CN103627706A - Promoter OsP004 as well as preparation method and application thereof - Google Patents
Promoter OsP004 as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN103627706A CN103627706A CN201310521305.2A CN201310521305A CN103627706A CN 103627706 A CN103627706 A CN 103627706A CN 201310521305 A CN201310521305 A CN 201310521305A CN 103627706 A CN103627706 A CN 103627706A
- Authority
- CN
- China
- Prior art keywords
- plant
- promotor
- nucleotide sequence
- seq
- paddy rice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a promoter OsP004 as well as a preparation method and an application thereof. The nucleotide sequence of the promoter OsP004 is a nucleotide sequence shown by Seq ID No.1 or a nucleotide sequence being complementary to the Seq ID No.1. The promoter OsP004 provided by the invention can be used for regulating the gene expression in a monocotyledon, thus a new tool and choice are provided for the research of the expression of target genes in the monocotyledon.
Description
Technical field
The present invention relates to plant genetic engineering and biological technical field, particularly a kind of promotor, the preparation method of this promotor and application thereof.
Background technology
Promotor refers in gene that the one section of trans factor that can transcribe with RNA polymerase and some other impact is combined and realizes accurately effectively initial DNA sequence dna of transcribing.The initial time of gene expression in plants (transcribing) and the degree of expression are subject to the control of promotor, and the clone of promotor and functional analysis are the important contents of control of plant gene expression research, are also importances of plant genetic engineering research.
According to the transcriptional profile of promotor, can be divided into 3 classes: constitutive promoter, tissue or organ specific promoters and inducible promoter.So-called constitutive promoter refers to that the genetic expression of different tissues organ and etap does not have notable difference, thereby is referred to as constitutive promoter under constitutive promoter regulation and control.The constitutive promoter the most often using in dicotyledons is cauliflower mosaic virus (CaMV) 35S promoter.Some potent promotors in dicotyledons, as efficient promoters such as CsVMV (Cassava VeinMosaic Virus) promotor, tomato E8 promotor, Resveratrol synthase gene Vst1 promotors, also have very strong gene regulating effect in monocotyledons.
People pay much attention to the constitutive promoter from plant clone itself.For example Actin muscle (actin) and the isogenic promotor of ubiquitin (ubiquitin) are cloned.By these promotors, replace CaMV35S promotor, can more effectively in monocotyledons, drive transcribing of foreign gene.Naomi philosophy has been cloned corresponding promotor from the tryptophan synthase subunit gene of Arabidopis thaliana and phytochrome gene, with it, replace CaMV35S promotor, in transgene tobacco, also obtained good expression effect (Plant biotechnology, 2002,19 (1): 19-26).
Promotor common in monocotyledons gene has: Ubi promotor (Plant ubiquitin promoter), Actin promotor (Plant Actin promoter) and Adh-1 promotor (Maize alcohol dehydrogenasel promoter).Factors such as Ubi promotor is high with its starting efficiency, methylation is low, stabilization characteristics of genetics and gaining great popularity.At present, from a lot of ubiquitin genes, separation obtains promoter sequence, comprise Ubi-1 promotor, paddy rice ubiquitin RUBQ2 promotor, Arabidopis thaliana ubiquitin promoter, Sunflower Receptacle ubiquitin UbB1 promotor, tobacco ubiquitin Ubi.U4 promotor, potato ubiquitin Ubi7 promotor, tomato ubiquitin Ubi1-1 promotor in Maize genome, barley ubiquitin Mub1 promotor.Corn ubiquitin Ubi-1 promotor has been widely used in the monocotyledonss such as corn, wheat, paddy rice, and paddy rice ubiquitin RUBQ2 promotor also has more application in paddy rice and sugarcane.Actin promotor nineteen ninety is found first by McElroy of Cornell University etc., belongs to strong constitutive promoter in paddy rice.Actin promotor acts on significantly in unifacial leaf Gramineae, but the gene regulating function in the plant that contiguous section belongs to is but very undesirable.Therefore, many correlative studys are found Actin promotor by other monocotyledonss, and success is found successively in banana, muskmelon, corn and Arabidopis thaliana.Actin promotor, due to the strong regulating and controlling effect to genetic expression, has obtained applying more and more widely in the transgenosis of monocotyledons good character.Adh-1 promoter regulation ADH (alcohol dehydrogenase) gene, most important to the expression of plant ethanol dehydrogenase under anaerobic environment.Particularly cereal grass is as paddy rice, oat and barley to monocotyledons for Adh-1 promotor, and small part dicotyledons is as tobacco, and the adjusting function of gene improves 10-50 doubly than CaMV (cauliflower mosaic virus CaMV) 35S promoter.Adh-1 promotor is mainly used in monocotyledons, and the regulating effect that most dicotyledon genes are expressed is all very limited.
Summary of the invention
The present invention is by the further investigation to rice genome, a kind of new promotor OsP004 is provided, described promotor can be used in the expression of goal gene in regulation and control monocotyledons, simultaneously for destination gene expression in research monocotyledons provides a kind of new instrument and selection.
The object of this invention is to provide a kind of new promotor, can be in plant the expression of regulatory gene.
Another object of the present invention is to provide a kind of nucleic acid construct that contains above-mentioned promotor, carrier, reconstitution cell and plant callus, plant explants or plant.
A further object of the present invention is to provide a kind of primer, preparation method who prepares above-mentioned promotor, and the method for utilizing this promoter regulation gene expression in plants
A further object of the present invention is to provide the preparation method of a kind of transgenic plant, and above-mentioned promotor purposes in destination gene expression or plant breeding in regulating plant.
For achieving the above object, the present invention is by the following technical solutions:
The invention discloses a kind of promotor, this promotor contains and is selected from following any one group and have the nucleotide sequence of promoter function:
Nucleotide sequence shown in a, Seq ID No.1;
B, with the nucleotide sequence of Seq ID No.1 complementation;
C, under high stringent condition can with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b;
D, nucleotide sequence shown in above-mentioned a or b is carried out to the nucleotide sequence that the replacement, disappearance, interpolation of one or more bases are modified;
E, there is the nucleotide sequence of at least 90% identity with nucleotide sequence shown in above-mentioned a or b.
The invention also discloses a kind of nucleic acid construct, comprise above-mentioned promotor, and the gene order being operatively connected with promotor, above-mentioned promotor is identical or different from gene order source.
