CN103614378B - A kind of promotor OsP002, preparation method and application thereof - Google Patents
A kind of promotor OsP002, preparation method and application thereof Download PDFInfo
- Publication number
- CN103614378B CN103614378B CN201310526035.4A CN201310526035A CN103614378B CN 103614378 B CN103614378 B CN 103614378B CN 201310526035 A CN201310526035 A CN 201310526035A CN 103614378 B CN103614378 B CN 103614378B
- Authority
- CN
- China
- Prior art keywords
- promotor
- plant
- seq
- rice
- nucleotide sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a kind of promotor OsP002, and its preparation method and application, the nucleotides sequence of described promotor is classified as the nucleotide sequence shown in Seq ID No.1 or is the nucleotide sequence with Seq ID No.1 complementation.Promotor of the present invention can be used in the expression of goal gene in monocotyledons, in research monocotyledons, destination gene expression provides a kind of new instrument and selection.
Description
Technical field
The invention belongs to field of plant genetic, be specifically related to a kind of promotor OsP002, preparation method and application thereof.
Background technology
Promotor to refer in gene that one section can affect the trans factors of transcribing with RNA polymerase and some other and is combined the DNA sequence dna realizing accurately effectively initiation transcription.The initial time of gene expression in plants (transcribing) and the degree of expression are subject to the control of promotor, and the clone of promotor and functional analysis are the important contents of control of plant gene expression research, are also importances of plant genetic engineering research.
Transcriptional profile according to promotor can be divided into 3 classes: constitutive promoter, tissue or organ specific promoters and inducible promoter.So-called constitutive promoter refers to that the genetic expression of different tissues organ and etap does not have notable difference, is thus referred to as constitutive promoter under constitutive promoter regulation and control.
People pay much attention to from plant clone constitutive promoter itself.Such as Actin muscle (actin) and ubiquitin (ubiquitin) isogenic promotor are cloned.Replace CaMV35S promotor by these promotors, more effectively can drive transcribing of foreign gene in monocotyledons.Naomi etc. have cloned corresponding promotor respectively from the tryptophan synthase subunit gene of Arabidopis thaliana and phytochrome gene, CaMV35S promotor is replaced with it, also good expression effect (Plant biotechnology is achieved in transgene tobacco, 2002,19 (1): 19-26).
Promotor common in monocot genes has: Ubi promotor (Plant ubiquitinpromoter), Actin promotor (Plant Actin promoter) and Adh-1 promotor (Maizealcohol dehydrogenase1promoter).Factors such as Ubi promotor is high with its starting efficiency, methylation is low, stabilization characteristics of genetics and gaining great popularity.Actin promotor nineteen ninety is found first by the McElroy etc. of Cornell University in paddy rice, belongs to strong constitutive promoter.Actin promotor acts on significantly in unifacial leaf Gramineae, but the gene regulating function in the plant of contiguous section genus is but very undesirable.Therefore, many correlative studys find Actin promotor by other monocotyledonss, and success finds successively in banana, muskmelon, corn and Arabidopis thaliana.Actin promotor, due to the strong regulating and controlling effect to genetic expression, has obtained applying more and more widely in the transgenosis of monocotyledons good character.Adh-1 promoter regulation ADH (alcohol dehydrogenase) gene, most important to the expression of plant ethanol dehydrogenase under anaerobic environment.Particularly cereal grass is as paddy rice, oat and barley to monocotyledons for Adh-1 promotor, and small part dicotyledons is as tobacco, and the adjusting function of gene improves 10-50 doubly than CaMV (cauliflower mosaic virus CaMV) 35S promoter.Adh-1 promotor is mainly used in monocotyledons, and the regulating effect of expressing most dicotyledon gene is all very limited.
Summary of the invention
The present invention is by the further investigation to rice genome, provide a kind of new promotor OsP002, described promotor can be used in the expression of goal gene in monocotyledons, simultaneously for destination gene expression in research monocotyledons provides a kind of new instrument and selection.
The object of this invention is to provide a kind of new promotor, can the expression of regulatory gene in plant.
Another object of the present invention is to provide a kind of nucleic acid construct containing above-mentioned promotor, carrier, reconstitution cell and plant callus, plant explants or plant.
Another object of the present invention is to provide a kind of primer, the preparation method that prepare above-mentioned promotor, and utilizes the method for this promoter regulation gene expression in plants.
Another object of the present invention is to provide the preparation method of a kind of transgenic plant, and above-mentioned promotor, nucleic acid construct, carrier, reconstitution cell or plant callus or plant explants or the plant purposes in regulating plant in destination gene expression or plant breeding.
For achieving the above object, the present invention is by the following technical solutions:
The invention discloses a kind of promotor, this promotor contains and is selected from following any one group and have the nucleotide sequence of promoter function:
Nucleotide sequence shown in a, Seq ID No.1;
B, with the nucleotide sequence of Seq ID No.1 complementation;
C, under high stringency condition can with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b;
The nucleotide sequence that d, replacement nucleotide sequence shown in above-mentioned a or b being carried out to one or more base, disappearance, interpolation are modified;
E, with nucleotide sequence shown in above-mentioned a or b, there is the nucleotide sequence of at least 90% identity.
The invention also discloses a kind of nucleic acid construct, comprise above-mentioned promotor, and the gene order be operatively connected with promotor, above-mentioned promotor and gene order are originated identical or different.
The invention also discloses a kind of carrier, this carrier contains above-mentioned promotor or nucleic acid construct, preferably, this carrier be above-mentioned promotor or above-mentioned nucleic acid construct respectively with pMD18-T or p8 plasmid through the recombinant vectors obtained of recombinating.
The invention also discloses a kind of reconstitution cell, this reconstitution cell contains above-mentioned promotor or nucleic acid construct or carrier, and preferably, this reconstitution cell is recombinant Bacillus coli cells or recombinational agrobacterium cell.
The invention also discloses the plant callus containing above-mentioned promotor, nucleic acid construct, carrier or reconstitution cell, plant explants or plant, this plant optimization is monocotyledons, be preferably Oryza again, be more preferably paddy rice, more preferably paddy rice Japan is fine.
The invention also discloses one group of primer pair; above-mentioned promotor is obtained for amplification; two primers of this primer pair are respectively containing the sequence shown in Seq ID No:2 and Seq ID No:3; preferably; these two primers are also connected to restriction enzyme site and/or protection base at 5 ' end; more preferably, two primers of this primer pair have the sequence shown in Seq ID No:4 and Seq ID No:5 respectively.
The invention also discloses a kind of method preparing Seq ID No.1 promotor, the method comprises, with the fine genomic dna of paddy rice Japan for template, pair for amplification primer is used to increase, this amplimer designs for head and the tail respectively according to the sequence of SEQ ID NO:1 in the fine genome gDNA of paddy rice Japan, the preferred above-mentioned primer pair of the primer.
