) promotor is extensively present in eukaryote, chronicity in reinforcing gene expression, there is remarkable efficacy the aspects such as stability, and, the factor such as methylation low, stabilization characteristics of genetics high with starting efficiency and the (Xie Wei that gains great popularity, happy super silver-colored. SanXia University's journal, 2007,29 (2): 176-179).
Ubi promotor can effectively promote the high efficient expression of long-term stability of foreign gene, has now had a lot of Ubi promotors to be applied in monocotyledons and dicotyledons.And Ubi promotor is compared with coming from no, ocs, the mas of T-DNA and coming from the promotors such as viral CaMV35S, CsVMV, has higher levels of transcriptional regulation.Guo Dianjing etc. (Acta Genetica Sinica, 1999,26 (2): 168-173) find in transgenic wheat callus, Ubi promotor most effective, be the 4-5 of CaMV35S promotor doubly.(the Gene such as Genschik, 1994, the promoter sequence that 148:195-202) separation is obtained to tobacco ubiquitin gene Ubi.U4 imports and in transgene tobacco, to start GUS and express, and result shows that expression amount that Ubi.U4 promotor starts gus gene is 7 times of CaMV35S.
Along with the development of plant genetic engineering, people no longer meet a specific foreign gene are proceeded to recipient plant, but want the specific and expression efficiently of foreign gene.Exogenous gene expression quantity not sufficient can not get the major reason of desirable transgenic plant often, and promotor determining aspect genetic expression to play a key effect (Hou Bingkai etc. heredity, 2001,23 (5): 492-497).Utilize Ubi promotor lasting and high-caliber transcriptional regulation in cell paste, be integrated in the carrier of additive type, can obtain high-caliber expression system, thereby in transgenic plant, ubiquitin promoter there is huge application potential.
At present, from a lot of ubiquitin genes, separation obtains promoter sequence, comprising: the Ubi-1 promotor in Maize genome, paddy rice ubiquitin RUBQ2 promotor, Arabidopis thaliana ubiquitin promoter, Sunflower Receptacle ubiquitin UbB1 promotor, tobacco ubiquitin Ubi.U4 promotor, potato ubiquitin Ubi7 promotor, tomato ubiquitin Ubi1-1 promotor, barley ubiquitin Mub1 promotor etc.Wherein, corn ubiquitin Ubi-1 promotor has been widely used in the monocotyledonss such as corn, wheat, paddy rice, and paddy rice ubiquitin RUBQ2 promotor also has more application in paddy rice and sugarcane.
Summary of the invention
In order to provide a kind of new instrument and selection to regulating and controlling destination gene expression in plant research, the inventor, by the genomic further investigation of sweet sorghum, provides a kind of new ubiquitin promoter, and described promotor can be used in destination gene expression in regulating plant.
One aspect of the present invention, provides the plant promoter of nucleotide sequence shown in a kind of SEQ of having ID NO:1.In the present invention, the concrete base sequence length of described promotor is 2157 bases, as shown in SEQ ID NO:1:
GCTTAGGGACCCGTGTCTTGTGTGTTGCAGACCAAAAAATTTAGAAAGCATCTAAACACCTATTTGAATGTAAAGTTTACAGCCAAAAGTTTTAGGATGTAAAGATTTGGGATCTAAAAGTAGTCATTAGGAAATAACACGTTAGAGAGAGAGAGTAGATCTTCTTATTGGTTTCTCATGCACTAATCGAACCAATCACTGGACCACTTGAACCAAACTTTATCACATTGAACTTTGTCAGTTCAGTTCGAACGCAGGACTGGAGCTGCCCTTAAGGCCAATTGCTCAAGATTCATTCAACAATTGAAACATCTCCCATGATTAAATCAGTATAAGGTTGCTATGGTCTTGCTTGACAAAGTTTTTTTTTTGAGGGAATTTCAACTAAATTTTTGAGTGAAACTATCAAATACTGATTTTAAAAATTTTTTATAAAAGGAAGCGCAGAGATAAAAGGCCATCTATGCTACAAAAGTACCCAAAAATGTAATCCTAAAGTATGAATTGCATTTTTTTTGTTTGGACGAAAGGAAAGGAGTATTACCACAAGAATGATATCATCTTCATATTTAGATCTTTTTTGGGTAAAGCTTGAGATTCTCTAAATATAGAGAAATCAGAAGAAAAAAAAACCGTGTTTTGGTGGTTTTGATTTCTAGCCTCCACAATAACTTTGACGGCGTCGACAAGTCTAACGGACACCAAGCAGCGAACCACCAGCGCCGAGCCAAGCGAAGCAGACGGCCGAGACGTTGACACCTTCGGCGCGGCATCTCTCGAGAGTTCCGCTCCGGCGCTCCACCTCCACCGCTGGCGGTTTCTTATTCCGTTCCGTTCCGCCTCCTGCTCTGCTCCTCTCCACACCACACGGCACGAAACCGTTACGGCACCGGCAGCACCCAGCACGGGAGAGGGGATTCCTTTCCCACCGTTCCTTCCCTTTCCGCCCCGCCGCTATAAATAGCCAGCCCCATCCCCAGCTTTTTTCCCCAATCTCATCTCCTCTCTCCTGTTGTTCGGAGCACACGCACAATCCGATCGATCCCCAAATCCCCTTCGTCTCTCCTCGCGAGCCTCGTGGATCCCAGCTTCAAGGTACGGCGATCGATCATCCCCCCTCCTTCTCTCTACCTTCTTTTCTCTAGACTACATCGGATGGCGATCCATGGTTAGGGCCTGCTAGTTTCCCTTCCTGTTTTGTCGATGGCTGCGAGGCACAATAGATCTGATGGCGTTATGACGGCTAACTTGTCATGTTGTTGCGATTTATAGTCCCTTTAGGAGATCAGTTTAATTTCTCGGATGGTTCGAGATCGGTGGTCCATGGTTAGTACCCTAAGATCCGCGCTGTTAGGGTTCGTAGATGGAGGCGACCTGTTCTGATTGTTAACTTGTCAGTACCTGGGAAATCCTGGGATGGTTCTAGCTCGTCCGCAGATGAGATCGATTTCATGATCCTCTGTATCTTGTTTCGTTGCCTAGGTTCCGTCTAATCTATCCGTGGTATGATGTAGATGTTTTGATCGTGCTAACTACGTCTTGTAAAGTTAATTGTCAGGTCATAATTTTTAGCATGCCTTTTTTTTTGTTTGGTTTTGTCTAATTGGGCTGTCGTTCTAGATCAGAGTAGAAGACTGTTCCAAACTACCTGCTGGATTTATTGAACTTGGATCTGTATGTGTGTCACATATCTTCATAAATTCATGATTAAGATGGATTGAAATATCTTTTATCTTTTTGGTATGGATAGTTCTATATGTTGGTGTGGCTTTGTTAGATGTATACATGCTTAGATACATGAAGCAACGTGCTGCTACTGTTTAGTAATTGCTGTTCATTTGTCTAATAAACAGATAAGGATAGGTATTTATGTTGCTGTTGGTTTTGCTGGTACTTTGTTGGATACAAATGCTTCAATACAGAAAACAGCATGCTGCTACGATTTACCATTTATCTAATCTTATCATATGTCTAATCTAATAAACAAACATGCTTTTAAATTATCTTCATATGCTTGGATGATGGCATACACAGCGGCTATGTGTGGTTTTTTAAATACCCAGCATCATGGGCATGCATGACACTGCTTTAATATGCTTTTTATTTGCTTGAGACTGTTTCTTTTGTTTATACTGACCCTTTAGTTCGGTGACTCTT(SEQ ID NO：1)
In the present invention, the promoter sequence shown in SEQ ID NO:1 is called to promotor SbUbi1, also referred to as P604.
This promotor is constitutive promoter, is also ubiquitin promoter, and with the Rice Callus of this promotor and GUS and transgenic paddy rice seedling, after GUS Coloration experiment, it is blue that the root of described Rice Callus and transgenic paddy rice seedling, stem, leaf etc. all become.
Another aspect of the present invention, relates to the promotor having with the sequence of nucleotide sequence complementation shown in SEQ ID NO:1.
Another aspect of the present invention, what also relate to plant promoter shown in SEQ ID NO:1 has a following variant of being selected from of promoter function:
1) under high stringent condition with the nucleotide sequence of the nucleotide sequence hybridization shown in SEQ ID NO:1,
2) nucleotide sequence shown in SEQ ID NO:1 is carried out to the nucleotide sequence that the replacement, disappearance, interpolation of one or more bases are modified, and
3) there is the nucleotide sequence of at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO:1.
When typically, " hybridization conditions " is according to measurement hybridization, " stringency " degree of condition used is classified.It is foundation in conjunction with the melting temperature(Tm) (Tm) of mixture or probe that stringency degree can be take nucleic acid for example.For example, " maximum stringency " typically occurs in about Tm-5 ℃ (lower than 5 ℃ of probe Tm); " high stringency " occurs in the following about 5-10 ℃ of Tm; " medium stringency " occurs in the following about 10-20 ℃ of probe Tm; " low stringency " occurs in the following about 20-25 ℃ of Tm.As an alternative, or further, hybridization conditions can take the salt of hybridization or ionic strength conditions and/or one or the washing of stringency be repeatedly foundation.For example, the extremely low stringency of 6 * SSC=; 3 * SSC=is low to moderate medium stringency; The medium stringency of 1 * SSC=; The high stringency that waits of 0.5 * SSC=.From function, say, can adopt maximum stringency condition to determine and the tight same or nearly tight same nucleotide sequence of hybridization probe; And adopt high stringency condition to determine with this probe, have an appointment 80% or the nucleotide sequence of multisequencing identity more.