The invention also discloses a kind of carrier, this carrier contains above-mentioned promotor or nucleic acid construct, and preferably, this carrier is promotor or nucleic acid construct and pMD18-T or the recombinant vectors of p8 plasmid through recombinating and obtaining.
The invention also discloses a kind of reconstitution cell, this reconstitution cell contains above-mentioned promotor or nucleic acid construct or carrier, and preferably, this reconstitution cell is recombinant Bacillus coli cells or restructuring agrobatcerium cell.
The invention also discloses the plant callus, plant explants or the plant that contain above-mentioned promotor, nucleic acid construct, carrier or reconstitution cell, this plant optimization is monocotyledons, be preferably again Oryza, paddy rice more preferably, more preferably paddy rice Japan is fine.
The invention also discloses one group of primer pair; for amplification, obtain above-mentioned promotor; two primers of this primer pair contain respectively the sequence shown in Seq ID No:2 and Seq ID No:3; preferably; these two primers are also connected with respectively restriction enzyme site and/or protection base at 5 ' end; more preferably, two of this primer pair primers have respectively the sequence shown in Seq ID No:4 and Seq ID No:5.
The invention also discloses a kind of method of the Seq of preparation ID No.1 promotor, the method comprises, the fine genomic dna of paddy rice Japan is template, use pair for amplification primer to increase, according to SEQ ID NO:1, the sequence in the fine genome gDNA of paddy rice Japan designs for head and the tail respectively this amplimer, and the primer is above-mentioned primer pair preferably.
The invention also discloses the method for genetic expression in a kind of regulating plant, the method comprises, above-mentioned promotor, nucleic acid construct, carrier or reconstitution cell are imported to vegetable cell; Preferably import plant callus; Further preferred, described plant callus is that this plant optimization is monocotyledons, then is preferably Oryza by the restructuring Agrobacterium-mediated Transformation of above-mentioned promotor or nucleic acid construct or carrier, paddy rice more preferably, and more preferably paddy rice Japan is fine.
The invention also discloses a kind of method of preparing transgenic plant, under the condition that effectively produces plant, cultivate above-mentioned reconstitution cell or plant callus or plant explants or plant; Preferably, this plant callus or plant explants or plant contain above-mentioned promotor or nucleic acid construct or carrier or reconstitution cell; This plant optimization is monocotyledons, then is preferably Oryza, paddy rice more preferably, and japonica rice more preferably, more preferably paddy rice Japan is fine.
The invention also discloses above-mentioned promotor, nucleic acid construct, carrier, reconstitution cell or plant callus or plant explants or the plant purposes in destination gene expression or plant breeding in regulating plant, preferred plant is monocotyledons, preferred plant is Oryza again, more preferably plant is paddy rice, and further preferred plant is that paddy rice Japan is fine.
Owing to having adopted above technical scheme, the beneficial effect that the present invention possesses is:
New promotor provided by the invention can be in plant regulate gene expression, and, in monocotyledons, there is promoter function in as the root of rice seedling, seedling, Rice Anther, rice glume, the expression of foreign gene be can regulate and control, thereby a kind of new instrument and selection provided for studying the expression of goal gene in monocotyledons.
Accompanying drawing explanation
Fig. 1 is for building the pGAMBIA-1301 plasmid schematic diagram of p8 plasmid;
Fig. 2 is p8 plasmid schematic diagram;
Fig. 3 is the GUS coloration result of the Rice Callus through transforming; 3-a: the Rice Callus transforming with the restructuring agrobacterium tumefaciens p8+P004 of promotor P004 sequence of the present invention; 3-b: without the Rice Callus of the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention;
Fig. 4 is the GUS coloration result of the rice seedling through transforming; 4-a: the rice seedling transforming with the restructuring agrobacterium tumefaciens p8+P004 of promotor P004 sequence of the present invention; 4-b: without the rice seedling of the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention;
Fig. 5 is the GUS coloration result of the rice root through transforming; 5-a: the rice root transforming with the restructuring agrobacterium tumefaciens p8+P004 of promotor P004 sequence of the present invention; 5-b: without the rice root of the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention;
Fig. 6 is the GUS coloration result of the rice stem through transforming; 6-a: the rice stem transforming with the restructuring agrobacterium tumefaciens p8+P004 of promotor P004 sequence of the present invention, 6-b: without the rice stem of the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention;
Fig. 7 is the GUS coloration result of the Rice Leaf through transforming; 7-a: the Rice Leaf transforming with the restructuring agrobacterium tumefaciens p8+P004 of promotor P004 sequence of the present invention, 7-b: without the Rice Leaf of the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention;
Fig. 8 is the GUS coloration result of the rice glume through transforming; 8-a: the rice glume transforming with the restructuring agrobacterium tumefaciens p8+P004 of promotor P004 sequence of the present invention, 8-b: without the rice glume of the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention.
Embodiment
Below in conjunction with drawings and Examples, the invention will be further described.
The invention provides a kind of can be in plant the promoter sequence of regulate gene expression, this promotor contains and is selected from following any one group and have the nucleotide sequence of promoter function:
Nucleotide sequence shown in a, Seq ID No.1;
B, with the nucleotide sequence of Seq ID No.1 complementation;
C, under high stringent condition can with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b;
D, nucleotide sequence shown in above-mentioned a or b is carried out to the nucleotide sequence that the replacement, disappearance, interpolation of one or more bases are modified;
E, there is the nucleotide sequence of at least 90% identity with nucleotide sequence shown in above-mentioned a or b.
In the present invention, term " monocotyledons " can be oryza plant paddy rice for example particularly, includes but not limited to that Japan fine, middlely spends 10, middlely spends 11, No. 8, Danjiang River, cloud rice No. 2, Anhui rice 90, Anhui rice 92, Anhui rice 201, Tianjin are former 101, Shan excellent 608 etc.
In the present invention, under described high stringent condition, with shown in Seq ID No.1 or the nucleotide sequence of the nucleotide sequence hybridization complementary with it, it has and the same or analogous promoter activity of nucleotide sequence shown in Seq ID No.1.
In the present invention, described Seq ID No.1 or the nucleotide sequence complementary with it are carried out to the nucleotide sequence that replacement, disappearance, the interpolation of one or more bases are modified, refer to respectively or simultaneously and hold at 5 ＇ ends and/or 3 ＇ of described nucleotide sequence, and/or sequence inside is for example no more than 2-45, or be no more than 3-20, or be no more than 4-15, or be no more than 5-10, or be no more than the replacement of using respectively the base that continuous integral number represents one by one, disappearance, the interpolation modification of 6-8.