The invention also discloses the method for genetic expression in a kind of regulating plant, the method comprises, and above-mentioned promotor, nucleic acid construct, carrier or reconstitution cell are imported vegetable cell; Preferred importing plant callus; Preferred further, plant callus is that the recombinational agrobacterium by having above-mentioned promotor or nucleic acid construct or carrier transforms; This plant optimization is monocotyledons, then is preferably Oryza, and be more preferably paddy rice, more preferably paddy rice Japan is fine.
The invention also discloses a kind of method preparing transgenic plant, under the condition effectively producing plant, cultivate above-mentioned reconstitution cell or plant callus or plant explants or plant; Preferably, described plant callus or plant explants or plant contain above-mentioned promotor or nucleic acid construct or carrier or reconstitution cell; This plant optimization is monocotyledons, then is preferably Oryza, and be more preferably paddy rice, be more preferably japonica rice, more preferably paddy rice Japan is fine.
The invention also discloses above-mentioned promotor, nucleic acid construct, carrier, reconstitution cell or plant callus or plant explants or the plant purposes in regulating plant in destination gene expression or plant breeding; Preferred plant is monocotyledons, more preferred plant is Oryza, and more preferably plant is paddy rice, and further preferred plant is that paddy rice Japan is fine.
Owing to have employed above technical scheme, the beneficial effect that the present invention is possessed is:
New promotor provided by the invention can in plant regulate gene expression, and, in the root, seedling, Rice Anther, rice glume etc. of monocotyledons as rice seedling, there is promoter function, the expression of foreign gene can be regulated and controled, thus be that the expression studying goal gene in monocotyledons provides a kind of new instrument and selection.
Accompanying drawing explanation
Fig. 1 is the pGAMBIA-1301 plasmid schematic diagram for building p8 plasmid.
Fig. 2 is p8 plasmid schematic diagram.
Fig. 3 is the GUS coloration result of the Rice Callus through transforming; Wherein, the Rice Callus (left side) transformed with the restructuring agrobacterium tumefaciens p8+P002 of promotor P002 sequence of the present invention presents blueness after GUS dyeing; Rice Callus (contrast, right) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
Fig. 4 is the GUS coloration result of the rice seedling phase root through transforming; Wherein, rice seedling phase root (right side) transformed by the restructuring agrobacterium tumefaciens p8+P002 with promotor P002 sequence of the present invention presents blueness after GUS dyeing; Rice seedling phase root (contrast, left) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
Fig. 5 is the GUS coloration result of the rice seedling phase blade through transforming; Wherein, rice seedling phase blade (right side) transformed by the restructuring agrobacterium tumefaciens p8+P002 with promotor P002 sequence of the present invention presents blueness after GUS dyeing; Rice seedling phase blade (contrast, left) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
Fig. 6 is the GUS coloration result of the rice maturity root through transforming; Wherein, the rice maturity root (right side) transformed by the restructuring agrobacterium tumefaciens p8+P002 with promotor P002 sequence of the present invention presents blueness after GUS dyeing; Rice maturity root (contrast, left) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
Fig. 7 is the GUS coloration result of the rice maturity stem through transforming; Wherein, the rice maturity stem (right side) transformed by the restructuring agrobacterium tumefaciens p8+P002 with promotor P002 sequence of the present invention presents blueness after GUS dyeing; Rice maturity stem (contrast, left) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
Fig. 8 is the GUS coloration result of the rice maturity blade through transforming; Wherein, the rice maturity blade (right side) transformed by the restructuring agrobacterium tumefaciens p8+P002 with promotor P002 sequence of the present invention presents blueness after GUS dyeing; Rice maturity blade (contrast, left) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
Fig. 9 is the GUS coloration result of the rice maturity grain husk shell through transforming; Wherein, rice maturity grain husk shell (right side) transformed with the restructuring agrobacterium tumefaciens p8+P002 of promotor P002 sequence of the present invention presents blueness after GUS dyeing; After GUS dyeing, color does not change the clever shell of rice maturity without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention (contrast, left).
Figure 10 be through transform Rice Anther, filigree, column cap GUS coloration result; Wherein, the Rice Anther transformed with the restructuring agrobacterium tumefaciens p8+P002 of promotor P002 sequence of the present invention, filigree, column cap (right side) present blueness after GUS dyeing; Without the Rice Anther of the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention, filigree, after GUS dyeing, color does not change column cap (contrast, left).
Embodiment
Below in conjunction with drawings and Examples, the invention will be further described.
The invention provides a kind of can in plant the promoter sequence of regulate gene expression, this promotor contains and is selected from following any one group and have the nucleotide sequence of promoter function:
Nucleotide sequence shown in a, Seq ID No.1;
B, with the nucleotide sequence of Seq ID No.1 complementation;
C, under high stringency condition can with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b;
The nucleotide sequence that d, replacement nucleotide sequence shown in above-mentioned a or b being carried out to one or more base, disappearance, interpolation are modified;
E, with nucleotide sequence shown in above-mentioned a or b, there is the nucleotide sequence of at least 90% identity.
In the present invention, term " monocotyledons " can be oryza plant such as paddy rice particularly, includes but not limited to that Japan fine, middlely spends 10, middlely spends 11, No. 8, Danjiang River, cloud rice No. 2, Anhui rice 90, Anhui rice 92, Anhui rice 201, Tianjin are former 101, Shan excellent 608 etc.
In the present invention, with the nucleotide sequence of the nucleotide sequence hybridization shown in Seq ID No.1 or with its complementation under described high stringency condition, it has and the same or analogous promoter activity of nucleotide sequence shown in Seq ID No.1.
In the present invention, described to Seq ID No.1 or and the nucleotide sequence of its complementation carries out the replacement of one or more base, disappearance, interpolation are modified nucleotide sequence, refer to and hold at 5 ＇ ends of described nucleotide sequence and/or 3 ＇ respectively or simultaneously, and/or interior sequences is such as no more than 2-45, or be no more than 3-20, or be no more than 4-15, or be no more than 5-10, or be no more than 6-8 the replacement of the base represented with continuous integral number one by one respectively, disappearance, interpolation modification.
In the present invention, described to Seq ID No.1 or and the nucleotide sequence of its complementation carries out the replacement of base as one or more in above-mentioned row, disappearance, interpolation are modified nucleotide sequence, have and the same or analogous promoter activity of nucleotide sequence shown in Seq ID No.1.