For the application that requires highly selective, typically expectation adopts relatively restricted condition to form crossbred, for example, selects relatively low salt and/or high-temperature condition.Sambrook etc. (Sambrook, J. etc. (1989) molecular cloning, laboratory manual, Cold Spring HarborPress, Plainview, N.Y.) provide the hybridization conditions that comprises medium stringency and high stringency.
For ease of explanation, for detection of the suitable moderate stringent condition of polynucleotide of the present invention and other multi-nucleotide hybrid, comprise: with 5 * SSC, 0.5%SDS, the prewashing of 1.0mM EDTA (pH8.0) solution; At 50-65 ℃, in 5 * S SC, hybridize and spend the night; Subsequently with containing 2 of 0.1%SDS *, 0.5 * and 0.2 * SSC each washed twice 20 minutes at 65 ℃.It will be appreciated by those skilled in the art that and can easily operate hybridization stringency, as changed saltiness and/or the hybridization temperature of hybridization solution.For example, in another embodiment, the tight hybridization conditions of suitable height comprises above-mentioned condition, and difference is that hybridization temperature is elevated to for example 60-65 ℃ or 65-70 ℃.
In the present invention, described under high stringent condition with the nucleotide sequence of the nucleotide sequence hybridization shown in SEQ ID NO:1, it has and the same or analogous promoter activity of nucleotide sequence shown in SEQ ID NO:1.
In the present invention, described nucleotide sequence shown in SEQ ID NO:1 is carried out to the nucleotide sequence that the replacement, disappearance, interpolation of one or more bases are modified, refer to respectively or simultaneously and hold at the 5 ' end and/or 3 ' of described nucleotide sequence, and/or sequence inside is for example no more than 2-45, or be no more than 2-30, or be no more than 3-20, or be no more than 4-15, or be no more than 5-10, or be no more than the replacement of using respectively the base that continuous integral number represents one by one, disappearance, the interpolation modification of 6-8.
In the present invention, describedly nucleotide sequence shown in SEQ ID NO:1 is carried out to the nucleotide sequence that replacement as above-mentioned one or more bases, disappearance, interpolation modify have and the same or analogous promoter activity of nucleotide sequence as shown in SEQ IDNO:1.
By a kind of polynucleotide, describe, its nucleotide sequence having for example with the reference nucleotide sequence of SEQID NO:1 at least " identity " of tool 95% refer to: in every 100 Nucleotide of the reference nucleotide sequence of SEQ IDNO:1, the nucleotide sequence of these polynucleotide is except containing the difference that reaches 5 Nucleotide, and the nucleotide sequence of these polynucleotide is identical with reference sequences.In other words, in order to obtain the polynucleotide that nucleotide sequence is identical with reference nucleotide sequence at least 95%, in reference sequences, nearly 5% Nucleotide can be deleted or by another nucleotide substitution; Maybe some Nucleotide can be inserted in reference sequences, the Nucleotide wherein inserting can reach reference sequences total nucleotide 5%; Or the combination of in some Nucleotide, exist deleting, inserting and replacing, wherein said Nucleotide reach reference sequences total nucleotide 5%.These sudden changes of reference sequences can occur in 5 ' or 3 ' terminal position of reference nucleotide sequence, or any place between these terminal positions, they or be dispersed in separately in the Nucleotide of reference sequences, or be present in reference sequences with the group of one or more vicinities.
In the present invention, for determining that the algorithm of sequence identity and sequence similarity percentage ratio is for example BLAST and BLAST 2.0 algorithms, they are described in respectively (1990) J.Mol.Biol.215:403-410 such as (1977) Nucl.Acid.Res.25:3389-3402 such as Altschul and Altschul.For example adopt described in document or default parameters, BLAST and BLAST 2.0 can be for determining nucleotide sequence homology percentage ratio of the present invention.The software of carrying out BLAST analysis can be obtained by the public by state-run biotechnology information center (NCBI).
In the present invention, the nucleotide sequence that nucleotide sequence shown in described and SEQ ID NO:1 has at least 90% sequence identity comprises the polynucleotide sequence substantially same with the disclosed sequence of SEQ ID NO:1, for example, for example, when adopting methods described herein (adopting the BLAST of canonical parameter to analyze), compare with polynucleotide sequence of the present invention and contain at least 90% sequence identity, preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or those sequences of higher sequence identity.
In the present invention, the nucleotide sequence that the nucleotide sequence shown in described and SEQ ID NO:1 has at least 90% sequence identity has and the same or analogous promoter activity of nucleotide sequence shown in SEQ ID NO:1.
In the present invention, described promotor derives from monocotyledons, particularly, for sweet sorghum, for example for sweet sorghum BT * 623, (be preserved in Luojiashan, Wuchang, Wuhan City, Hubei Province Wuhan University preservation center on April 1st, 2010, be Chinese Typical Representative culture collection center (CCTCC), deposit number is CCTCC P201005).
Another aspect of the present invention, also relates to a kind of recombinant vectors that contains promotor of the present invention.Described recombinant vectors can be by being inserted into cloning vector by above-mentioned promotor or expression vector obtains.
The cloning vector that is suitable for building recombinant vectors of the present invention includes but not limited to, such as: pUC18, pUC19, pUC118, pUC119, pMD19-T, pMD20-T, pMD18-T SimpleVecter, pMD19-T Simple Vecter etc.
Be suitable for building expression vector of the present invention and include but not limited to, such as: pBI121, p13W4, pGEM etc.
In one embodiment of the invention, described recombinant vectors is p8+P604 recombinant vectors.
Another aspect of the present invention, also relates to the reconstitution cell of the described recombinant vectors that contains promotor of the present invention.Described reconstitution cell can obtain by the described recombinant vectors that contains promotor of the present invention is converted into host cell.
The host cell that is suitable for building reconstitution cell of the present invention includes but not limited to, such as: agrobacterium tumefaciens cell LBA4404, EHA105, GV3101 etc.
In one embodiment of the invention, described reconstitution cell is restructuring agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105-P604.
Another aspect of the present invention, also relates to a kind of plant callus, and described Transformation of Callus has promotor of the present invention.In one embodiment of the invention, described plant is paddy rice.Described paddy rice includes but not limited to, for example: in spend 9, in spend 10, in spend 11, the Taibei 309, No. 8, Danjiang River, cloud rice No. 2, Shanyou 63, Shan excellent 608, Feng You 22, Guizhou Province excellent 88, II excellent 416, II excellent 107, II excellent 128, II excellent 718, Zhunliangyou 527, No. 1, river agriculture, assorted 0152, Anhui rice 88, Anhui rice 90, Anhui rice 92, Anhui rice 94, Anhui rice 96, Anhui rice 185, Anhui rice 187, Anhui rice 189, Anhui rice 191, Anhui rice 193, Anhui rice 195, Anhui rice 197, Anhui rice 199, Anhui rice 201, Anhui rice 203, Anhui rice 205, Anhui rice 207, and Tianjin former 101 (above-mentioned rice varieties all can purchased from Anhui good fortune company limited of Hui Shang farmers') etc.In another embodiment of the present invention, described paddy rice is fine (the Oryza sativa L.ssp.japonica cv.Nipponbare of Japan, be preserved in Luojiashan, Wuchang, Wuhan City, Hubei Province Wuhan University preservation center on December 18th, 2009, be Chinese Typical Representative culture collection center (CCTCC), deposit number is CCTCC P200910).
Another aspect of the present invention, also relates to a kind of method of preparing promotor of the present invention, comprises the steps:
1) according to the nucleotide sequence shown in SEQ ID NO:1, design pcr amplification primer pair,
2) take sweet sorghum BT * 623 genomic dna is template, uses step 1) in designed pcr amplification primer to carrying out pcr amplification.
Those skilled in the art are known, can according to base complementrity principle, design corresponding pcr amplification primer pair according to object nucleotide sequence to be amplified.In one embodiment of the invention, described pcr amplification primer is to as shown in SEQ ID NO:2 and SEQ ID NO:3.
Another aspect of the present invention, also relates to the method for destination gene expression in a kind of regulating plant, and described method comprises the step with the callus of promotor conversion of plant of the present invention.In one embodiment of the invention, the trans-utilization of described plant callus the reconstitution cell that contains promotor of the present invention.In one embodiment of the invention, in the conversion process of described plant callus, utilized aforesaid restructuring agrobacterium tumefaciens EHA105-P604.In a specific embodiments of the present invention, the callus of described plant is Rice Callus, and particularly, described paddy rice is that Japan is fine.