In the present invention, the described nucleotide sequence modified as the replacement of the one or more bases of above line, disappearance, interpolation that Seq ID No.1 or the nucleotide sequence complementary with it are carried out, has and the same or analogous promoter activity of nucleotide sequence shown in Seq ID No.1.
By a kind of polynucleotide, describe, the nucleotide sequence that it has, for example refer to reference nucleotide sequence at least 90% identity of Seq ID No.1: in every 100 Nucleotide of the reference nucleotide sequence of Seq ID No.1, the nucleotide sequence of these polynucleotide is except containing the difference that reaches 10 Nucleotide, and the nucleotide sequence of these polynucleotide is identical with reference sequences.In order to obtain the polynucleotide that nucleotide sequence is identical with reference nucleotide sequence at least 90%, in reference sequences, nearly 10% Nucleotide can be deleted or by another nucleotide substitution; Maybe some Nucleotide can be inserted in reference sequences, the Nucleotide wherein inserting can reach 10% of reference sequences total nucleotide; Or in some Nucleotide, there is the combination of deleting, inserting and replacing.
In the present invention, for determining the algorithm of sequence identity and sequence similarity percentage ratio, take BLAST and BLAST2.0 algorithm is example, and they are described in respectively (1990) J.Mol.Bio.215:403-410 such as (1977) Nucl.Acid.Res.25:3389-3402 such as Altschul and Altschul.Adopt described in document or default parameters, BLAST and BLAST2.0 can be used for determining nucleotide sequence homology percentage ratio of the present invention.
In the present invention, nucleotide sequence shown in described and Seq ID No.1 or the nucleotide sequence complementary with it have the nucleotide sequence of at least 90% identity, comprise and Seq ID No.1 or the substantially same polynucleotide sequence of the nucleotide sequence disclosed sequence complementary with it.
The invention also discloses a kind of nucleic acid construct, comprise above-mentioned promotor, and the gene order being operatively connected with this promotor." be operatively connected " the functional space arrangement that refers to two or more Nucleotide region or nucleotide sequence.In constructs of the present invention, promotor is placed in certain specific position of gene nucleic acid sequence, described gene is generally any nucleotide sequence that need to improve transcriptional level, or, can design promotor of the present invention and gene to lower specific nucleic acid sequence.By promotor is connected to realize with antisense orientation gene.
The invention still further relates to a kind of carrier that contains above-mentioned promotor or above-mentioned nucleic acid construct.Carrier of the present invention can be by above-mentioned promotor or above-mentioned nucleic acid construct being inserted into the recombinant vectors that cloning vector or expression vector obtain.Be suitable for building the expression vector of recombinant vectors of the present invention.
The invention further relates to the reconstitution cell that contains promotor of the present invention.Reconstitution cell of the present invention can be by obtaining the above-mentioned recombinant vectors transformed host cell that contains promotor of the present invention.The host cell that is suitable for building reconstitution cell of the present invention includes but not limited to, for example: Bacillus coli cells, agrobacterium tumefaciens cell etc.In concrete embodiment of the present invention, described reconstitution cell is restructuring agrobacterium tumefaciens.
The present invention further discloses a kind of plant callus or plant explants or plant, described callus, plant explants or plant contain above-mentioned promotor of the present invention.Plant callus of the present invention is monocotyledons callus, as Rice Callus.
The present invention also further relates to the one group of primer pair that obtains promotor of the present invention for pcr amplification, and this group primer pair is containing the sequence shown in Seq ID No:2 in ordered list and Seq ID No:3.For the ease of operation, conventionally preferably at 5 ' of primer, hold also design to be connected with restriction enzyme site and/or protection base.In the specific embodiment of the invention, two primers of described primer pair have respectively the sequence shown in Seq ID No:4 and Seq ID No:5.
Adopt above-mentioned primer, the fine genomic dna of paddy rice Japan of take carries out pcr amplification as template, can prepare promotor of the present invention.
The present invention also further discloses the method for genetic expression in a kind of regulating plant, and the method comprises: above-mentioned promotor is imported to vegetable cell.Preferably by the nucleic acid construct that contains foreign gene and promotor of the present invention is imported to the object that vegetable cell reaches regulate gene expression simultaneously.In described nucleic acid construct, foreign gene is operably connected with promotor of the present invention.In the preferred embodiment of the present invention, can utilize the recombinant vectors that contains object foreign gene and promotor of the present invention to transform Agrobacterium, by the restructuring Agrobacterium-mediated Transformation plant callus obtaining, thereby realize, described foreign gene is imported together with promotor of the present invention to the object of vegetable cell again.In concrete embodiment of the present invention, foreign gene is preferably gus gene.Plant of the present invention is monocotyledons.
In the present invention, can adopt plant gene transformation technology that goal gene and described promotor are inserted in plant gene, comprise agrobacterium mediation converted, virus-mediated conversion, microinjection, particle bombardment, via Particle Bombardment Transformation and electroporation etc.This area is known, and agriculture bacillus mediated gene transformation is often used to monocotyledonous gene transformation, but its transformation technology also can be used for the importing of promotor of the present invention and foreign gene.Certainly, the another kind of method that is suitable for promotor of the present invention and foreign gene importing is particle bombardment, (being the DNA that micro-gold or tungsten particle attached bag are covered conversion) embryo callus or embryo's exploitation.The method of the transformed plant cells that can also adopt in addition, is protoplast transformation.After gold and silver transforms, adopt general method to screen and regenerate and be integrated with the plant of expressing unit.
thisin the promotor of invention and regulating plant, the method for genetic expression, can be applied to the seed selection of plant variety.For example, can be used for the breeding of paddy rice.In a specific embodiment of the present invention, described paddy rice is that Japan is fine.
Promotor of the present invention can be described as a kind of new promotor, as genetically modified instrument start-up of plant (particularly monocotyledons), in order to carry out, low expressing gene transformation seedlings screens, the breeding research of plant flower organ abortion equimolecular facilitates, thereby greatly shortens the seed selection time of improved seeds.
thisin invention, monocotyledons is specifically as follows grass, more specifically, can be oryza plant, and for example paddy rice, includes but not limited to that Japan is fine.
Below by embodiment, by reference to the accompanying drawings the present invention is described in further details.Not marked concrete technology or condition in embodiment, according to the described technology of the document in this area or condition (for example, with reference to works such as J. Pehanorm Brookers, the < < molecular cloning experiment guide > > that Huang Peitang etc. translate, the third edition, Science Press), or according to product description carry out.Agents useful for same or the unreceipted production firm of instrument, being can be by the conventional products of commercial acquisition.