Be described by a kind of polynucleotide, its nucleotide sequence had, such as refer to reference nucleotide sequence at least 90% identity of Seq IDNo.1: in every 100 Nucleotide of the reference nucleotide sequence of Seq ID No.1, the nucleotide sequence of these polynucleotide is except containing the difference of nearly 10 Nucleotide, and the nucleotide sequence of these polynucleotide is identical with reference sequences.Namely in order to obtain the nucleotide sequence polynucleotide identical with reference nucleotide sequence at least 90%, in reference sequences, nearly the Nucleotide of 10% can be deleted or by another nucleotide substitution; Maybe some Nucleotide can be inserted in reference sequences, the Nucleotide wherein inserted can reach 10% of reference sequences total nucleotide; Or in some Nucleotide, there is the combination of deleting, inserting and replacing.
In the present invention, for determining the algorithm of sequence iden and sequence similarity percentage ratio, for BLAST and BLAST2.0 algorithm, they are described in (1990) J.Mol.Bio.215:403-410 such as (1977) Nucl.Acid.Res.25:3389-3402 and Altschul such as Altschul respectively.Adopt described in document or default parameters, BLAST and BLAST2.0 can be used for determining nucleotide sequence homology percentage ratio of the present invention.The software performing BLAST analysis can by National Biotechnology information center by the public be obtained.
In the present invention, described with nucleotide sequence shown in Seq ID No.1 or with the nucleotide sequence of its complementation, there is the nucleotide sequence of at least 90% identity, comprise and Seq ID No.1 or the polynucleotide sequence substantially same with sequence disclosed in the nucleotide sequence of its complementation, in the present invention, described have and the same or analogous promoter activity of nucleotide sequence shown in Seq ID No.1 with nucleotide sequence shown in SeqID No.1 or with the nucleotide sequence that the nucleotide sequence of its complementation has at least 90% identity.
The invention also discloses a kind of nucleic acid construct, comprise above-mentioned promotor, and the gene order be operatively connected with this promotor." be operatively connected " functional spatial arrangement referring to two or more nucleotide region or nucleotide sequence.In constructs of the present invention, promotor is placed in certain specific position of gene nucleic acid sequence, described gene is generally need to improve any nucleotide sequence of transcriptional level, or, promotor of the present invention and gene can be designed to lower specific nucleic acid sequence.Namely realize by promotor is connected with antisense orientation gene.In the embodiment that the present invention one is concrete, affiliated gene is preferably gus gene.
The invention still further relates to a kind of carrier containing above-mentioned promotor or above-mentioned nucleic acid construct.Carrier of the present invention can be by above-mentioned promotor or above-mentioned nucleic acid construct being inserted into cloning vector or expression vector and the recombinant vectors obtained.Be suitable for the expression vector building recombinant vectors of the present invention.In the specific embodiment of the invention, the carrier that the present invention contains described promotor is that above-mentioned promotor and pMD18-T or p8 plasmid are through the recombinant vectors obtained of recombinating, preferably, recombinant vectors of the present invention is pMD18-T+P002 recombinant vectors or p8+P002 recombinant vectors.
The invention further relates to the reconstitution cell containing promotor of the present invention.Reconstitution cell of the present invention can by obtaining the above-mentioned recombinant vectors transformed host cell containing promotor of the present invention.The host cell being suitable for building reconstitution cell of the present invention includes but not limited to, such as: Bacillus coli cells, and Agrobacterium tumefaciens cell etc.In the embodiment that the present invention one is concrete, described reconstitution cell is restructuring agrobacterium tumefaciens.
The present invention further discloses a kind of plant callus or plant explants or plant, described callus, plant explants or plant contain above-mentioned promotor of the present invention.Plant callus of the present invention is monocotyledons callus, as Rice Callus.
The present invention also relates to the one group of primer pair obtaining promotor of the present invention for pcr amplification further, and this group primer pair is containing the sequence shown in Seq ID No:2 and Seq ID No:3 in ordered list.For the ease of operation, the preferred 5 ' end at primer also designs and is connected with restriction enzyme site and/or protection base usually.In the specific embodiment of the invention, two primers of described primer pair have the sequence shown in Seq ID No:4 and Seq ID No:5 respectively.
Adopt above-mentioned primer, carry out pcr amplification with the fine genomic dna of paddy rice Japan for template, promotor of the present invention can be prepared.
The present invention further discloses the method for genetic expression in a kind of regulating plant, and the method comprises: above-mentioned promotor is imported vegetable cell.The object that vegetable cell reaches regulate gene expression is imported preferably by by the nucleic acid construct simultaneously containing foreign gene and promotor of the present invention.In described nucleic acid construct, foreign gene is operably connected with promotor of the present invention.
In the present invention, genetic plant transformations technology can be adopted to be inserted in plant gene by goal gene and described promotor, to comprise agrobacterium mediation converted, virus-mediated conversion, microinjection, particle bombardment, via Particle Bombardment Transformation and electroporation etc.This area is known, and agriculture bacillus mediated gene transformation is often used to monocotyledonous gene transformation, but its transformation technology also can be used for the importing of promotor of the present invention and foreign gene.Certainly, the another kind of method being suitable for promotor of the present invention and foreign gene importing is particle bombardment, (namely micro-gold or tungsten particle attached bag cover the DNA of conversion) embryo callus or embryo's exploitation.In addition, the method for the transformed plant cells that can also adopt is protoplast transformation.After gold and silver transforms, adopt general method to screen and regenerate the plant being integrated with and expressing unit.
The method of genetic expression in promotor of the present invention and regulating plant, can be applied to the seed selection of plant variety.Such as, can be used for the breeding of paddy rice.In a specific embodiment of the present invention, described paddy rice is that Japan is fine.
Promotor of the present invention can be described as a kind of new promotor, as genetically modified instrument start-up of plant (particularly monocotyledons), in order to carry out, low expressing gene transformation seedlings screens, the breeding research of plant flower organ abortion equimolecular provides convenient, thus greatly shortens the seed selection time of improved seeds.
thisin invention, monocotyledons is specifically as follows grass, more specifically, can be oryza plant, such as paddy rice, includes but not limited to that Japan is fine.
By reference to the accompanying drawings the present invention is described in further details below by embodiment.Not marked concrete technology or condition in embodiment, (such as, show with reference to J. Pehanorm Brooker etc. according to the technology described by the document in this area or condition, " Molecular Cloning: A Laboratory guide " that Huang Peitang etc. translate, the third edition, Science Press), or carry out according to product description.Agents useful for same or the unreceipted production firm of instrument, be the conventional products by commercial acquisition.
The pcr amplification of embodiment 1:P002 promoter fragment and the structure of pMD18-T+P002 recombinant vectors.