In the present invention, can adopt plant gene transformation technology that goal gene is inserted in Plant Genome, comprise agrobacterium mediation converted, virus-mediated conversion, microinjection, particle bombardment, via Particle Bombardment Transformation and electroporation etc.This area is known, and agriculture bacillus mediated gene transformation is often used to the gene transformation of monocotyledons and dicotyledons, but other transformation technology also can be used for monocotyledonous gene transformation of the present invention.Certainly, the another kind of method that is suitable for transforming monocots of the present invention is particle bombardment (micro-gold or tungsten particle attached bag are covered the DNA of conversion) embryo callus or embryo's exploitation.The method of the transforming monocots that can also adopt in addition, is protoplast transformation.After gene transformation, adopt general method to screen and regenerate and be integrated with the plant of expressing unit.
In the present invention, can utilize the plant of described promoter regulation destination gene expression to include but not limited to, such as: paddy rice, wheat, corn, millet, sugarcane, sweet sorghum, barley etc.
Another aspect of the present invention, also relates to the application that promotor of the present invention regulates and controls destination gene expression in plant.In one embodiment of the invention, described plant is monocotyledons.In one embodiment of the invention, utilizing the goal gene of promoter regulation of the present invention is GUS.In one embodiment of the invention, described monocotyledons is paddy rice, and described paddy rice is that Japan is fine particularly.
For realizing the object of above-mentioned regulation and control destination gene expression, promotor of the present invention can be with the form application of single copy and/or multiple copied, also can with promotor well known in the prior art and or enhanser coupling.
Another aspect of the present invention, relates to the purposes of promotor of the present invention in rice breeding.Described paddy rice spends 9 for Japan is fine, middle, middlely spend 10, middlely spend 11, the Taibei 309, No. 8, Danjiang River, cloud rice No. 2, Shanyou 63, Shan are excellent 608, Feng You 22, Guizhou Province is excellent 88, II is excellent 416, II is excellent 107, II is excellent 128, II is excellent 718, Zhunliangyou 527, No. 1, river agriculture, assorted 0152, Anhui rice 88, Anhui rice 90, Anhui rice 92, Anhui rice 94, Anhui rice 96, Anhui rice 185, Anhui rice 187, Anhui rice 189, Anhui rice 191, Anhui rice 193, Anhui rice 195, Anhui rice 197, Anhui rice 199, Anhui rice 201, Anhui rice 203, Anhui rice 205, Anhui rice 207, and Tianjin former 101.In one embodiment of the invention, described paddy rice is that Japan is fine.
Promotor of the present invention can become a kind of new promotor, for example, as plant: paddy rice, genetically modified instrument start-up.Promotor of the present invention is owing to being constitutive promoter, also can regulate and control across species the expression of goal gene simultaneously, therefore promotor of the present invention can be various plants breeding and facilitates, as low expressing gene transformation seedlings screening, the breeding research of plant flower organ abortion equimolecular, may shorten greatly the seed selection time of improved seeds.
Promotor of the present invention can be widely used in plants such as cultivating paddy rice, wheat, corn, millet, sugarcane, sweet sorghum, barley.
The beneficial effect of the invention
The inventor is studied and is obtained a kind of ubiquitin promoter that derives from sweet sorghum by information biology, and adopts biological experiment to verify the function of described promotor P604.This promotor has the effect across species regulation and control destination gene expression, is constitutive promoter.Particularly, described promotor can regulate and control gus gene and expresses in paddy rice: at the callus of paddy rice, can regulate and control the high efficient expression of gus gene in the root of Transgenic Rice seedling, stem, leaf.
Accompanying drawing explanation
Fig. 1 is the pcr amplification detected result of promotor P604, wherein, swimming lane M:200bp DNALadder Marker, the size of the band of the numeral Ladder Marker pointed in its left side, unit is all bp; Swimming lane 1:PCR amplified production.
Fig. 2 is for building the pCAMBIA-1301 plasmid schematic diagram of p8 plasmid.
Fig. 3 is the schematic diagram of multiple clone site and GUS Sequence in p8 plasmid schematic diagram.
Fig. 4 is p8 plasmid schematic diagram.
Fig. 5 is the GUS coloration result of the Rice Callus through transforming.Wherein, the Rice Callus (left side) being transformed by the restructuring agrobacterium tumefaciens p8+P604 with promotor P604 sequence of the present invention presents blueness after GUS dyeing; Rice Callus (contrast, the right side) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
Fig. 6 is the GUS coloration result of the transgenic paddy rice seedling through transforming.Wherein, the rice seedlings (left side) being transformed by the restructuring agrobacterium tumefaciens p8+P604 with promotor P604 sequence of the present invention is after GUS dyeing, and its root, stem, leaf present blueness; The rice seedlings transforming without the restructuring agrobacterium tumefaciens p8 of promoter sequence of the present invention (contrast, the right side) color of its root, stem, leaf after GUS dyeing does not change.
Embodiment
Below in conjunction with embodiment, embodiment of the present invention are described in detail, but it will be understood to those of skill in the art that the following example is only for the present invention is described, and should not be considered as limiting scope of the present invention.Unreceipted concrete technology or condition person in embodiment, according to the described technology of the document in this area or condition (such as with reference to works such as J. Pehanorm Brookers, the < < molecular cloning experiment guide > > that Huang Peitang etc. translate, the third edition, Science Press) or carry out according to product description.The unreceipted person of production firm of agents useful for same or instrument, being can be by the conventional products of commercial acquisition.
the pcr amplification of embodiment 1:P604 promoter fragment and pMD18-T+P604 restructuring are carried
the structure of body
pcr amplification
Use plant genome DNA to extract test kit (TIANGEN plant genes group DNA extraction test kit; catalog number (Cat.No.): the genomic dna that DP320-02) extracts sweet sorghum BT * 623 seed; sequence according to this promotor in sweet sorghum BT * 623gDNA; at head and the tail, design one couple of PCR specificity amplification primer (upstream primer F1 respectively; add restriction enzyme site KpnI and protection base; downstream primer R1, adds restriction enzyme site Pst I and protection base).The gDNA of sweet sorghum BT * 623 of said extracted of take is template, uses high-fidelity Ex Taq (TaKaRa, DRR100B) polysaccharase to carry out pcr amplification.As shown in table 1.
The PCR system of table 1 gene promoter amplification
Pcr amplification program is: 94 ℃ of denaturation 5min, and then with 94 ℃ of sex change 45s, 55 ℃ of annealing 50s, 72 ℃ are extended 90s, carry out 35 reaction cycle, and last 72 ℃ are extended 7min.
Wherein, upstream primer F1:GGggtaccGCTTAGGGACCCGTGTCTTGT (SEQ ID NO:2), wherein lowercase represents Kpn I restriction enzyme site.
Downstream primer R1:GCctgcagAAGAGTCACCGAACTAAAGGGT (SEQ ID NO:3), wherein lowercase represents Pst I restriction enzyme site.
Pcr amplification product is separated through 1.0% agarose gel electrophoresis, and obtaining size is the band of 2173bp (Fig. 1), uses TIANGEN sepharose DNA to reclaim test kit (catalog number (Cat.No.): DP209-03) carry out purifying recovery.
the structure of pMD18-T+P604 recombinant vectors
To carry out T/A clone (pMD18-T plasmid, TaKaRa, D103A) as pcr amplification product obtained above, and transform intestinal bacteria, picking positive colony order-checking (as shown in SEQ ID NO:4), proves accurately.