The pcr amplification of embodiment 1:P004 promoter fragment and the structure of pMD18-T+P004 recombinant vectors.
One, the pcr amplification of P004 promoter fragment:
Use plant genome DNA to extract test kit (TIANGEN plant genes group DNA extraction test kit, catalog number (Cat.No.): DP320-02) extracting paddy rice Japan fine (has been 200910238992.0 at application number, denomination of invention is " a kind of promotor BgIosP587, Preparation Method And The Use " patent application in preservation, and open on September 22nd, 2010, deposit number is CCTCC NO:P200910) genomic dna, sequence according to this promotor in the fine gDNA of paddy rice Japan, at head and the tail, design one couple of PCR specificity amplification primer (upstream primer F1 respectively, add restriction enzyme site EcoR I and protection base, downstream primer R1, add restriction enzyme site SbfI and protection base).The fine gDNA of paddy rice Japan of said extracted of take is template, uses high-fidelity Ex Taq (TaKaRa, DRR100B) polysaccharase to carry out pcr amplification.As shown in table 1.
The PCR system of table 1 gene promoter amplification
Pcr amplification program is: 94 ℃ of denaturation 5min, and then with 94 ℃ of sex change 45s, 55 ℃ of annealing 50s, 72 ℃ are extended 90s, carry out 35 reaction cycle, and last 72 ℃ are extended 7min.
Wherein, upstream primer F1 (SEQ ID NO:4):
G
gAATT 
wherein underscore represents EcoR I restriction enzyme site, in square frame, is SEQ ID No:2.Downstream primer R1 (SEQ ID NO:5):
TG
cCTGCAGG wherein underscore represents SbfI restriction enzyme site, in square frame, is SEQ ID No:3.
Pcr amplification product is separated through 1.0% agarose gel electrophoresis, obtains the band that size is about 1081bp left and right, uses TIANGEN sepharose DNA to reclaim test kit (catalog number (Cat.No.): DP209-03) carry out purifying recovery.
Two, the structure of pMD18-T+P004 recombinant vectors:
To carry out T/A clone (pMD18-T plasmid, TaKaRa, D103A) as pcr amplification product obtained above, and transform intestinal bacteria, the order-checking of picking positive colony, proves accurately.Wherein, T/A clone's condition of contact is as table 2.
Table 2T/A clone's condition of contact
In 16 ℃, at energy-conserving intelligent thermostatic bath, (the new sesame in Ningbo SDC-6) more than middle connection 8h, obtains pMD18-T+P004 recombinant vectors.Product after above-mentioned connection is transformed to intestinal bacteria as follows:
(Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences provides from Ultralow Temperature Freezer, to take out the competent cell 100 μ l DH5 α that prepare according to Calcium Chloride Method shown in < < molecular cloning experiment guide > > (third edition, Science Press), or can be from for example: the raw work in Shanghai is buied), after melting on ice, add the as above connection product of gained of 10 μ l, it is pMD18-T+P004 recombinant vectors, stir evenly gently, ice bath 30min, 42 ℃ of heat shock 60s, ice bath 5min, add the SOC substratum of 600 μ l4 ℃ precoolings (specifically to fill a prescription and refer to < < molecular cloning experiment guide > >, the third edition, Science Press), 37 ℃ of 220rpm recovery 45min, the centrifugal 30s of 8000rpm, remove supernatant, leave and take 150 μ l, with the mixture after the remaining resuspended precipitation of 150 μ l supernatant, blow gently even, granulated glass sphere coating LB (kantlex) is dull and stereotyped, and (concrete formula refers to < < molecular cloning experiment guide > >, the third edition, Science Press), be inverted for 37 ℃ and cultivate 16h-24h.The recombination bacillus coli that acquisition contains pMD18-T+P004 cloning vector, called after DH5 α-P004.Shenzhen Huada Genetic Technology Co., Ltd checks order to the P004 in pMD18-T+P004 cloning vector.
Sequencing result shows, in the pMD18-T+P004 cloning vector of acquisition, P004 promoter sequence is correct.The sequence of P004 promotor is as shown in Seq ID No:1 in sequence table.
Embodiment 2: the structure of carrier-p8+P004 recombinant vectors.
One, p8 plasmid construction:
The p8 plasmid using in the present invention is that (Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences provides by pCAMBIA-1301 plasmid; Or can buy from for example Shanghai Guo Rui Gene Tech. Company Limited, the primary source of the pCAMBIA-1301 plasmid of the said firm is The CAMBIA Bios (biological open source) Licensee, Australia) transform in the following manner and build, be described as follows:
With Kpn I/Nco I (NEB) double digestion plasmid pCAMBIA-1301 (referring to Fig. 1), reclaim large fragment.According to adopted restriction endonuclease sites, synthesize following sequence:
GGTACCAAGCTTACTAGTCCTGCAGGTCTAGAGGATCCGTCGACCATGG (SEQ ID NO:6) (restriction enzyme site comprising is Kpn I/HindIII/Spe I/Sbf I/Pst I/Xba I/BamH I/SalI/Nco I), with reclaiming after Kpn I/Nco I double digestion, (Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences provides with transforming top10 cell after above-mentioned reclaimed large fragment is connected; Or can be from for example: Beijing Suo Laibao Science and Technology Ltd. buys).With primer GCTTCCGGCTCGTATGTTGT (SEQ ID NO:7)/GAGTCGTCGGTTCTGTAAC (SEQ ID NO:8) screening transformant, by PCR detection method, the transformant that is 350bp with amplified fragments is the transformant of the p8 plasmid that contains multiple clone site that needs build and GUS sequence.P8 plasmid map is shown in Fig. 2.
Length 2353 bases of the multiple clone site in described p8 plasmid and GUS sequence, as shown in SEQ ID NO:9:
GTTGGCAAGCTGCTCTAGCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTACACTTTAT
GCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTAC
GAGCTC 
AAGCTT 
C
G
GGATCC 
CATGGTAGATCTGAGG
As above constructed p8 plasmid in the present invention shown in sequence, EcoR I/Sac I/KpnI/HindIII/Spe I/Sbf I/Pst I/Xba I/BamH I/SalI/Nco I restriction enzyme site in its multiple clone site is respectively with adding frame and underscore represents, screening transformant primer used
GCTTCCGGCTCGTATGTTGT/GAGTCGTCGGTTCTGTAAC (being SEQ ID NO:7 and 8) represents with double underline, and GUS sequence represents by italic, and its intron sequences adds shading by italic respectively and illustrates.