One, the pcr amplification of P002 promoter fragment:
Paddy rice Japan is fine (at application number is to use plant genome DNA extraction test kit (TIANGEN plant genes group DNA extraction kit, catalog number (Cat.No.): DP320-02) to extract
200910238992.0, denomination of invention is preservation in the patent application of " a kind of promotor BgIosP587, Preparation Method And The Use "; and it is open on September 22nd, 2010; deposit number is CCTCC NO:P200910) genomic dna; according to the sequence of this promotor in the fine gDNA of paddy rice Japan; respectively at head and the tail design a pair PCR specificity amplification primer (upstream primer F1; add restriction enzyme site EcoR I and protection base; downstream primer R1, adds restriction enzyme site SbfI and protection base).With the fine gDNA of the paddy rice of said extracted Japan for template, high-fidelity Ex Taq (TaKaRa, DRR100B) polysaccharase is used to carry out pcr amplification.As shown in table 1.
The PCR system of table 1 gene promoter amplification
Pcr amplification program is: 94 DEG C of denaturation 5min, and then with 94 DEG C of sex change 45s, 55 DEG C of annealing 50s, 72 DEG C extend 90s, carry out 35 reaction cycle, and last 72 DEG C extend 7min.Wherein, upstream primer F1 (SEQ ID NO:4): G
gAATTC wherein underscore represents EcoR I restriction enzyme site, is SEQ ID No:2 in square frame.Downstream primer R1 (SEQ ID NO:5): TG
cCTGCAGG wherein underscore represents Sbf I restriction enzyme site, is SEQ ID No:3 in square frame.
Pcr amplification product is separated through 1.0% agarose gel electrophoresis, obtains the band that size is about about 3043bp, uses TIANGEN sepharose DNA to reclaim test kit (catalog number (Cat.No.): DP209-03) and carries out purifying recovery.
Two, the structure of pMD18-T+P002 recombinant vectors:
To carry out T/A clone (pMD18-T plasmid, TaKaRa, D103A), transformation of E. coli as pcr amplification product obtained above, picking positive colony checks order, and proves accurately.Wherein, the condition of contact of T/A clone is as table 2.
The condition of contact of table 2T/A clone
In energy-conserving intelligent thermostatic bath (the new sesame in Ningbo, SDC-6), connect more than 8h in 16 DEG C, obtain pMD18-T+P002 recombinant vectors.By the transformation of E. coli as follows of the product after above-mentioned connection: (Kunming Institute of Zoology, Chinese Academy of Sciences Dong Yang provides to take out the competent cell 100 μ l DH5 α prepared according to Calcium Chloride Method " Molecular Cloning: A Laboratory guide " (third edition, Science Press) Suo Shi from Ultralow Temperature Freezer, or can from such as: the raw work in Shanghai is buied), after thawed on ice, add the connection product of 10 μ l as above gained, i.e. pMD18-T+P002 recombinant vectors, stir evenly gently, ice bath 30min, 42 DEG C of heat shock 60s, ice bath 5min, the SOC substratum adding 600 μ l4 DEG C precoolings (is specifically filled a prescription and is referred to " Molecular Cloning: A Laboratory guide ", the third edition, Science Press), 37 DEG C of 220rpm recovery 45min, the centrifugal 30s of 8000rpm, remove supernatant, leave and take 150 μ l, with the mixture after the remaining resuspended precipitation of 150 μ l supernatant, blow even gently, granulated glass sphere coating LB (kantlex) is dull and stereotyped, and (concrete formula refers to " Molecular Cloning: A Laboratory guide ", the third edition, Science Press), be inverted for 37 DEG C and cultivate 16h-24h.Obtain the recombination bacillus coli containing pMD18-T+P002 cloning vector, called after DH5 α-P002.Shenzhen Huada Genetic Technology Co., Ltd checks order to the P002 in pMD18-T+P002 cloning vector.
Sequencing result shows, in the pMD18-T+P002 cloning vector of acquisition, P002 promoter sequence is correct.The sequence of P002 promotor is as shown in Seq ID No:1 in sequence table.
Embodiment 2: the structure of carrier-p8+P002 recombinant vectors.
One, p8 plasmid construction:
The p8 plasmid used in the present invention is that (Kunming Institute of Zoology, Chinese Academy of Sciences Dong Yang provides by pCAMBIA-1301 plasmid; Or can buy from such as Shanghai Guo Rui Gene Tech. Company Limited, the primary source of the pCAMBIA-1301 plasmid of the said firm is The CAMBIA Bios (biologicalopen source) Licensee, Australia) to transform in the following manner and build, being described as follows:
With Kpn I/Nco I (NEB) double digestion plasmid pCAMBIA-1301 as shown in Figure 1, reclaim large fragment.Following sequence is synthesized according to adopted restriction endonuclease sites:
GGTACCAAGCTTACTAGTCCTGCAGGTCTAGAGGATCCGTCGACCATGG (SEQ ID NO:6) (restriction enzyme site comprised is Kpn I/HindIII/Spe I/Sbf I/Pst I/XbaI/BamH I/SalI/Nco I), reclaim with after Kpn I/Nco I double digestion, (Kunming Institute of Zoology, Chinese Academy of Sciences Dong Yang provides to transform top10 cell after being connected with above-mentioned reclaimed large fragment; Or can from such as: Beijing Suo Laibao Science and Technology Ltd. buys).Use primer
GCTTCCGGCTCGTATGTTGT(SEQ ID NO：
7)/GAGTCGTCGGTTCTGTAAC (SEQ ID NO:8) screens transformant, and by PCR detection method, the transformant being 350bp with amplified fragments is the transformant containing the p8 plasmid needing multiple clone site and the GUS sequence built.P8 plasmid map is shown in Fig. 2.