Wherein, T/A clone's condition of contact is as follows:
T/A linked system: 10 μ l
pMD18-T 1μl
2*solution I 5μl
Pcr amplification product (recovery Insert Fragment) 10ng～20ng, fixed according to its concentration
DdH
2o polishing to 10 μ l
In 16 ℃, at energy-conserving intelligent thermostatic bath, (the new sesame in Ningbo SDC-6) more than middle connection 8h, obtains pMD18-T+P604 recombinant vectors.Product after above-mentioned connection is transformed to intestinal bacteria as follows:
(Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences provides from Ultralow Temperature Freezer, to take out the competent cell 100 μ l DH5 α that prepare according to Calcium Chloride Method shown in < < molecular cloning experiment guide > > (third edition, Science Press), or can be from for example: the raw work in Shanghai is buied), after melting on ice, add the as above connection product of gained of 10 μ l, it is pMD18-T+P604 recombinant vectors, stir evenly gently, ice bath 30min, 42 ℃ of heat shock 60s, ice bath 5min, add the SOC substratum of 4 ℃ of precoolings of 600 μ l (specifically to fill a prescription and refer to < < molecular cloning experiment guide > >, the third edition, Science Press), 37 ℃ of 220rpm recovery 45min, the centrifugal 30s of 8000rpm, remove supernatant, leave and take 150 μ l, with the mixture after the remaining resuspended precipitation of 150 μ l supernatant, blow gently even, granulated glass sphere coating LB (kantlex) is dull and stereotyped, and (concrete formula refers to < < molecular cloning experiment guide > >, the third edition, Science Press), be inverted for 37 ℃ and cultivate 16h～24h.The recombination bacillus coli that acquisition contains pMD18-T+P604 cloning vector, called after DH5 α-P604.Shenzhen Huada Genetic Technology Co., Ltd checks order to the P604 in pMD18-T+P604 cloning vector, and result is as follows:
GG
GGTACC GTGTTGCAGACCAAAAAATTTAGAAAGCATCTAAACACCTATTTGAATGTAAAGTTTACAGCCAAAAGTTTTAGGATGTAAAGATTTGGGATCTAAAAGTAGTCATTAGGAAATAACACGTTAGAGAGAGAGAGTAGATCTTCTTATTGGTTTCTCATGCACTAATCGAACCAATCACTGGACCACTTGAACCAAACTTTATCACATTGAACTTTGTCAGTTCAGTTCGAACGCAGGACTGGAGCTGCCCTTAAGGCCAATTGCTCAAGATTCATTCAACAATTGAAACATCTCCCATGATTAAATCAGTATAAGGTTGCTATGGTCTTGCTTGACAAAGTTTTTTTTTTGAGGGAATTTCAACTAAATTTTTGAGTGAAACTATCAAATACTGATTTTAAAAATTTTTTATAAAAGGAAGCGCAGAGATAAAAGGCCATCTATGCTACAAAAGTACCCAAAAATGTAATCCTAAAGTATGAATTGCATTTTTTTTGTTTGGACGAAAGGAAAGGAGTATTACCACAAGAATGATATCATCTTCATATTTAGATCTTTTTTGGGTAAAGCTTGAGATTCTCTAAATATAGAGAAATCAGAAGAAAAAAAAACCGTGTTTTGGTGGTTTTGATTTCTAGCCTCCACAATAACTTTGACGGCGTCGACAAGTCTAACGGACACCAAGCAGCGAACCACCAGCGCCGAGCCAAGCGAAGCAGACGGCCGAGACGTTGACACCTTCGGCGCGGCATCTCTCGAGAGTTCCGCTCCGGCGCTCCACCTCCACCGCTGGCGGTTTCTTATTCCGTTCCGTTCCGCCTCCTGCTCTGCTCCTCTCCACACCACACGGCACGAAACCGTTACGGCACCGGCAGCACCCAGCACGGGAGAGGGGATTCCTTTCCCACCGTTCCTTCCCTTTCCGCCCCGCCGCTATAAATAGCCAGCCCCATCCCCAGCTTTTTTCCCCAATCTCATCTCCTCTCTCCTGTTGTTCGGAGCACACGCACAATCCGATCGATCCCCAAATCCCCTTCGTCTCTCCTCGCGAGCCTCGTGGATCCCAGCTTCAAGGTACGGCGATCGATCATCCCCCCTCCTTCTCTCTACCTTCTTTTCTCTAGACTACATCGGATGGCGATCCATGGTTAGGGCCTGCTAGTTTCCCTTCCTGTTTTGTCGATGGCTGCGAGGCACAATAGATCTGATGGCGTTATGACGGCTAACTTGTCATGTTGTTGCGATTTATAGTCCCTTTAGGAGATCAGTTTAATTTCTCGGATGGTTCGAGATCGGTGGTCCATGGTTAGTACCCTAAGATCCGCGCTGTTAGGGTTCGTAGATGGAGGCGACCTGTTCTGATTGTTAACTTGTCAGTACCTGGGAAATCCTGGGATGGTTCTAGCTCGTCCGCAGATGAGATCGATTTCATGATCCTCTGTATCTTGTTTCGTTGCCTAGGTTCCGTCTAATCTATCCGTGGTATGATGTAGATGTTTTGATCGTGCTAACTACGTCTTGTAAAGTTAATTGTCAGGTCATAATTTTTAGCATGCCTTTTTTTTTGTTTGGTTTTGTCTAATTGGGCTGTCGTTCTAGATCAGAGTAGAAGACTGTTCCAAACTACCTGCTGGATTTATTGAACTTGGATCTGTATGTGTGTCACATATCTTCATAAATTCATGATTAAGATGGATTGAAATATCTTTTATCTTTTTGGTATGGATAGTTCTATATGTTGGTGTGGCTTTGTTAGATGTATACATGCTTAGATACATGAAGCAACGTGCTGCTACTGTTTAGTAATTGCTGTTCATTTGTCTAATAAACAGATAAGGATAGGTATTTATGTTGCTGTTGGTTTTGCTGGTACTTTGTTGGATACAAATGCTTCAATACAGAAAACAGCATGCTGCTACGATTTACCATTTATCTAATCTTATCATATGTCTAATCTAATAAACAAACATGCTTTTAAATTATCTTCATATGCTTGGATGATGGCATACACAGCGGCTATGTGTGGTTTTTTAAATACCCAGCATCATGGGCATGCATGACACTGCTTTAATATGCTTTTTATTTGCTTGAGACTGTTTCTTTTGTTTATACTG
CTGCAGGC(SEQ ID NO：4)
In sequence above, with underscore be restriction enzyme site (kpn I+Pst I), with square frame is primer sequence.
Sequencing result shows, in the pMD18-T+P604 cloning vector of acquisition, P604 promoter sequence is correct.
embodiment 2: the structure of carrier-p8+P604 recombinant vectors
According to the little extraction reagent kit of the common plasmid of TIANGEN (catalog number (Cat.No.): operational manual DP103-03), the conversion building from embodiment 1 has bacillus coli DH 5 alpha-P604 of promotor P604 extracts the cloning vector pMD18-T+P604 with P604 promoter sequence of the present invention; After purifying, with corresponding restriction enzyme Kpn I (NEB) and Pst I (NEB), carry out enzyme and cut, reclaim corresponding promotor Insert Fragment, and connect by the carrier large fragment reclaiming after identical digestion with restriction enzyme with p8 plasmid respectively.
Gained is connected to product p8+P604 recombinant vectors to be transformed according to the < < molecular cloning experiment guide > > (third edition, Science Press) the competent cell DH5 α that shown in prepared by Calcium Chloride Method, be inverted for 37 ℃ and cultivate 16～24h, son to be transformed grows after bacterium colony, and picking mono-clonal carries out PCR detection and enzyme is cut evaluation.
p8 plasmid construction
The p8 plasmid using in the present invention is that (Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences provides by pCAMBIA-1301 plasmid; Or can buy from for example Shanghai Guo Rui Gene Tech. Company Limited, the primary source of the pCAMBIA-1301 plasmid of the said firm is The CAMBIABios (biological open source) Licensee, Australia) transform in the following manner and build, be described as follows:
With Kpn I/Nco I (NEB) double digestion plasmid pCAMBIA-1301 (referring to Fig. 2), reclaim large fragment.According to synthetic following sequence: the GGTACCAAGCTTACTAGTCCTGCAGGTCTAGAG GATCCGTCGACCATGG (SEQ ID NO:5) (restriction enzyme site comprising is Kpn I/Hind III/Spe I/Sbf I/Pst I/Xba I/BamH I/Sa II/Nco I) of adopted restriction endonuclease sites, with reclaiming after Kpn I/Nco I double digestion, (Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences provides with transforming top10 cell after above-mentioned reclaimed large fragment is connected; Or can be from for example: Beijing Suo Laibao Science and Technology Ltd. buys).With primer GCTTCCGGCTCGTATGTTGT (SEQ ID NO:6)/GAGTCGTCGGTTCTGTAAC (SEQID NO:7) screening transformant, by PCR detection method, the transformant that is 350bp with amplified fragments is the transformant (referring to Fig. 4) of the p8 plasmid that contains multiple clone site that needs build and GUS sequence.
Length 2353 bases of the multiple clone site in described p8 plasmid and GUS sequence, as shown in SEQID NO:8 (referring to Fig. 3):
GTTGGCAAGCTGCTCTAGCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTAT
GTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTAC
GAG CTC AAGCTT C G GGATCC C (SEQ ID NO：8)
As above constructed p8 plasmid in the present invention shown in sequence, EcoRI/Sac I/Kpn I/Hind III/Spe I/Sbf I/Pst I/Xba I/BamH I/Sa II/NcoI restriction enzyme site in its multiple clone site is respectively with adding frame and underscore represents, screening transformant primer GCTTCCGGCTCGTATGTTGT/GAGTCGTCGGTTCTGTAAC (being SEQ ID NO:6 and 7) used represents with double underline, GUS sequence represents by italic, and its intron sequences adds shading by italic respectively and illustrates.
the structure of recombinant vectors p8+P604
According to restriction enzyme Kpn I (NEB) and Pst I (NEB) operation instructions, according to resulting cloning vector pMD18-T+P604 in following condition Processing Example 1, and the p8 plasmid building as mentioned above.
Wherein, the enzyme tangent condition of cloning vector pMD18-T+P604 and p8 plasmid is as follows:
Enzyme is cut system: 50 μ l
Sterilized water 34.8 μ l
10*buffer H 5μl
Kpn I 0.1μl(10U)
Pst I 0.1μl(10U)
Cloning vector pMD18-T+P604 or p8 plasmid 10 μ l (< 1000ng)
Use TIANGEN sepharose DNA to reclaim test kit (catalog number (Cat.No.): DP209-03) reclaim respectively the p8 plasmid of cutting through enzyme, and promotor P604 Insert Fragment, according to T4 ligase enzyme (TaKaRa, D2011A) operation instructions, according to following condition, connect:
Linked system: 10 μ l
10*T4buffer 1μl
P8 plasmid 1 μ l (20ng) after enzyme is cut
The promotor P604 Insert Fragment 10～20ng reclaiming, determines according to its concentration
Sterilized water polishing to 9.5 μ l
T4ligase(TaKaRa，D2011A) 0.5μl
T4buffer melts on ice, the about 20ng of p8 plasmid vector add-on after enzyme is cut, and the P604 fragment in the present invention adds 10ng.In 16 ℃, at energy-conserving intelligent thermostatic bath, (the new sesame in Ningbo, SDC-6) more than middle connection 8h.