Two, the structure of recombinant vectors p8+P004:
According to restriction enzyme KpnI and SbfI operation instructions, according to resulting cloning vector pMD18-T+P004 in following condition Processing Example 1, and the p8 plasmid building as mentioned above.
Wherein, the enzyme tangent condition of cloning vector pMD18-T+P004 and p8 plasmid following (table 3):
The enzyme tangent condition of table 3 cloning vector pMD18-T+P004 and p8 plasmid
Use TIANGEN sepharose DNA to reclaim test kit (catalog number (Cat.No.): DP209-03) reclaim respectively the p8 plasmid of cutting through enzyme, and promotor P004 Insert Fragment, according to T4 ligase enzyme (TaKaRa, D2011A) operation instructions, according to following (table 4) condition, connect:
Table 4 condition of contact
T4buffer melts on ice, the about 20ng of p8 plasmid vector add-on after enzyme is cut, and the P004 fragment in the present invention adds 10ng.In 16 ℃, at energy-conserving intelligent thermostatic bath, (the new sesame in Ningbo, SDC-6) more than middle connection 8h.
The competent cell DH5 α that 100 μ l Calcium Chloride Method are made takes out from Ultralow Temperature Freezer, after melting, adds the connection product above 10 μ l on ice, stir evenly gently ice bath 30min, 42 ℃ of heat shock 60s, ice bath 5min, adds the SOC of 600 μ l4 ℃ precoolings, 37 ℃ of 220rpm recovery 45min, the centrifugal 30s of 8000rpm, remove supernatant, leave and take 150 μ l, blow gently even, granulated glass sphere coating LB (kan), is inverted for 37 ℃ and cultivates 16-24h.Obtain recombinant vectors p8+P004.
Take F1 (being SEQ ID NO:4) and R1 (being SEQ ID NO:5) respectively as primer pair gained recombinant vectors p8+P004 carries out PCR detection, to confirm in gained recombinant vectors p8+P004, contain required promotor P004.By KpnI and SbfI enzyme, cut screening and contain recombinant vectors p8+P004 transformant.
Embodiment 3: the preparation of restructuring agrobacterium tumefaciens EHA105-P004 cell.
Method builds as described in Example 2 p8+P004 recombinant vectors and p8 plasmid are in contrast transformed respectively to the (third edition according to < < molecular cloning experiment guide > >, agrobacterium tumefaciens EHA105 prepared by the method for calcium chloride Science Press) (has been 200910238992.0 at application number, denomination of invention is " a kind of promotor BgIosP587, Preparation Method And The Use " patent application in preservation, and open on September 22nd, 2010, deposit number is CCTCC NO:M209315) competent cell, concrete grammar is as follows:
Agrobacterium tumefaciens competent cell EHA105 is taken out in Ultralow Temperature Freezer, as for thawing on ice.After thawing, the p8+P004 recombinant vectors and p8 plasmid and the p8 empty carrier in contrast that add respectively 5 μ l, mix gently, ice bath 10min, put into the freezing 5min of liquid nitrogen, 37 ℃ of 5min that thaw, the LB liquid nutrient medium that adds 800 μ l normal temperature, 28 ℃ of 160rpm recovery 3h, the centrifugal 30s of 8000rpm, sucks supernatant, leaving 200 μ l blows even, coat and be added with (50mg/lKan, 10mg/l Rif specifically fill a prescription referring to table 7) on the dual anti-YM solid medium flat board of kan-rif (kantlex-Rifampin).Be inverted for 28 ℃ and cultivate 2-3 days.
Take F1 (being SEQ ID NO:4) and R1 (being SEQ ID NO:5) carries out PCR detection and cuts screening transformant by EcoRI/SbfI enzyme as primer.What pcr amplification went out that about 1081bp left and right band and enzyme cut out about 1081bp left and right band is the restructuring agrobacterium tumefaciens of recombinant vectors p8+P004.
In the present invention, according to the restructuring Agrobacterium with recombinant vectors p8+P004 obtaining as aforesaid method, called after restructuring agrobacterium tumefaciens EHA105-P004.
According to the method for the invention, the restructuring of the contrast with the p8 plasmid Agrobacterium obtaining, called after restructuring agrobacterium tumefaciens EHA105-p8.
Embodiment 4: the induction of Rice Callus and conversion.
Inducing paddy rice callus in accordance with the following steps, and with restructuring agrobacterium tumefaciens EHA105-P004 and restructuring agrobacterium tumefaciens EHA105-p8, transform described callus respectively.
(1) the fine seed of paddy rice Japan is shelled, 70% ethanol surface sterilization 30s, then with the clorox sterilization 30min of available chlorine 1.5%, during acutely shake, after sterilization, with aqua sterilisa, clean 5 times; Seed after sterilization is placed in to N6D substratum (specifically filling a prescription referring to table 5) upper, with sealed membrane, seals; 29.5 ℃ of illumination cultivation 3-4 weeks;
(2) choose the callus (yellow-white, dry, diameter 1-3mm) of active growth, on new N6D substratum, 29.5 ℃ of illumination cultivation are 3 days;
(3) the difference picking single bacterium colony of restructuring agrobacterium tumefaciens (restructuring agrobacterium tumefaciens EHA105-P004 or restructuring agrobacterium tumefaciens EHA105-p8) as constructed in embodiment 3, in adding microbiotic (50mg/lKan, upper streak culture 3 days of YM solid medium 10mg/lRif) (specifically filling a prescription referring to table 7), 28 ℃ of culture temperature; The above-mentioned restructuring agrobacterium tumefaciens of scraping is placed in the AS (Acetosyringone that has added 30 μ l100mM respectively, Syringylethanone) in 30ml AAM substratum (specifically filling a prescription referring to table 8), gentle resuspended described restructuring agrobacterium tumefaciens cell (restructuring agrobacterium tumefaciens EHA105-P004 or restructuring agrobacterium tumefaciens EHA105-p8);
(4) callus of succeeding transfer culture is placed in to sterilizing culture dish; By pouring in culture dish as the restructuring agrobacterium tumefaciens suspension of step 3 preparation, callus is immersed to 15min;
(5) outwell restructuring agrobacterium tumefaciens suspension, callus is sopped up to unnecessary liquid with sterilizing thieving paper; On N6-AS substratum (specifically filling a prescription referring to table 9), put a sterilizing filter paper, add 1ml as the above-mentioned AAM substratum containing AS, callus is transferred on filter paper; Sealing culture dish, 28 ℃ of dark 48～60h that cultivate;
(6) infected callus is placed in to 50ml sterile tube, with aqua sterilisa, shakes cleaning, until supernatant liquor becomes clarification; By callus be soaked in containing in the sterilized water of 500mg/l Pyocianil (Carb) with kill restructuring agrobacterium tumefaciens; With sterilizing thieving paper, remove moisture unnecessary on callus, then transfer them on the N6-AS substratum containing 1mg/l hygromycin B (HmB) and 50mg/l Carb; With sealed membrane, seal culture dish, 29.5 ℃ of illumination cultivation 3-4 weeks.