Length 2353 base of the multiple clone site in described p8 plasmid and GUS sequence, as SEQ ID
Shown in NO:9:
GTTGGCAAGCTGCTCTAGCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTACACTTTAT
GTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTAC
GAGCTC AAGCTT C
G
GGATCC CATGGTAGATCTGAGG
GTCCGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTCGACGGCCTGTGGGCATTCAGTCTGGATCGCGAAAACTGTGGAATTGATCAGCGTTGGTGGGAAAGCGCGTTACAAGAAAGCCGGGCAATTGCTGTGCCAGGCAGTTTTAACGATCAGTTCGCCGATGCAGATATTCGTAATTATGCGGGCAACGTCTGGTATCAGCGCGAAGTCTTTATACCGAAAGGTTGGGCAGGCCAGCGTATCGTGCTGCGTTTCGATGCGGTCACTCATTACGGCAAAGTGTGGGTCAATAATCAGGAAGTGATGGAGCATCAGGGCGGCTATACGCCATTTGAAGCCGATGTCACGCCGTATGTTATTGCCGGGAAAAGTGTACGTATCACCGTTTGTGTGAACAACGAACTGAACTGGCAGACTATCCCGCCGGGAATGGTGATTACCGACGAAAACGGCAAGAAAAAGCAGTCTTACTTCCATGATTTCTTTAACTATGCCGGAATCCATCGCAGCGTAATGCTCTACACCACGCCGAACACCTGGGTGGACGATATCACCGTGGTGACGCATGTCGCGCAAGACTGTAACCACGCGTCTGTTGACTGGCAGGTGGTGGCCAATGGTGATGTCAGCGTTGAACTGCGTGATGCGGATCAACAGGTGGTTGCAACTGGACAAGGCACTAGCGGGACTTTGCAAGTGGTGAATCCGCACCTCTGGCAACCGGGTGAAGGTTATCTCTATGAACTCGAAGTCACAGCCAAAAGCCAGACAGAGTCTGATATCTACCCGCTTCGCGTCGGCATCCGGTCAGTGGCAGTGAAGGGCCAACAGTTCCTGATTAACCACAAACCGTTCTACTTTACTGGCTTTGGTCGTCATGAAGATGCGGACTTACGTGGCAAAGGATTCGATAACGTGCTGATGGTGCACGACCACGCATTAATGGACTGGATTGGGGCCAACTCCTACCGTACCTCGCATTACCCTTACGCTGAAGAGATGCTCGACTGGGCAGATGAACATGGCATCGTGGTGATTGATGAAACTGCTGCTGTCGGCTTTCAGCTGTCTTTAGGCATTGGTTTCGAAGCGGGCAACAAGCCGAAAGAACTGTACAGCGAAGAGGCAGTCAACGGGGAAACTCAGCAAGCGCACTTACAGGCGATTAAAGAGCTGATAGCGCGTGACAAAAACCACCCAAGCGTGGTGATGTGGAGTATTGCCAACGAACCGGATACCCGTCCGCAAGGTGCACGGGAATATTTCGCGCCACTGGCGGAAGCAACGCGTAAACTCGACCCGACGCGTCCGATCACCTGCGTCAATGTAATGTTCTGCGACGCTCACACCGATACCATCAGCGATCTCTTTGATGTGCTGTGCCTGAACCGTTATTACGGATGGTATGTCCAAAGCGGCGATTTGGAAACGGCAGAGAAGGTACTGGAAAAAGAACTTCTGGCCTGGCAGGAGAAACTGCATCAGCCGATTATCATCACCGAATACGGCGTGGATACGTTAGCCGGGCTGCACTCAATGTACACCGACATGTGGAGTGAAGAGTATCAGTGTGCATGGCTGGATATGTATCACCGCGTCTTTGATCGCGTCAGCGCCGTCGTCGGTGAACAGGTATGGAATTTCGCCGATTTTGCGACCTCGCAAGGCATATTGCGCGTTGGCGGTAACAAGAAAGGGATCTTCACTCGCGACCGCAAACCGAAGTCGGCGGCTTTTCTGCTGCAAAAACGCTGGACTGGCATGAACTTCGGTGAAAAACCGCAGCAGGGAGGCAAACAAGCTAGCCACCACCACCACCACCACGTGTGA(SEQ IDNO:9)
As above constructed in the present invention shown in sequence p8 plasmid, EcoR I/SacI/KpnI/HindIII/Spe I/Sbf I/Pst I/Xba I/BamH I/SalI/Nco I restriction enzyme site in its multiple clone site respectively with adding frame and underscore represents, the primer that screening transformant is used
GCTTCCGGCTCGTATGTTGT/GAGTCGTCGGTTCTGTAAC (i.e. SEQ IDNO:7 and 8) represents with double underline, and GUS sequence italic represents, its intron sequences adds shading by italic respectively and illustrates.
Two, the structure of recombinant vectors p8+P002:
According to restriction enzyme EcoRI and SbfI operation instructions, according to the cloning vector pMD18-T+P002 obtained in following condition Processing Example 1, and the p8 plasmid built as mentioned above.
Wherein, the enzyme tangent condition following (table 3) of cloning vector pMD18-T+P002 and p8 plasmid:
The enzyme tangent condition of table 3 cloning vector pMD18-T+P002 and p8 plasmid
Use TIANGEN sepharose DNA to reclaim test kit (catalog number (Cat.No.): DP209-03) and reclaim the p8 plasmid cut through enzyme respectively, and promotor P002 Insert Fragment, according to T4 ligase enzyme (TaKaRa, D2011A) operation instructions, connects according to following (table 4) condition:
Table 4 condition of contact
T4buffer thawed on ice, enzyme cut after p8 plasmid vector add-on be about 20ng, the P002 fragment in the present invention adds 10ng.In energy-conserving intelligent thermostatic bath (the new sesame in Ningbo, SDC-6), more than 8h is connected in 16 DEG C.The competent cell DH5 α that 100 μ l Calcium Chloride Method are obtained takes out from Ultralow Temperature Freezer, after thawed on ice, adds the connection product above 10 μ l, stir evenly gently, ice bath 30min, 42 DEG C of heat shock 60s, ice bath 5min, adds the SOC of 600 μ l4 DEG C precoolings, 37 degree of 220rpm recovery 45min, the centrifugal 30s of 8000rpm, remove supernatant, leave and take 150 μ l, blow even gently, granulated glass sphere coating LB (kan), is inverted cultivation 16 ~ 24h for 37 DEG C.Obtain recombinant vectors p8+P002.Respectively with F1 (i.e. SEQ ID NO:4) and R1 (i.e. SEQ ID NO:5) for primer pair gained recombinant vectors p8+P002 carries out PCR detection, to confirm in gained recombinant vectors p8+P002 containing required promotor P002.Screening is cut containing recombinant vectors p8+P002 transformant by EcoRI and SbfI enzyme.
Embodiment 3: the preparation of restructuring agrobacterium tumefaciens EHA105-P002 cell.
The p8+P002 recombinant vectors build method as described in Example 2 and p8 plasmid in contrast transform according to " Molecular Cloning: A Laboratory the guide " (third edition respectively, Science Press) described in the agrobacterium tumefaciens EHA105 for preparing of calcium chloride method (be 200910238992.0 at application number, denomination of invention is " a kind of promotor BgIosP587, Preparation Method And The Use " patent application in preservation, and it is open on September 22nd, 2010, deposit number is CCTCC NO:M209315) competent cell, concrete grammar is as follows: taken out in Ultralow Temperature Freezer by agrobacterium tumefaciens competent cell EHA105, as for thawing on ice.After thawing, add the p8+P002 recombinant vectors of 5 μ l and p8 plasmid and p8 empty carrier in contrast respectively, mix gently, ice bath 10min, put into the freezing 5min of liquid nitrogen, 37 DEG C of 5min that thaw, add the LB liquid nutrient medium of 800 μ l normal temperature, 28 DEG C of 160rpm recovery 3h, the centrifugal 30s of 8000rpm, sucks supernatant, leaving 200 μ l blows even, coat and be added with (50mg/lKan, 10mg/l Rif, the concrete explanation that vide infra of filling a prescription) on the dual anti-YM culture medium flat plate of kan-rif (kantlex-Rifampin).Be inverted for 28 DEG C and cultivate 2-3 days.