The competent cell DH5 α that 100 μ l Calcium Chloride Method are made takes out from Ultralow Temperature Freezer, after melting, adds the connection product above 10 μ l on ice, stir evenly gently ice bath 30min, 42 ℃ of heat shock 60s, ice bath 5min, adds the SOC of 4 ℃ of precoolings of 600 μ l, 37 degree 220rpm recovery 45min, the centrifugal 30s of 8000rpm, remove supernatant, leave and take 150 μ l, blow gently even, granulated glass sphere coating LB (kan), is inverted for 37 ℃ and cultivates 16～24h.Obtain recombinant vectors p8+P604.
Take F1 (being SEQ ID NO:2) and R1 (being SEQ ID NO:3) respectively as primer pair gained recombinant vectors p8+P604 carries out PCR detection, to confirm in gained recombinant vectors p8+P604, contain required promotor P604.By Kpn I/Pst I enzyme, cut screening and contain recombinant vectors p8+P604 transformant.
the preparation of embodiment 3 restructuring agrobacterium tumefaciens EHA105-P604 cells
Method builds as described in Example 2 p8+P604 recombinant vectors and p8 plasmid are in contrast transformed respectively to the (third edition according to < < molecular cloning experiment guide > >, agrobacterium tumefaciens EHA105 prepared by the method for calcium chloride Science Press) (is preserved in Luojiashan, Wuchang, Wuhan City, Hubei Province Wuhan University preservation center on December 24th, 2009, it is Chinese Typical Representative culture collection center (CCTCC), deposit number is CCTCC M 209315) competent cell, concrete grammar is as follows:
Agrobacterium tumefaciens competent cell EHA105 is taken out in Ultralow Temperature Freezer, as for thawing on ice.After thawing, the p8+P604 recombinant vectors and p 8 plasmids and the p8 empty carrier in contrast that add respectively 5 μ l, mix gently, ice bath 10min, put into the freezing 5min of liquid nitrogen, 37 ℃ of 5min that thaw, the LB liquid nutrient medium that adds 800 μ l normal temperature, 28 ℃ of 160rpm recovery 3h, the centrifugal 30s of 8000rpm, sucks supernatant, leaving 200 μ l blows even, coat and be added with (50mg/lKan, 10mg/l Rif specifically fill a prescription referring to table 4) on the dual anti-YM culture medium flat plate of kan-rif (kantlex-Rifampin).Be inverted for 28 ℃ and cultivate 2-3 days.
Take F1 (being SEQ ID NO:2) and R1 (being SEQ ID NO:3) carries out PCR detection and cuts screening transformant by Kpn I/Pst I enzyme as primer.
What pcr amplification went out that about 2173bp band and enzyme cut out about 2159bp band is the restructuring agrobacterium tumefaciens of recombinant vectors p8+P604.
In the present invention, according to the restructuring agrobacterium tumefaciens with recombinant vectors p8+P604 obtaining as aforesaid method, called after restructuring agrobacterium tumefaciens EHA105-P604.
According to the method for the invention, the restructuring of the contrast with the p8 plasmid agrobacterium tumefaciens obtaining, called after restructuring agrobacterium tumefaciens EHA105-p8.
embodiment 4: the induction of Rice Callus and conversion
Inducing paddy rice callus in accordance with the following steps, and with restructuring agrobacterium tumefaciens EHA105-P604 and restructuring agrobacterium tumefaciens EHA105-p8, transform described callus respectively.
1) the fine seed of paddy rice Japan is shelled, 70% ethanol surface sterilization 30s, then with the clorox sterilization 30min of available chlorine 1.5%, during acutely shake, after sterilization, with aqua sterilisa, clean 5 times; Seed after sterilization is placed in to N6D substratum (specifically filling a prescription referring to table 2) upper, with sealed membrane, seals; 29.5 ℃ of illumination cultivation 3～4 weeks;
2) choose the callus (yellow-white, dry, diameter 1～3mm) of active growth, on new N6D substratum, 29.5 ℃ of illumination cultivation are 3 days;
3) the difference picking single bacterium colony of restructuring agrobacterium tumefaciens (restructuring agrobacterium tumefaciens EHA105-P604 or restructuring agrobacterium tumefaciens EHA105-p8) as constructed in embodiment 3, in adding microbiotic (50mg/l Kan, 10mg/l Rif) upper streak culture 3 days of YM substratum (specifically filling a prescription referring to table 3, table 4), 28 ℃ of culture temperature; The above-mentioned restructuring agrobacterium tumefaciens of scraping is placed in the AS (Acetosyringone that has added 30 μ l 100mM respectively, Syringylethanone) in 30ml AAM substratum (specifically filling a prescription referring to table 5), gentle resuspended described restructuring agrobacterium tumefaciens cell (restructuring agrobacterium tumefaciens EHA105-P604 or restructuring agrobacterium tumefaciens EHA105-p8);
4) callus of succeeding transfer culture is placed in to sterilizing culture dish; By pouring in culture dish as the restructuring agrobacterium tumefaciens suspension of step 3 preparation, callus is immersed to 15min;
5) outwell restructuring agrobacterium tumefaciens suspension, callus is sopped up to unnecessary liquid with sterilizing thieving paper; On N6-AS substratum (formula is referring to table 6), put a sterilizing filter paper, add 1ml as the above-mentioned AAM substratum containing AS, callus is transferred on filter paper; Sealing culture dish, 28 ℃ of dark 48～60h that cultivate;
6) infected callus is placed in to 50ml sterile tube, with aqua sterilisa, shakes cleaning, until supernatant liquor becomes clarification; By callus be soaked in containing in the sterilized water of 500mg/l Pyocianil (Carb) with kill restructuring agrobacterium tumefaciens; With sterilizing thieving paper, remove moisture unnecessary on callus, then transfer them on the N6-AS substratum containing 1mg/l hygromycin B (HmB) and 50mg/l Carb; With sealed membrane, seal culture dish, 29.5 ℃ of illumination cultivation 3～4 weeks.
embodiment 5: the expression of the GUS in Rice Callus
For detecting the expression of goal gene GUS in the Rice Callus through transforming described in embodiment 4, according to Chen S Y etc. at Journal of Integrative Plant Biology, 2008,50 (6): the method described in 742-751, to dyeing with the Rice Callus that restructuring agrobacterium tumefaciens EHA105-P604 or restructuring agrobacterium tumefaciens EHA105-p8 transform respectively.
The formula of GUS staining fluid (1ml): 610 μ l 0.2M Na
2hPO
4solution (pH=7.0); 390 μ l 0.2M NaH
2pO
4solution and 10 μ l 0.1M X-gluc.
To with the Rice Callus that restructuring agrobacterium tumefaciens EHA105-P604 or restructuring agrobacterium tumefaciens EHA105-p8 transform, be immersed in GUS staining fluid respectively, 37 ℃ of insulations are blue to occurring, take pictures, result as shown in Figure 5, after the Rice Callus of the restructuring Agrobacterium-Mediated Transformation of the p8+P604 recombinant vectors through containing promotor (Fig. 5 is left) is dyed, present blueness, through not containing Rice Callus (in contrast, Fig. 5 is right) color after GUS dyeing of the p8 plasmid restructuring Agrobacterium-Mediated Transformation of promotor, do not change.Result demonstration, P604 promotor of the present invention is expressed and is had regulating and controlling effect gus gene.
embodiment 6: the expression of GUS in transgenic paddy rice seedling
The callus obtaining in embodiment 4 is transferred to MS-R division culture medium (specifically filling a prescription in Table 7) the differentiation seedling containing 50mg/l hygromycin B (HmB); With sealed membrane, seal culture dish, 29.5 ℃ of illumination cultivation 3-4 weeks; When growing to 3-4cm, seedling transfers to 1/2MS root media (specifically filling a prescription referring to the table 8) screening of taking root containing 50mg/l hygromycin B (HmB).
The GUS dyeing course of transgenic paddy rice seedling is with the dyeing course of callus in embodiment 5.Result as shown in Figure 6, after the root of the rice seedlings of the restructuring Agrobacterium-Mediated Transformation of the p8+P604 recombinant vectors through containing promotor, stem, leaf (Fig. 6 is left) are dyed, present blueness, through not containing root, stem, leaf (in contrast, Fig. 6 is right) color after GUS dyeing of rice seedlings of the p 8 plasmids restructuring Agrobacterium-Mediated Transformations of promotor, do not change.Result demonstration, P604 promotor of the present invention is expressed and is had regulating and controlling effect gus gene.
The relevant culture medium prescription using in the embodiment of the present invention is described as follows:
About alleged " conventional sterilizing " in substratum, refer to below the sterilizing of following condition: at 121 ℃, vapor sterilization is 20 minutes.
Table 2N6D substratum
With 1N potassium hydroxide, regulate pH value to 5.8, sterilizing according to a conventional method after sealing.
N
6macro mother liquor (20X): saltpetre 56.60g, potassium primary phosphate 8.00g, ammonium sulfate 9.26g, magnesium sulfate 3.70g, calcium chloride 3.32g, distilled water is settled to 1L, and 4 ℃ save backup.