Embodiment 5: the expression of the GUS in Rice Callus.
For detecting the expression of goal gene GUS in the Rice Callus through transforming described in embodiment 4, according to Chen S Y etc. at Journal of Integrative Plant Biology, 2008,50 (6): the method described in 742-751, to dyeing with the Rice Callus that restructuring agrobacterium tumefaciens EHA105-P004 or restructuring Agrobacterium EHA105-p8 transform respectively.
The formula of GUS staining fluid (1ml): 610 μ l0.2M Na2HPO4 solution (pH=7.0); 390 μ l0.2M NaH2PO4 solution and 10 μ l0.1M X-gluc.
To with the Rice Callus that restructuring agrobacterium tumefaciens EHA105-P004 or restructuring agrobacterium tumefaciens EHA105-p8 transform, be immersed in GUS staining fluid respectively, 37 ℃ of insulations are blue to occurring, take pictures, result as shown in Figure 3, the Rice Callus of the restructuring Agrobacterium-Mediated Transformation of the p8+P004 recombinant vectors through containing promotor (presents blueness after Fig. 3-a) is dyed, through not containing Rice Callus (Fig. 3-b in contrast) color after GUS dyeing of the p8 plasmid restructuring Agrobacterium-Mediated Transformation of promotor, do not change.Result demonstration, P004 promotor of the present invention is expressed and is had regulating and controlling effect gus gene.
Embodiment 6: the expression of GUS in transgenic paddy rice seedling
The callus obtaining in the 4th step is transferred to the MS-R division culture medium differentiation seedling containing 50mg/l hygromycin B (HmB); With sealed membrane, seal culture dish, 29.5 ℃ of illumination cultivation 3-4 weeks; When growing to 3-4cm, seedling transfers to 1/2MS root media (specifically filling a prescription referring to the table 15) screening of taking root containing 50mg/l hygromycin B (HmB).
The GUS dyeing course of transgenic paddy rice seedling is as follows, rice callus GUS staining fluid in same the 5th step of GUS staining fluid:
1, the GUS of the rice seedling through transforming dyeing:
To with the rice seedling that restructuring agrobacterium tumefaciens EHA105-P004 or restructuring agrobacterium tumefaciens EHA105-p8 transform, be immersed in GUS staining fluid respectively, 37 ℃ are incubated 24 hours, seedling is taken out, in the alcohol of immersion 75%, decolour, slough the green of seedling leaves, be convenient to observe the blueness occurring, take pictures, result as shown in Figure 4, the rice seedling being transformed by restructuring agrobacterium tumefaciens p8+P004 with promotor P004 sequence of the present invention (Fig. 4-a) present blueness after GUS dyeing; Rice seedling (contrast, Fig. 4-b) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
2, the GUS of the rice root through transforming dyeing:
To by the rice root that restructuring agrobacterium tumefaciens EHA105-P004 or restructuring agrobacterium tumefaciens EHA105-p8 transform, be immersed in GUS staining fluid respectively, 37 ℃ are incubated 24 hours, taking-up is taken pictures, result is as Fig. 5, by rice root (Fig. 5-a) present blueness after GUS dyeing of the restructuring agrobacterium tumefaciens p8+P004 conversion with promotor P004 sequence of the present invention; Rice root (contrast, Fig. 5-b) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
3, the GUS of the rice stem through transforming dyeing:
To by the rice stem that restructuring agrobacterium tumefaciens EHA105-P004 or restructuring agrobacterium tumefaciens EHA105-p8 transform, be immersed in GUS staining fluid respectively, 37 ℃ are incubated 24 hours, taking-up is taken pictures, result is as Fig. 6, by rice stem (Fig. 6-a) present blueness after GUS dyeing of the restructuring agrobacterium tumefaciens p8+P004 conversion with promotor P004 sequence of the present invention; Rice stem (contrast, Fig. 6-b) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
4, the GUS of the Rice Leaf through transforming dyeing:
To with the Rice Leaf that restructuring agrobacterium tumefaciens EHA105-P004 or restructuring agrobacterium tumefaciens EHA105-p8 transform, be immersed in GUS staining fluid respectively, 37 ℃ are incubated 24 hours, taking-up is taken pictures, result is as Fig. 7, by Rice Leaf (Fig. 7-a) present blueness after GUS dyeing of the restructuring agrobacterium tumefaciens p8+P004 conversion with promotor P004 sequence of the present invention; Rice Leaf (contrast, Fig. 7-b) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
5, the GUS of the rice glume through transforming dyeing:
To with the rice glume that restructuring agrobacterium tumefaciens EHA105-P004 or restructuring agrobacterium tumefaciens EHA105-p8 transform, be immersed in GUS staining fluid respectively, 37 ℃ are incubated 24 hours, taking-up is taken pictures, result is as Fig. 8, by rice glume (Fig. 8-a) present blueness after GUS dyeing of the restructuring agrobacterium tumefaciens p8+P004 conversion with promotor P004 sequence of the present invention; Rice glume (contrast, Fig. 8-b) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
Result demonstration, P004 promotor of the present invention is expressed and is had regulating and controlling effect gus gene.
The relevant culture medium prescription using in the embodiment of the present invention is described as follows:
About alleged " conventional sterilizing " in substratum, refer to below the sterilizing of following condition: at 121 ℃, vapor sterilization is 20 minutes.
Table 5N6D substratum
With 1N potassium hydroxide, regulate pH value to 5.8, sterilizing according to a conventional method after sealing.
N6macro mother liquor (20X): saltpetre 56.60g, potassium primary phosphate 8.00g, ammonium sulfate 9.26g, magnesium sulfate 3.70g, calcium chloride 3.32g, distilled water is settled to 1L, and 4 ℃ save backup.