Carry out PCR detection with F1 (i.e. SEQ ID NO:4) and R1 (i.e. SEQ ID NO:5) for primer and cut screening transformant by EcoRI/SbfI enzyme.Pcr amplification goes out the restructuring agrobacterium tumefaciens for recombinant vectors p8+P002 that about about 3043bp band and enzyme cut out about about 3043bp band.
In the present invention, the recombinational agrobacterium with recombinant vectors p8+P002 obtained according to such as aforesaid method, called after restructuring agrobacterium tumefaciens EHA105-P002.
According to the method for the invention, the contrast recombinational agrobacterium with p8 plasmid obtained, called after restructuring agrobacterium tumefaciens EHA105-p8.
Embodiment 4: the induction of Rice Callus and conversion.
Inducing paddy rice callus in accordance with the following steps, and transform described callus with restructuring agrobacterium tumefaciens EHA105-P002 and restructuring agrobacterium tumefaciens EHA105-p8 respectively.
The fine seed of paddy rice Japan is shelled, 70% ethanol surface sterilization 30s, then use the hypochlorite disinfectant 30min of available chlorine 1.5%, period acutely shakes, and cleans 5 times after sterilization with aqua sterilisa; Seed after sterilization is placed on N6D substratum (the concrete explanation that vide infra of filling a prescription), seals with sealed membrane; 29.5 DEG C of illumination cultivation 3-4 weeks; Choose the callus (yellow-white, dry, diameter 1-3mm) of active growth, 29.5 DEG C of illumination cultivation 3 days on new N6D substratum; The single bacterium colony of the restructuring agrobacterium tumefaciens of picking constructed by embodiment 3 (restructuring agrobacterium tumefaciens EHA105-P002 or restructuring agrobacterium tumefaciens EHA105-p8) respectively, in interpolation microbiotic (50mg/l Kan, upper streak culture 3 days of YM substratum (the concrete explanation that vide infra of filling a prescription) 10mg/lRif), culture temperature 28 DEG C; The above-mentioned restructuring agrobacterium tumefaciens of scraping is placed in the AS (Acetosyringone that with the addition of 30 μ l100mM respectively, Syringylethanone) 30ml AAM substratum (concrete formula vide infra explanations) in, gentle resuspended described restructuring Agrobacterium tumefaciens cell (restructuring agrobacterium tumefaciens EHA105-P002 or the agrobacterium tumefaciens EHA105-p8 that recombinates); The callus of succeeding transfer culture is placed in sterilizing culture dish; The restructuring agrobacterium tumefaciens suspension that such as prepared by step 3 is poured in culture dish, callus is immersed 15min; Outwell restructuring agrobacterium tumefaciens suspension, callus sterilizing thieving paper is sopped up unnecessary liquid; On N6-AS substratum (formula vide infra explanation), put a sterilizing filter paper, add 1ml as above-mentioned containing the AAM substratum of AS, callus is transferred on filter paper; Sealing culture dish, 28 DEG C of light culture 48-60h; Infected callus is placed in 50ml sterile tube, with aqua sterilisa shake cleaning, until supernatant liquor becomes clarification; Callus is soaked in the sterilized water containing 500mg/l Pyocianil (Carb) to kill restructuring agrobacterium tumefaciens; With unnecessary moisture on sterilizing thieving paper removing callus, then transfer them on the N6-AS substratum containing 1mg/l hygromycin B (HmB) and 50mg/l Carb; Culture dish is sealed, 29.5 DEG C of illumination cultivation 3-4 weeks with sealed membrane.
Embodiment 5: the expression of the GUS in Rice Callus.
For detecting the expression of goal gene GUS in the Rice Callus through transforming described in embodiment 4, according to Chen S Y etc. at Journal of Integrative Plant Biology, 2008, method described in 50 (6): 742-751, to dyeing with the Rice Callus that restructuring agrobacterium tumefaciens EHA105-P002 or recombinational agrobacterium EHA105-p8 transforms respectively.
The formula (1ml) of GUS staining fluid: 610 μ l0.2M Na2HPO4 solution (pH=7.0); 390 μ l0.2M NaH2PO4 solution and 10 μ l0.1M X-gluc.
To be immersed in GUS staining fluid with the Rice Callus that restructuring agrobacterium tumefaciens EHA105-P002 or restructuring agrobacterium tumefaciens EHA105-p8 transform respectively, 37 DEG C of insulations are to occurring blueness, take pictures, result as shown in Figure 3, blueness is presented after the Rice Callus (Fig. 3 is left) of the restructuring Agrobacterium-Mediated Transformation of the p8+P002 recombinant vectors containing promotor is dyed, Rice Callus (in contrast, Fig. 3 is right) color after GUS dyeing through the p8 plasmid restructuring Agrobacterium-Mediated Transformation not containing promotor does not change.Result shows, and P002 promotor of the present invention is expressed gus gene has regulating and controlling effect.
Embodiment 6: the expression of GUS in transgenic paddy rice seedling.
The callus obtained in 4th step is transferred to MS-R division culture medium (specifically filling a prescription in table 2) the differentiation seedling containing 50mg/l hygromycin B (HmB); Culture dish is sealed, 29.5 DEG C of illumination cultivation 3-4 weeks with sealed membrane; The 1/2MS root media (specifically filling a prescription see table 3) transferred to when seedling grows to 3-4cm containing 50mg/l hygromycin B (HmB) carries out screening of taking root.