N
6micro mother liquor (1000X): potassiumiodide 0.80g, boric acid 1.60g, manganous sulfate 3.33g, zinc sulfate 1.50g, distilled water is settled to 1L, and 4 ℃ save backup.
Molysite (Fe
2eDTA) stock solution (100X): by 3.73g b diammonium disodium edta (Na
2eDTA2H
2o) and 2.78g FeSO
4.7H
2o dissolves respectively, mixes and uses.With distilled water, be settled to 1000ml, 70 ℃ of temperature are bathed 2h, and cooling rear 4 ℃ of preservations are no more than 1 month.
N
6vITAMIN stock solution (1000X): vitamins B
10.10g, vitamins B
60.05g, nicotinic acid 0.05g, glycine 0.20g, adding distil water is settled to 100ml, filtration sterilization, 4 ℃ of preservations are no more than 1 week.
Table 3YM liquid nutrient medium (containing 50mg/L Kan, 10mg/L Rif):
Table 4YM solid medium (containing 50mg/L Kan, 10mg/L Rif):
Table 5AAM substratum
Add 1N potassium hydroxide and regulate pH value to 5.2, conventional sterilizing.
AAM macro (10X): 2.5g magnesium sulfate heptahydrate (MgSO
47H
2o), 1.5g Calcium dichloride dihydrate (CaCl
22H
2o), 1.33g sodium dihydrogen phosphate dihydrate (NaH
2pO
4.2H
2o), distilled water is settled to 1L, and 4 ℃ save backup.
AAM micro (100X): the mono-water manganous sulfate of 0.7g (MnSO
4h
2o), 0.2g Zinc Sulphate Heptahydrate (ZnSO
47H
2o), 0.075g potassiumiodide (KI), 0.3g boric acid (H
3bO
3), 25mg Sodium Molybdate Dihydrate (Na
2moO
4.2H
2o), 2.5mg cupric sulfate pentahydrate (CuSO
4.5H
2o), 2.5mg CoCL2 6H2O (CoCl
2.6H
2o), distilled water is settled to 1L, and 4 ℃ save backup.
AAM organic (1000X): 0.75g glycine (Glycine), 0.1g nicotinic acid (Nicotinic acid), 0.1g VB
6(Pyridoxine), 1g VB
1(Thiamine), distilled water is settled to 100ml, and 4 ℃ save backup.
Molysite (Fe
2eDTA) stock solution (100X): in Table 2.
Table 6N 6-AS is substratum altogether
Adjust pH to 5.2.
N
6macro mother liquor (20X), N
6micro mother liquor (1000X), molysite (Fe
2eDTA) stock solution (100X), N
6vITAMIN stock solution (1000X): all in Table 2.
Table 7MS-R division culture medium:
Adjust pH value to 5.8, usual manner sterilizing.
MS macro (20X): ammonium nitrate 33.0g, saltpetre 38.0g, potassium primary phosphate 3.4g, magnesium sulfate 7.4g, calcium chloride 8.8g dissolves one by one, then under room temperature, with distilled water, is settled to 1L, 4 ℃ of preservations.
MS micro (1000X): manganous sulfate 16.90g, zinc sulfate 8.60g, boric acid 6.20g, potassiumiodide 0.83g, Sodium orthomolybdate 0.25g, copper sulfate 0.025g, cobalt chloride 0.025g, mentioned reagent is at room temperature dissolved and is settled to 1L with distilled water, 4 ℃ of preservations.
MS VITAMIN stock solution (1000X): vitamins B
10.010g, vitamins B
60.050g, nicotinic acid 0.050g, glycine 0.200g, adding distil water is settled to 100ml, filtration sterilization, 4 ℃ of preservations are no more than 1 week.
Molysite (Fe
2eDTA) stock solution (100X): in Table 2.
Table 81/2MS root media
Adjust pH value to 5.8.
MS macro (20X) is in Table 7.
MS micro (1000X) MS VITAMIN stock solution (1000X) is in Table 7.
Molysite (Fe
2eDTA) stock solution (100X): in Table 2.
Although the specific embodiment of the present invention has obtained detailed description, it will be understood to those of skill in the art that.According to disclosed all instructions, can carry out various modifications and replacement to those details, these change all within protection scope of the present invention.Four corner of the present invention is provided by claims and any equivalent thereof.
Sequence table
<110> Shenzhen Huada Genetic Technology Co., Ltd
<120> promotor SbUbi1, Preparation Method And The Use
<130>IDC100027
<160>8
<170>PatentIn version 3.2
<210>1
<211>2157
<212>DNA
<213> sweet sorghum BT * 623
<400>1
gcttagggac ccgtgtcttg tgtgttgcag accaaaaaat ttagaaagca tctaaacacc 60
tatttgaatg taaagtttac agccaaaagt tttaggatgt aaagatttgg gatctaaaag 120
tagtcattag gaaataacac gttagagaga gagagtagat cttcttattg gtttctcatg 180
cactaatcga accaatcact ggaccacttg aaccaaactt tatcacattg aactttgtca 240
gttcagttcg aacgcaggac tggagctgcc cttaaggcca attgctcaag attcattcaa 300
caattgaaac atctcccatg attaaatcag tataaggttg ctatggtctt gcttgacaaa 360
gttttttttt tgagggaatt tcaactaaat ttttgagtga aactatcaaa tactgatttt 420
aaaaattttt tataaaagga agcgcagaga taaaaggcca tctatgctac aaaagtaccc 480
aaaaatgtaa tcctaaagta tgaattgcat tttttttgtt tggacgaaag gaaaggagta 540
ttaccacaag aatgatatca tcttcatatt tagatctttt ttgggtaaag cttgagattc 600
tctaaatata gagaaatcag aagaaaaaaa aaccgtgttt tggtggtttt gatttctagc 660
ctccacaata actttgacgg cgtcgacaag tctaacggac accaagcagc gaaccaccag 720
cgccgagcca agcgaagcag acggccgaga cgttgacacc ttcggcgcgg catctctcga 780
gagttccgct ccggcgctcc acctccaccg ctggcggttt cttattccgt tccgttccgc 840
ctcctgctct gctcctctcc acaccacacg gcacgaaacc gttacggcac cggcagcacc 900
cagcacggga gaggggattc ctttcccacc gttccttccc tttccgcccc gccgctataa 960
atagccagcc ccatccccag cttttttccc caatctcatc tcctctctcc tgttgttcgg 1020
agcacacgca caatccgatc gatccccaaa tccccttcgt ctctcctcgc gagcctcgtg 1080
gatcccagct tcaaggtacg gcgatcgatc atcccccctc cttctctcta ccttcttttc 1140
tctagactac atcggatggc gatccatggt tagggcctgc tagtttccct tcctgttttg 1200
tcgatggctg cgaggcacaa tagatctgat ggcgttatga cggctaactt gtcatgttgt 1260
tgcgatttat agtcccttta ggagatcagt ttaatttctc ggatggttcg agatcggtgg 1320
tccatggtta gtaccctaag atccgcgctg ttagggttcg tagatggagg cgacctgttc 1380
tgattgttaa cttgtcagta cctgggaaat cctgggatgg ttctagctcg tccgcagatg 1440
agatcgattt catgatcctc tgtatcttgt ttcgttgcct aggttccgtc taatctatcc 1500
gtggtatgat gtagatgttt tgatcgtgct aactacgtct tgtaaagtta attgtcaggt 1560
cataattttt agcatgcctt tttttttgtt tggttttgtc taattgggct gtcgttctag 1620
atcagagtag aagactgttc caaactacct gctggattta ttgaacttgg atctgtatgt 1680
gtgtcacata tcttcataaa ttcatgatta agatggattg aaatatcttt tatctttttg 1740
gtatggatag ttctatatgt tggtgtggct ttgttagatg tatacatgct tagatacatg 1800
aagcaacgtg ctgctactgt ttagtaattg ctgttcattt gtctaataaa cagataagga 1860
taggtattta tgttgctgtt ggttttgctg gtactttgtt ggatacaaat gcttcaatac 1920
agaaaacagc atgctgctac gatttaccat ttatctaatc ttatcatatg tctaatctaa 1980
taaacaaaca tgcttttaaa ttatcttcat atgcttggat gatggcatac acagcggcta 2040
tgtgtggttt tttaaatacc cagcatcatg ggcatgcatg acactgcttt aatatgcttt 2100
ttatttgctt gagactgttt cttttgttta tactgaccct ttagttcggt gactctt 2157
<210>2
<211>29
<212>DNA
<213> artificial sequence
<400>2
ggggtaccgc ttagggaccc gtgtcttgt 29
<210>3
<211>30
<212>DNA
<213> artificial sequence
<400>3
gcctgcagaa gagtcaccga actaaagggt 30
<210>4
<211>2173
<212>DNA
<213> artificial sequence
<400>4
ggggtaccgc ttagggaccc gtgtcttgtg tgttgcagac caaaaaattt agaaagcatc 60
taaacaccta tttgaatgta aagtttacag ccaaaagttt taggatgtaa agatttggga 120
tctaaaagta gtcattagga aataacacgt tagagagaga gagtagatct tcttattggt 180