N6micro mother liquor (1000X): potassiumiodide 0.80g, boric acid 1.60g, manganous sulfate 3.33g, zinc sulfate 1.50g, distilled water is settled to 1L, and 4 ℃ save backup.
Molysite (Fe2EDTA) stock solution (100X): by 3.73g b diammonium disodium edta (Na
2eDTA2H
2o) and 2.78g FeSO
4.7H
2o dissolves respectively, mixes and uses.With distilled water, be settled to 1000ml, 70 ℃ of temperature are bathed 2h, and cooling rear 4 ℃ of preservations are no more than 1 month.
N6 VITAMIN stock solution (1000X): vitamins B
10.10g, vitamins B
60.05g, nicotinic acid 0.05g, glycine 0.20g, adding distil water is settled to 100ml, filtration sterilization, 4 ℃ of preservations are no more than 1 week.
Table 6YM liquid nutrient medium (containing 50mg/L Kan, 10mg/L Rif):
Table 7YM solid medium (containing 50mg/L Kan, 10mg/L Rif)
Table 8AAM substratum
Add 1N potassium hydroxide and regulate pH value to 5.2, conventional sterilizing.
AAM macro (10X): 2.5g magnesium sulfate heptahydrate (MgSO
47H
2o), 1.5g Calcium dichloride dihydrate (CaCl
22H
2o), 1.33g sodium dihydrogen phosphate dihydrate (NaH
2pO
4.2H
2o), distilled water is settled to 1L, and 4 ℃ save backup.
AAM micro (100X): the mono-water manganous sulfate of 0.7g (MnSO
4h
2o), 0.2g Zinc Sulphate Heptahydrate (ZnSO
47H
2o), 0.075g potassiumiodide (KI), 0.3g boric acid (H
3bO
3), 25mg Sodium Molybdate Dihydrate (Na
2moO
4.2H
2o), 2.5mg cupric sulfate pentahydrate (CuSO
4.5H
2o), 2.5mg CoCL2 6H2O (CoCl
2.6H
2o), distilled water is settled to 1L, and 4 ℃ save backup.
AAM organic (1000X): 0.75g glycine (Glycine), 0.1g nicotinic acid (Nicotinic acid), 0.1gVB
6(Pyridoxine), 1g VB
1(Thiamine), distilled water is settled to 100ml, and 4 ℃ save backup.
Molysite (Fe
2eDTA) stock solution (100X): in Table 5.
Table 9N6-AS is substratum altogether
Adjust pH to 5.2.
N6macro mother liquor (20X), Fe
2eDTA stock solution (100X), N6 VITAMIN stock solution (1000X): all in Table 5.
Table 10MS-R division culture medium
Table 111/2MS root media
MS macroelement (20X): 33g ammonium nitrate (NH
4nO
3), 38g saltpetre (KNO
3), 8.8g Calcium dichloride dihydrate (CaCl
22H
2o), 7.4g magnesium sulfate heptahydrate (MgSO
47H
2o), 3.4g potassium primary phosphate (KH
2pO
4), distilled water dissolves one by one, and distilled water is settled to 1L, and 4 ℃ save backup.
MS trace element (1000X): 0.83g potassiumiodide (KI), 6.2g boric acid (H
3bO3), 22.3g tetra-water manganous sulfate (MnSO
44H
2o), 8.6g Zinc Sulphate Heptahydrate (ZnSO
47H
2o), 0.25g Sodium Molybdate Dihydrate (Na
2moO
42H
2o), 0.025g cupric sulfate pentahydrate (CuSO
45H
2o) 0.025g CoCL2 6H2O (CoCl
26H
2o), distilled water dissolves one by one, and distilled water is settled to 1L, and 4 ℃ save backup.
MS organic composition (1000X): 0.5g nicotinic acid, 0.5g pyridoxine hydrochloride (vitamins B
6), 0.5g vitamin (vitamins B
1), 2g glycine, distilled water dissolves one by one, and distilled water is settled to 1L, and 4 ℃ save backup.
Molysite (100X): in Table 5
Inositol (500X): 50g inositol distilled water dissolves, and distilled water is settled to 1L, and 4 ℃ save backup.
Claims (10)
1. a promotor, is characterized in that, described promotor contains and is selected from following any one group and have the nucleotide sequence of promoter function:
Nucleotide sequence shown in a, Seq ID No.1;
B, with the nucleotide sequence of Seq ID No.1 complementation;
C, under high stringent condition can with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b;
D, nucleotide sequence shown in above-mentioned a or b is carried out to the nucleotide sequence that the replacement, disappearance, interpolation of one or more bases are modified;
E, there is the nucleotide sequence of at least 90% identity with nucleotide sequence shown in above-mentioned a or b.
2. a nucleic acid construct, is characterized in that, comprises promotor claimed in claim 1, and the gene order being operatively connected with promotor, and described promotor is identical or different from described gene order source.
3. a carrier, is characterized in that, described carrier contains promotor claimed in claim 1 or nucleic acid construct claimed in claim 2; Preferably, described carrier is promotor claimed in claim 1 or nucleic acid construct claimed in claim 2 and pMD18-T or the recombinant vectors of p8 plasmid through recombinating and obtaining.
4. a reconstitution cell, is characterized in that, described reconstitution cell contains promotor claimed in claim 1 or nucleic acid construct claimed in claim 2 or carrier claimed in claim 3; Described reconstitution cell is recombinant Bacillus coli cells or restructuring agrobatcerium cell.
5. plant callus, plant explants or a plant that contains reconstitution cell described in carrier described in nucleic acid construct described in promotor described in claim 1, claim 2, claim 3, claim 4; Described plant is monocotyledons; Preferably, described plant is Oryza; Preferably, described plant is paddy rice; Preferably, described plant is that paddy rice Japan is fine.
6. one group of primer pair, described primer pair obtains promotor claimed in claim 1 for amplification, it is characterized in that, and two primers of described primer pair contain respectively the sequence shown in Seq ID No:2 and Seq ID No:3; Two described primers are connected with respectively restriction enzyme site and/or protection base at 5 ' end; Preferably, two of described primer pair primers have respectively the sequence shown in Seq ID No:4 and Seq ID No:5;
7. a method of preparing the ID of Seq described in claim 1 No.1 promotor, it is characterized in that, the method comprises, the fine genomic dna of paddy rice Japan of take is template, use pair for amplification primer to increase, described amplimer designs for head and the tail respectively in the sequence in the fine gDNA of paddy rice Japan according to SEQ ID NO:1; Preferably, described amplimer is primer pair claimed in claim 6.