The GUS dyeing course of transgenic paddy rice seedling is as follows, and GUS staining fluid is with rice callus GUS staining fluid in the 5th step:
The GUS dyeing of the rice seedling phase root 1, through transforming and leaf:
The root of the rice seedling phase transformed with restructuring agrobacterium tumefaciens EHA105-P002 or restructuring agrobacterium tumefaciens EHA105-p8 respectively and blade are immersed in GUS staining fluid respectively, 37 DEG C are incubated 24 hours, are taken out, and immerse in the alcohol of 75% and decolour, be convenient to observe the blueness occurred, take pictures.As shown in Figure 4, the rice seedling root (right side) transformed by the restructuring agrobacterium tumefaciens p8+P002 with promotor P002 sequence of the present invention presents blueness to Seedling Stage root dyeing result after GUS dyeing; Rice seedling root (contrast, left) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change; As shown in Figure 5, the rice seedling leaf (right side) transformed by the restructuring agrobacterium tumefaciens p8+P002 with promotor P002 sequence of the present invention presents blueness to Seedling Stage blade coloration result after GUS dyeing; Rice seedling leaf (contrast, left) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
The GUS dyeing of the rice maturity root 2, through transforming, stem, leaf, clever shell:
The root of the rice maturity transformed with restructuring agrobacterium tumefaciens EHA105-P002 or restructuring agrobacterium tumefaciens EHA105-p8 respectively, stem, leaf, clever shell are immersed in GUS staining fluid, 37 DEG C are incubated 24 hours, taken out, immerse in the alcohol of 75% and decolour, be convenient to observe the blueness occurred, take pictures.Ripening stage, root dyeing result result was as Fig. 6, and the rice root (right side) transformed by the restructuring agrobacterium tumefaciens p8+P002 with promotor P002 sequence of the present invention presents blueness after GUS dyeing; Rice root (contrast, left) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change; Ripening stage, stem coloration result result was as Fig. 7, and the rice stem (right side) transformed by the restructuring agrobacterium tumefaciens p8+P002 with promotor P002 sequence of the present invention presents blueness after GUS dyeing; Rice stem (contrast, left) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change; Mature Leaf coloration result result is as Fig. 8, and the rice leaf (right side) transformed by the restructuring agrobacterium tumefaciens p8+P002 with promotor P002 sequence of the present invention presents blueness after GUS dyeing; Rice leaf (contrast, left) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change; Ripening stage, grain husk shell coloration result result was as Fig. 9, and the rice root (right side) transformed by the restructuring agrobacterium tumefaciens p8+P002 with promotor P002 sequence of the present invention presents blueness after GUS dyeing; Rice root (contrast, left) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change;
The GUS dyeing of the Rice Anther 3, through transforming, filigree, column cap:
To be immersed in GUS staining fluid by the Rice Anther that restructuring agrobacterium tumefaciens EHA105-P002 or restructuring agrobacterium tumefaciens EHA105-p8 transform respectively, 37 DEG C are incubated 24 hours, seedling is taken out, immerse in the alcohol of 75% and decolour, slough the green of seedling leaves, be convenient to observe the blueness occurred, take pictures, result is as Figure 10, and the Rice Anther that the restructuring agrobacterium tumefaciens p8+P002 with promotor P002 sequence of the present invention transforms, filigree, column cap (right side) present blueness after GUS dyeing; Without the Rice Anther of the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention, filigree, after GUS dyeing, color does not change column cap (contrast, left).
The relevant culture medium prescription used in the embodiment of the present invention is described as follows:
Below about " conventional sterilant " alleged in substratum refers to the sterilizing of following condition: vapor sterilization 20 minutes at 121 DEG C.
Table 5N6D substratum
By 1N potassium hydroxide adjust ph to 5.8, sterilizing according to a conventional method after sealing.
N6macro mother liquor (20X): saltpetre 56.60g, potassium primary phosphate 8.00g, ammonium sulfate 9.26g, magnesium sulfate 3.70g, calcium chloride 3.32g, distilled water is settled to 1L, and 4 DEG C save backup.N6micro mother liquor (1000X): potassiumiodide 0.80g, boric acid 1.60g, manganous sulfate 3.33g, zinc sulfate 1.50g, distilled water is settled to 1L, and 4 DEG C save backup.
Molysite (Fe2EDTA) stock solution (100X): by 3.73g b diammonium disodium edta (Na
2eDTA2H
2and 2.78g FeSO O)
4.7H
2o dissolves respectively, mixes and uses.Be settled to 1000ml with distilled water, 70 DEG C of temperature bath 2h, cool rear 4 DEG C of preservations and are no more than 1 month.
N6 vitamins stock liquid (1000X): vitamins B
10.10g, vitamins B
60.05g, nicotinic acid 0.05g, glycine 0.20g, adding distil water is settled to 100ml, filtration sterilization, and 4 DEG C of preservations are no more than 1 week.
Table 6YM liquid nutrient medium (containing 50mg/L Kan, 10mg/L Rif):
Table 7YM solid medium (containing 50mg/L Kan, 10mg/L Rif)
Table 8AAM substratum
Add 1N potassium hydroxide adjust ph to 5.2, conventional sterilant.
AAM macro (10X): 2.5g magnesium sulfate heptahydrate (MgSO
47H
2o), 1.5g Calcium dichloride dihydrate (CaCl
22H
2o), 1.33g sodium dihydrogen phosphate dihydrate (NaH
2pO
4.2H
2o), distilled water is settled to 1L, and 4 DEG C save backup.
AAM micro (100X): 0.7g mono-water manganous sulfate (MnSO
4h
2o), 0.2g Zinc Sulphate Heptahydrate (ZnSO
47H
2o), 0.075g potassiumiodide (KI), 0.3g boric acid (H
3bO
3), 25mg Sodium Molybdate Dihydrate (Na
2moO
4.2H
2o), 2.5mg cupric sulfate pentahydrate (CuSO
4.5H
2o), 2.5mg CoCL2 6H2O (CoCl
2.6H
2o), distilled water is settled to 1L, and 4 DEG C save backup.
AAM organic (1000X): 0.75g glycine (Glycine), 0.1g nicotinic acid (Nicotinic acid), 0.1gVB
6(Pyridoxine), 1g VB
1(Thiamine), distilled water is settled to 100ml, and 4 DEG C save backup.
Molysite (Fe
2eDTA) stock solution (100X): in table 5.
Table 9N6-AS Dual culture base
Adjust pH to 5.2.
N6macro mother liquor (20X), Fe
2eDTA stock solution (100X), N6 vitamins stock liquid (1000X): all in table 5.
Table 10MS-R division culture medium
Table 111/2MS root media
MS macroelement (20X): 33g ammonium nitrate (NH4NO3), 38g saltpetre (KNO3), 8.8g Calcium dichloride dihydrate (CaCl22H2O), 7.4g magnesium sulfate heptahydrate (MgSO47H2O), 3.4g potassium primary phosphate (KH2PO4), distilled water dissolves one by one, and distilled water is settled to 1L, and 4 DEG C save backup.
MS trace element (1000X): 0.83g potassiumiodide (KI), 6.2g boric acid (H3BO3), 22.3g tetra-water manganous sulfate (MnSO44H2O), 8.6g Zinc Sulphate Heptahydrate (ZnSO47H2O), 0.25g Sodium Molybdate Dihydrate (Na2MoO42H2O), 0.025g cupric sulfate pentahydrate (CuSO45H2O) 0.025g CoCL2 6H2O (CoCl26H2O), distilled water dissolves one by one, distilled water is settled to 1L, and 4 DEG C save backup.
MS organic composition (1000X): 0.5g nicotinic acid, 0.5g pyridoxine hydrochloride (vitamin B6), 0.5g vitamin (VITMAIN B1), 2g glycine, distilled water dissolves one by one, and distilled water is settled to 1L, and 4 DEG C save backup.
Inositol (500X): 50g inositol distilled water dissolves, and distilled water is settled to 1L, and 4 DEG C save backup.