ttctcatgca ctaatcgaac caatcactgg accacttgaa ccaaacttta tcacattgaa 240
ctttgtcagt tcagttcgaa cgcaggactg gagctgccct taaggccaat tgctcaagat 300
tcattcaaca attgaaacat ctcccatgat taaatcagta taaggttgct atggtcttgc 360
ttgacaaagt tttttttttg agggaatttc aactaaattt ttgagtgaaa ctatcaaata 420
ctgattttaa aaatttttta taaaaggaag cgcagagata aaaggccatc tatgctacaa 480
aagtacccaa aaatgtaatc ctaaagtatg aattgcattt tttttgtttg gacgaaagga 540
aaggagtatt accacaagaa tgatatcatc ttcatattta gatctttttt gggtaaagct 600
tgagattctc taaatataga gaaatcagaa gaaaaaaaaa ccgtgttttg gtggttttga 660
tttctagcct ccacaataac tttgacggcg tcgacaagtc taacggacac caagcagcga 720
accaccagcg ccgagccaag cgaagcagac ggccgagacg ttgacacctt cggcgcggca 780
tctctcgaga gttccgctcc ggcgctccac ctccaccgct ggcggtttct tattccgttc 840
cgttccgcct cctgctctgc tcctctccac accacacggc acgaaaccgt tacggcaccg 900
gcagcaccca gcacgggaga ggggattcct ttcccaccgt tccttccctt tccgccccgc 960
cgctataaat agccagcccc atccccagct tttttcccca atctcatctc ctctctcctg 1020
ttgttcggag cacacgcaca atccgatcga tccccaaatc cccttcgtct ctcctcgcga 1080
gcctcgtgga tcccagcttc aaggtacggc gatcgatcat cccccctcct tctctctacc 1140
ttcttttctc tagactacat cggatggcga tccatggtta gggcctgcta gtttcccttc 1200
ctgttttgtc gatggctgcg aggcacaata gatctgatgg cgttatgacg gctaacttgt 1260
catgttgttg cgatttatag tccctttagg agatcagttt aatttctcgg atggttcgag 1320
atcggtggtc catggttagt accctaagat ccgcgctgtt agggttcgta gatggaggcg 1380
acctgttctg attgttaact tgtcagtacc tgggaaatcc tgggatggtt ctagctcgtc 1440
cgcagatgag atcgatttca tgatcctctg tatcttgttt cgttgcctag gttccgtcta 1500
atctatccgt ggtatgatgt agatgttttg atcgtgctaa ctacgtcttg taaagttaat 1560
tgtcaggtca taatttttag catgcctttt tttttgtttg gttttgtcta attgggctgt 1620
cgttctagat cagagtagaa gactgttcca aactacctgc tggatttatt gaacttggat 1680
ctgtatgtgt gtcacatatc ttcataaatt catgattaag atggattgaa atatctttta 1740
tctttttggt atggatagtt ctatatgttg gtgtggcttt gttagatgta tacatgctta 1800
gatacatgaa gcaacgtgct gctactgttt agtaattgct gttcatttgt ctaataaaca 1860
gataaggata ggtatttatg ttgctgttgg ttttgctggt actttgttgg atacaaatgc 1920
ttcaatacag aaaacagcat gctgctacga tttaccattt atctaatctt atcatatgtc 1980
taatctaata aacaaacatg cttttaaatt atcttcatat gcttggatga tggcatacac 2040
agcggctatg tgtggttttt taaataccca gcatcatggg catgcatgac actgctttaa 2100
tatgcttttt atttgcttga gactgtttct tttgtttata ctgacccttt agttcggtga 2160
ctcttctgca ggc 2173
<210>5
<211>49
<212>DNA
<213> artificial sequence
<400>5
ggtaccaagc ttactagtcc tgcaggtcta gaggatccgt cgaccatgg 49
<210>6
<211>20
<212>DNA
<213> artificial sequence
<400>6
gcttccggct cgtatgttgt 20
<210>7
<211>19
<212>DNA
<213> artificial sequence
<400>7
gagtcgtcgg ttctgtaac 19
<210>8
<211>2353
<212>DNA
<213> artificial sequence
<400>8
gttggcaagc tgctctagcc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat 60
taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt 120
aatgtgagtt agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt 180
atgttgtgtg gaattgtgag cggataacaa tttcacacag gaaacagcta tgaccatgat 240
tacgaattcg agctcggtac caagcttact agtcctgcag gtctagagga tccgtcgacc 300
atggtagatc tgagggtaaa tttctagttt ttctccttca ttttcttggt taggaccctt 360
ttctcttttt atttttttga gctttgatct ttctttaaac tgatctattt tttaattgat 420
tggttatggt gtaaatatta catagcttta actgataatc tgattacttt atttcgtgtg 480
tctatgatga tgatgatagt tacagaaccg acgactcgtc cgtcctgtag aaaccccaac 540
ccgtgaaatc aaaaaactcg acggcctgtg ggcattcagt ctggatcgcg aaaactgtgg 600
aattgatcag cgttggtggg aaagcgcgtt acaagaaagc cgggcaattg ctgtgccagg 660
cagttttaac gatcagttcg ccgatgcaga tattcgtaat tatgcgggca acgtctggta 720
tcagcgcgaa gtctttatac cgaaaggttg ggcaggccag cgtatcgtgc tgcgtttcga 780
tgcggtcact cattacggca aagtgtgggt caataatcag gaagtgatgg agcatcaggg 840
cggctatacg ccatttgaag ccgatgtcac gccgtatgtt attgccggga aaagtgtacg 900
tatcaccgtt tgtgtgaaca acgaactgaa ctggcagact atcccgccgg gaatggtgat 960
taccgacgaa aacggcaaga aaaagcagtc ttacttccat gatttcttta actatgccgg 1020
aatccatcgc agcgtaatgc tctacaccac gccgaacacc tgggtggacg atatcaccgt 1080
ggtgacgcat gtcgcgcaag actgtaacca cgcgtctgtt gactggcagg tggtggccaa 1140
tggtgatgtc agcgttgaac tgcgtgatgc ggatcaacag gtggttgcaa ctggacaagg 1200
cactagcggg actttgcaag tggtgaatcc gcacctctgg caaccgggtg aaggttatct 1260
ctatgaactc gaagtcacag ccaaaagcca gacagagtct gatatctacc cgcttcgcgt 1320
cggcatccgg tcagtggcag tgaagggcca acagttcctg attaaccaca aaccgttcta 1380
ctttactggc tttggtcgtc atgaagatgc ggacttacgt ggcaaaggat tcgataacgt 1440
gctgatggtg cacgaccacg cattaatgga ctggattggg gccaactcct accgtacctc 1500
gcattaccct tacgctgaag agatgctcga ctgggcagat gaacatggca tcgtggtgat 1560
tgatgaaact gctgctgtcg gctttcagct gtctttaggc attggtttcg aagcgggcaa 1620
caagccgaaa gaactgtaca gcgaagaggc agtcaacggg gaaactcagc aagcgcactt 1680
acaggcgatt aaagagctga tagcgcgtga caaaaaccac ccaagcgtgg tgatgtggag 1740
tattgccaac gaaccggata cccgtccgca aggtgcacgg gaatatttcg cgccactggc 1800
ggaagcaacg cgtaaactcg acccgacgcg tccgatcacc tgcgtcaatg taatgttctg 1860
cgacgctcac accgatacca tcagcgatct ctttgatgtg ctgtgcctga accgttatta 1920
cggatggtat gtccaaagcg gcgatttgga aacggcagag aaggtactgg aaaaagaact 1980
tctggcctgg caggagaaac tgcatcagcc gattatcatc accgaatacg gcgtggatac 2040
gttagccggg ctgcactcaa tgtacaccga catgtggagt gaagagtatc agtgtgcatg 2100
gctggatatg tatcaccgcg tctttgatcg cgtcagcgcc gtcgtcggtg aacaggtatg 2160
gaatttcgcc gattttgcga cctcgcaagg catattgcgc gttggcggta acaagaaagg 2220
gatcttcact cgcgaccgca aaccgaagtc ggcggctttt ctgctgcaaa aacgctggac 2280
tggcatgaac ttcggtgaaa aaccgcagca gggaggcaaa caagctagcc accaccacca 2340
ccaccacgtg tga 2353
Claims (12)
1. a promotor, it is the nucleotide sequence shown in SEQ ID NO:1 or the nucleotide sequence complementary with it.
2. a recombinant vectors, is characterized in that, described recombinant vectors contains promotor claimed in claim 1.
3. a method of preparing the promotor described in claim 1, comprises the steps:
1) according to the nucleotide sequence shown in SEQ ID NO:1, design pcr amplification primer pair;
2) take sweet sorghum BT * 623 genomic dna is template, uses step 1) in designed pcr amplification primer to carrying out pcr amplification.
4. method according to claim 3, wherein, step 1), pcr amplification primer is to being SEQ ID NO:2 and SEQ ID NO:3.
5. a method for genetic expression in regulating plant, described method comprises the step with the callus of promotor conversion of plant claimed in claim 1.
6. method according to claim 5, wherein, described callus is Rice Callus.
7. method according to claim 6, wherein, described paddy rice is that Japan is fine.
8. the purposes of promotor claimed in claim 1 destination gene expression in regulating plant, wherein said goal gene is GUS, described plant is paddy rice.
9. purposes according to claim 8, wherein, described paddy rice is that Japan is fine.