8. the method for genetic expression in a regulating plant, it is characterized in that, the method is, by promotor claimed in claim 1 or nucleic acid construct claimed in claim 2 or carrier claimed in claim 3 or reconstitution cell claimed in claim 4 importing vegetable cell; Described plant is plant callus; Preferably, described plant callus is by having the restructuring Agrobacterium-mediated Transformation of carrier described in nucleic acid construct described in promotor described in claim 1 or claim 2 or claim 3; Preferably, described plant is monocotyledons; Preferably, described plant is Oryza; Preferably, described plant is paddy rice; Preferably, described plant is that paddy rice Japan is fine.
9. a method of preparing transgenic plant, is characterized in that, under the condition that effectively produces plant, cultivates above-mentioned reconstitution cell or plant callus or plant explants or plant; Preferably, described plant callus or plant explants or plant contain promotor claimed in claim 1 or nucleic acid construct claimed in claim 2 or carrier claimed in claim 3 or reconstitution cell claimed in claim 4; Preferably, described plant is monocotyledons; Preferably, described plant is Oryza; Preferably, described plant is paddy rice; Preferably, described plant is that paddy rice Japan is fine.
10. plant callus or plant explants or the plant purposes in destination gene expression or plant breeding in regulating plant described in reconstitution cell or claim 5 described in carrier or claim 4 described in nucleic acid construct or claim 3 described in promotor or claim 2 according to claim 1; Preferably, described plant is for being monocotyledons; Preferably, described plant is Oryza; Preferably, described plant is paddy rice; Preferably, described plant is that paddy rice Japan is fine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310521305.2A CN103627706A (en) | 2013-10-28 | 2013-10-28 | Promoter OsP004 as well as preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310521305.2A CN103627706A (en) | 2013-10-28 | 2013-10-28 | Promoter OsP004 as well as preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103627706A true CN103627706A (en) | 2014-03-12 |
Family
ID=50209155
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310521305.2A Pending CN103627706A (en) | 2013-10-28 | 2013-10-28 | Promoter OsP004 as well as preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103627706A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015161744A1 (en) * | 2014-04-22 | 2015-10-29 | 未名兴旺系统作物设计前沿实验室（北京）有限公司 | Identification and use of promoter ptaasg048 specifically expressed by plant anther |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050066387A1 (en) * | 2003-04-03 | 2005-03-24 | Su-May Yu | Rice glutelin gene promoters |
| US7365185B2 (en) * | 2000-07-19 | 2008-04-29 | Monsanto Technology Llc | Genomic plant sequences and uses thereof |
| CN102146402A (en) * | 2010-12-30 | 2011-08-10 | 深圳华大基因科技有限公司 | BgIosP594 promoter, preparation method and application |
| CN102286481A (en) * | 2004-04-20 | 2011-12-21 | 辛根塔参与股份公司 | Regulartory sequences for expressing gene products in plant reproductive tissue |
| CN102864167A (en) * | 2012-09-26 | 2013-01-09 | 浙江大学 | Plant expression carrier and method for cultivating low-phytic-acid rice |
-
2013
- 2013-10-28 CN CN201310521305.2A patent/CN103627706A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7365185B2 (en) * | 2000-07-19 | 2008-04-29 | Monsanto Technology Llc | Genomic plant sequences and uses thereof |
| US20050066387A1 (en) * | 2003-04-03 | 2005-03-24 | Su-May Yu | Rice glutelin gene promoters |
| CN102286481A (en) * | 2004-04-20 | 2011-12-21 | 辛根塔参与股份公司 | Regulartory sequences for expressing gene products in plant reproductive tissue |
| CN102146402A (en) * | 2010-12-30 | 2011-08-10 | 深圳华大基因科技有限公司 | BgIosP594 promoter, preparation method and application |
| CN102864167A (en) * | 2012-09-26 | 2013-01-09 | 浙江大学 | Plant expression carrier and method for cultivating low-phytic-acid rice |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015161744A1 (en) * | 2014-04-22 | 2015-10-29 | 未名兴旺系统作物设计前沿实验室（北京）有限公司 | Identification and use of promoter ptaasg048 specifically expressed by plant anther |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102146402B (en) | Promoter BgIosP594 , preparation method and application | |
| CN102146410B (en) | BgIosP526 promoter, preparation method and application of BgIosP526 promoter | |
| CN103614378B (en) | A kind of promotor OsP002, preparation method and application thereof | |
| CN102146384B (en) | Promoter BgIosP573, preparation method and application | |
| CN101864418B (en) | Promoter BgIosP513 and preparation method and application thereof | |
| CN103627706A (en) | Promoter OsP004 as well as preparation method and application thereof | |
| CN103614376B (en) | A kind of promotor OsP003, preparation method and application thereof | |
| CN102146406B (en) | Promoter BgIosP535, and preparation method and use thereof | |
| CN102146397B (en) | BgIosP549 promoter, preparation method and application | |
| CN102146399B (en) | Promoter BgIosP581 as well as preparation method and application thereof | |
| CN102146385B (en) | Promoter BgIosP576, and preparation method and use thereof | |
| CN102146407B (en) | Promoter BgIosP 534, and preparation method and application thereof | |
| CN103614377A (en) | Promoter OsP001, and preparation method and application thereof | |
| CN102146405B (en) | Promoter BgIosP529, and preparation method and use thereof | |
| CN103627707A (en) | Promoter OsP006 as well as preparation method and application thereof | |
| CN102146409B (en) | Promoter BgIosP522 as well as preparation method and application thereof | |
| CN102146398B (en) | Promoter BgIosP537, and preparation method and use thereof | |
| CN103627708A (en) | Promoter OsP005 as well as preparation method and application thereof | |
| CN101955937B (en) | Promoter BgIosP519 and preparation method and application thereof | |
| CN102146386B (en) | Promoter BgIosP557, preparation method and application | |
| CN102146408B (en) | Promoter BgIosP 524, and preparation method and application thereof | |
| CN102146387A (en) | Promoter BgIosP 565, and preparation method and application thereof | |
| CN102146389A (en) | BgIosP580 promoter, preparation method and application | |
| CN101967482B (en) | Promoter BglosP536 and preparation method and application thereof | |
| CN102146391A (en) | Promoter BgIosP 520, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140312 |