Claims (10)
1. a promotor, is characterized in that, described promotor forms by being selected from following any one group and the nucleotide sequence with promoter function:
Nucleotide sequence shown in a, Seq ID No:1;
B, with the nucleotide sequence of Seq ID No:1 complementation;
2. a nucleic acid construct, is characterized in that, comprises promotor according to claim 1, and the gene order be operatively connected with promotor, and described promotor and described gene order are originated identical or different.
3. a carrier, is characterized in that, described carrier contains promotor according to claim 1 or nucleic acid construct according to claim 2.
4. a reconstitution cell, is characterized in that, described reconstitution cell contains promotor according to claim 1 or nucleic acid construct according to claim 2 or carrier according to claim 3; Described reconstitution cell is recombinant Bacillus coli cells or recombinational agrobacterium cell.
5. one group of primer pair, is characterized in that, two primers of described primer pair are connected to restriction enzyme site and/or protection base at the 5 ' end of Seq ID No:2 and Seq ID No:3.
6. one group of primer pair as claimed in claim 5, is characterized in that, two primers of described primer pair are made up of the sequence shown in Seq ID No:4 and Seq ID No:5 respectively.
7. prepare the method for the promotor shown in Seq ID No:1 for one kind, it is characterized in that, the method comprises, with the fine genomic dna of paddy rice Japan for template, use pair for amplification primer to increase, described amplimer designs for head and the tail respectively according to the sequence of SEQ ID NO:1 in the fine gDNA of paddy rice Japan.
8. the method for genetic expression in a regulating plant, it is characterized in that, the method comprises, the recombinational agrobacterium cell of promotor according to claim 1 or nucleic acid construct according to claim 2 or carrier according to claim 3 or claim 4 is imported plant callus, and described plant is paddy rice.
9. prepare the method for transgenic plant for one kind, it is characterized in that, culturing plants callus or plant explants or plant under the condition effectively producing plant, described plant callus or plant explants or plant contain promotor according to claim 1 or nucleic acid construct according to claim 2 or carrier according to claim 3 or recombinational agrobacterium cell according to claim 4, and described plant is paddy rice.
10. the purposes of the recombinational agrobacterium cell of carrier or claim 4 described in nucleic acid construct described in promotor or claim 2 or claim 3 in regulating plant in destination gene expression or plant breeding according to claim 1, described plant is paddy rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310526035.4A CN103614378B (en) | 2013-10-30 | 2013-10-30 | A kind of promotor OsP002, preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310526035.4A CN103614378B (en) | 2013-10-30 | 2013-10-30 | A kind of promotor OsP002, preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103614378A CN103614378A (en) | 2014-03-05 |
| CN103614378B true CN103614378B (en) | 2015-08-05 |
Family
ID=50165093
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310526035.4A Expired - Fee Related CN103614378B (en) | 2013-10-30 | 2013-10-30 | A kind of promotor OsP002, preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103614378B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116083431B (en) * | 2022-10-11 | 2023-11-24 | 深圳瑞德林生物技术有限公司 | Method for improving soluble expression of recombinant protein |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP4474540B2 (en) * | 2004-02-10 | 2010-06-09 | 独立行政法人農業生物資源研究所 | Shoot vascular bundle-specific expression promoter |
| CN102146384A (en) * | 2010-12-30 | 2011-08-10 | 深圳华大基因科技有限公司 | Promoter BgIosP573, preparation method and application |
| CN102146402A (en) * | 2010-12-30 | 2011-08-10 | 深圳华大基因科技有限公司 | BgIosP594 promoter, preparation method and application |
| CN102286481A (en) * | 2004-04-20 | 2011-12-21 | 辛根塔参与股份公司 | Regulartory sequences for expressing gene products in plant reproductive tissue |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7348471B2 (en) * | 2003-04-03 | 2008-03-25 | Academia Sinica | Rice glutelin gene promoters |
-
2013
- 2013-10-30 CN CN201310526035.4A patent/CN103614378B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP4474540B2 (en) * | 2004-02-10 | 2010-06-09 | 独立行政法人農業生物資源研究所 | Shoot vascular bundle-specific expression promoter |
| CN102286481A (en) * | 2004-04-20 | 2011-12-21 | 辛根塔参与股份公司 | Regulartory sequences for expressing gene products in plant reproductive tissue |
| CN102146384A (en) * | 2010-12-30 | 2011-08-10 | 深圳华大基因科技有限公司 | Promoter BgIosP573, preparation method and application |
| CN102146402A (en) * | 2010-12-30 | 2011-08-10 | 深圳华大基因科技有限公司 | BgIosP594 promoter, preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103614378A (en) | 2014-03-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102146402B (en) | Promoter BgIosP594 , preparation method and application | |
| CN103614378B (en) | A kind of promotor OsP002, preparation method and application thereof | |
| CN102146410B (en) | BgIosP526 promoter, preparation method and application of BgIosP526 promoter | |
| CN102146384B (en) | Promoter BgIosP573, preparation method and application | |
| CN101864418B (en) | Promoter BgIosP513 and preparation method and application thereof | |
| CN103614376B (en) | A kind of promotor OsP003, preparation method and application thereof | |
| CN102146406B (en) | Promoter BgIosP535, and preparation method and use thereof | |
| CN103627706A (en) | Promoter OsP004 as well as preparation method and application thereof | |
| CN102146397B (en) | BgIosP549 promoter, preparation method and application | |
| CN102146385B (en) | Promoter BgIosP576, and preparation method and use thereof | |
| CN102146399B (en) | Promoter BgIosP581 as well as preparation method and application thereof | |
| CN102146405B (en) | Promoter BgIosP529, and preparation method and use thereof | |
| CN102146409B (en) | Promoter BgIosP522 as well as preparation method and application thereof | |
| CN101955937B (en) | Promoter BgIosP519 and preparation method and application thereof | |
| CN102146398B (en) | Promoter BgIosP537, and preparation method and use thereof | |
| CN102146407A (en) | Promoter BgIosP 534, and preparation method and application thereof | |
| CN103614377A (en) | Promoter OsP001, and preparation method and application thereof | |
| CN101955936B (en) | Promoter BgIosP586, and preparation method and use thereof | |
| CN102146386B (en) | Promoter BgIosP557, preparation method and application | |
| CN103627707A (en) | Promoter OsP006 as well as preparation method and application thereof | |
| CN102146408B (en) | Promoter BgIosP 524, and preparation method and application thereof | |
| CN101967482B (en) | Promoter BglosP536 and preparation method and application thereof | |
| CN102146387A (en) | Promoter BgIosP 565, and preparation method and application thereof | |
| CN102146389A (en) | BgIosP580 promoter, preparation method and application | |
| CN103627708A (en) | Promoter OsP005 as well as preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150805 Termination date: 20151030 |
|
| EXPY | Termination of patent right or utility model |