10. the purposes of promotor claimed in claim 1 in rice breeding.
11. purposes according to claim 10, wherein, described paddy rice is that Japan is fine, in spend 9, in spend 10, in spend 11, the Taibei 309, No. 8, Danjiang River, cloud rice No. 2, Shanyou 63, Shan excellent 608, Feng You 22, Guizhou Province excellent 88, II excellent 416, II excellent 107, II excellent 128, II excellent 718, Zhunliangyou 527, No. 1, river agriculture, assorted 0152, Anhui rice 88, Anhui rice 90, Anhui rice 92, Anhui rice 94, Anhui rice 96, Anhui rice 185, Anhui rice 187, Anhui rice 189, Anhui rice 191, Anhui rice 193, Anhui rice 195, Anhui rice 197, Anhui rice 199, Anhui rice 201, Anhui rice 203, Anhui rice 205, Anhui rice 207 or Tianjin former 101.
12. purposes according to claim 10, wherein, described paddy rice is that Japan is fine.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010156932.7A CN102234646B (en) | 2010-04-23 | 2010-04-23 | Promoter SbUbi1, preparation method and application thereof |
| PCT/CN2010/001773 WO2011130894A1 (en) | 2010-04-23 | 2010-11-04 | Promoter sbubi1, preparation method and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010156932.7A CN102234646B (en) | 2010-04-23 | 2010-04-23 | Promoter SbUbi1, preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102234646A CN102234646A (en) | 2011-11-09 |
| CN102234646B true CN102234646B (en) | 2014-10-22 |
Family
ID=44833623
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010156932.7A Expired - Fee Related CN102234646B (en) | 2010-04-23 | 2010-04-23 | Promoter SbUbi1, preparation method and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN102234646B (en) |
| WO (1) | WO2011130894A1 (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102156719B1 (en) * | 2012-12-19 | 2020-09-16 | 몬산토 테크놀로지 엘엘씨 | Plant regulatory elements and uses thereof |
| CA2900914A1 (en) * | 2013-02-18 | 2014-08-21 | Pioneer Hi-Bred International, Inc. | Sb-ubi terminator sequence for gene expression in plants |
| KR102270069B1 (en) | 2013-03-14 | 2021-06-28 | 몬산토 테크놀로지 엘엘씨 | Plant regulatory elements and uses thereof |
| CA2955828A1 (en) * | 2014-08-08 | 2016-02-11 | Pioneer Hi-Bred International, Inc. | Ubiquitin promoters and introns and methods of use |
| CN111560373B (en) * | 2020-05-07 | 2021-09-14 | 海南波莲水稻基因科技有限公司 | Plant constitutive promoter OsUbipro and application thereof |
| CN112375772B (en) * | 2020-10-22 | 2023-04-11 | 广西壮族自治区农业科学院 | Construction method and application of plant expression vector suitable for sugarcane |
| CN113832153B (en) * | 2021-09-07 | 2022-07-01 | 中国热带农业科学院三亚研究院 | Sorghum promoter, preparation method and application |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1641022A (en) * | 2003-06-12 | 2005-07-20 | 武汉大学 | Method for preparing transgene using rice calmodulin binding protein kinase gene and its use |
| CN1984993A (en) * | 2002-11-27 | 2007-06-20 | 陶氏化学公司 | Plant production of immunoglobulins with reduced fucosylation |
| CN101087885A (en) * | 2004-11-26 | 2007-12-12 | 达梭生技医药股份有限公司 | An expression vector encoding coronavirus-like particles |
| CN101384714A (en) * | 2006-02-09 | 2009-03-11 | 学校法人自治医科大学 | Novel viral vector |
| JP2009195197A (en) * | 2008-02-22 | 2009-09-03 | Hiroshima Univ | Method for transforming mammalian cell |
| WO2009124282A1 (en) * | 2008-04-03 | 2009-10-08 | Pioneer Hi-Bred International, Inc. | Methods and compositions for pollination disruption |
| US7790874B2 (en) * | 2006-03-15 | 2010-09-07 | Pioneer Hi-Bred International, Inc. | Gene expression modulating element |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6528701B1 (en) * | 1999-03-02 | 2003-03-04 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Rice ubiquitin-derived promoters |
| CN100427602C (en) * | 2005-08-22 | 2008-10-22 | 中国林业科学研究院林业研究所 | Plant bivalent anti-reverse gene bielement expression carrier |
| WO2008140766A2 (en) * | 2007-05-08 | 2008-11-20 | The Ohio State University | Highly active soybean promoters and uses thereof |
| US8362325B2 (en) * | 2007-10-03 | 2013-01-29 | Ceres, Inc. | Nucleotide sequences and corresponding polypeptides conferring modulated plant characteristics |
| CN101457233B (en) * | 2007-12-12 | 2011-06-15 | 中国科学院遗传与发育生物学研究所 | Method for constructing chlorella expression vector, converting chlorella and breaking wall of chlorella |
-
2010
- 2010-04-23 CN CN201010156932.7A patent/CN102234646B/en not_active Expired - Fee Related
- 2010-11-04 WO PCT/CN2010/001773 patent/WO2011130894A1/en active Application Filing
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1984993A (en) * | 2002-11-27 | 2007-06-20 | 陶氏化学公司 | Plant production of immunoglobulins with reduced fucosylation |
| CN1641022A (en) * | 2003-06-12 | 2005-07-20 | 武汉大学 | Method for preparing transgene using rice calmodulin binding protein kinase gene and its use |
| CN101087885A (en) * | 2004-11-26 | 2007-12-12 | 达梭生技医药股份有限公司 | An expression vector encoding coronavirus-like particles |
| CN101384714A (en) * | 2006-02-09 | 2009-03-11 | 学校法人自治医科大学 | Novel viral vector |
| US7790874B2 (en) * | 2006-03-15 | 2010-09-07 | Pioneer Hi-Bred International, Inc. | Gene expression modulating element |
| JP2009195197A (en) * | 2008-02-22 | 2009-09-03 | Hiroshima Univ | Method for transforming mammalian cell |
| WO2009124282A1 (en) * | 2008-04-03 | 2009-10-08 | Pioneer Hi-Bred International, Inc. | Methods and compositions for pollination disruption |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102234646A (en) | 2011-11-09 |
| WO2011130894A1 (en) | 2011-10-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102234646B (en) | Promoter SbUbi1, preparation method and application thereof | |
| CN101838647B (en) | Promoter BgIosP587, and preparation method and application thereof | |
| CN102206640B (en) | Promoter SbUbi2, its preparation method and use | |
| CN101864418B (en) | Promoter BgIosP513 and preparation method and application thereof | |
| CN101864417B (en) | Promoter BgIosP582 and preparation method and application thereof | |
| CN102115745B (en) | Promoter BgIosP556, and preparation method and application thereof | |
| CN102206641B (en) | Promoter SbUbi1, its preparation method and use | |
| CN101875934B (en) | Promoter BgIosP546, preparation method thereof and use thereof | |
| CN101792764B (en) | Promoter BgIosP 525 and preparation method and application thereof | |
| CN102146407B (en) | Promoter BgIosP 534, and preparation method and application thereof | |
| CN102146406B (en) | Promoter BgIosP535, and preparation method and use thereof | |
| CN102146410A (en) | BgIosP526 promoter, preparation method and application of BgIosP526 promoter | |
| CN101955937B (en) | Promoter BgIosP519 and preparation method and application thereof | |
| CN101985622B (en) | Promoter BgIosP572 and preparation method and application thereof | |
| CN101967482B (en) | Promoter BglosP536 and preparation method and application thereof | |
| CN101979546B (en) | Promoter BgIosP574, preparation method and application thereof | |
| CN101955936B (en) | Promoter BgIosP586, and preparation method and use thereof | |
| CN102021168B (en) | Promoter BgIosP566 as well as preparation method and application thereof | |
| CN101955935B (en) | Promoter BgIosP548 and preparation method and application thereof | |
| CN103614376B (en) | A kind of promotor OsP003, preparation method and application thereof | |
| CN102146408B (en) | Promoter BgIosP 524, and preparation method and application thereof | |
| CN102146394B (en) | Promoter BGIosP514 and use thereof | |
| CN102146405B (en) | Promoter BgIosP529, and preparation method and use thereof | |
| CN102146409B (en) | Promoter BgIosP522 as well as preparation method and application thereof | |
| CN102146393A (en) | BGIosP515 promoter and application of BGIosP515 promoter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20180131 Address after: 518124 Guangdong province Shenzhen City Dapeng Dapeng District Office Pengfei Road No. 7 Patentee after: Shenzhen Huada Sansheng Garden Technology Co.,Ltd. Address before: Beishan Industrial Zone Building in Yantian District of Shenzhen city of Guangdong Province in 518083 Patentee before: BGI SHENZHEN Co.,Ltd. |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20191213 Address after: 518120 A205, Peng Fei Road, Dapeng street, Dapeng New District, Shenzhen, Guangdong, China, 7 Patentee after: Shenzhen Huada Gene Agriculture Holding Co.,Ltd. Address before: 518124 Guangdong province Shenzhen City Dapeng Dapeng District Office Pengfei Road No. 7 Patentee before: Shenzhen Huada Sansheng Garden Technology Co.,Ltd. |
|
| TR01 | Transfer of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141022 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |