CN102808038A - Porcine parvovirus LAMP rapid detection primers, detection kit and detection method thereof - Google Patents
Porcine parvovirus LAMP rapid detection primers, detection kit and detection method thereof Download PDFInfo
- Publication number
- CN102808038A CN102808038A CN 201110142726 CN201110142726A CN102808038A CN 102808038 A CN102808038 A CN 102808038A CN 201110142726 CN201110142726 CN 201110142726 CN 201110142726 A CN201110142726 A CN 201110142726A CN 102808038 A CN102808038 A CN 102808038A
- Authority
- CN
- China
- Prior art keywords
- primer
- detection
- porcine parvovirus
- lamp
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to a detection kit for rapid detection of porcine parvovirus by using a loop-mediated isothermal amplification (LAMP) technology, and a detection method thereof. The detection kit comprises a reaction liquid A and a reaction liquid B, wherein the reaction liquid A comprises a 10*Lamp buffer, Bst DNA polymerase with a concentration of 8 U/muL, 10 mM of dNTP, 20-50 muM of inner primer 1, 20-50 muM of inner primer 2, 3-6 muM outer primer 1, 3-6 muM of outer primer 2, 15-25 muM of LooP primer 1, 15-25 muM of LooP primer 2, and 5 M of betaine, and the reaction liquid B comprises 1000* SYBR Green I. According to the detection kit, DNA in a control tissue sample is extracted, LAMP is performed on porcine parvovirus, and color detection is performed on the amplified product so as to detect the porcine parvovirus. With the present invention, defects of long time, large workload, cross contamination, expensive instrument, complex operation, and the like in the prior art are solved. The kit of the present invention has advantages of high specificity, high sensitivity, rapidness, low cost, and simple operation method, wherein a reaction time is only 43 minutes, and the kit and the method are suitable for popularization and on-site rapid detection.
Description
Technical field
The present invention relates to the detection kit and the detection method thereof of the technological rapid detection pig parvoviral of a kind of ring mediated isothermal amplification (LAMP), belong to eqpidemic disease diagnostic techniques in the veterinary biologics field.
Background technology
Pig parvoviral (porcine parvovirus; PPV) can cause the breeding difficulty of pig; Extensively be present in the swinery all over the world; Being characteristic with infected sow output stillborn foetus, monster, mummy tire and sick and weak piglet clinically, already having caused serious financial loss for the large scale of pig farm of each main hog area of the world, also is to become one of current main eqpidemic disease that endangers China's pig industry.
Along with the development of height intensive pig production industry, the control of PPV receives much concern.The numerous disease of pig can cause similar clinical symptom, is difficult to make tentative diagnosis according to clinical symptom, and pathology change also can only make tentative diagnosis.Therefore, clinical quick diagnosis has crucial meaning.At present, set up the detection method of the virus antigens such as separation and Culture evaluation, immunohistochemistry, PCR and quantitative fluorescent PCR of pig parvoviral both at home and abroad; Along with the application of pig parvoviral disease vaccine, two kinds of antiviral antibodies detect the diagnostics effect and have received influence.And viral isolation identification technical requirements is higher, and is time-consuming, is unfavorable for rapid detection and diagnosis.Though PCR and fluorescence quantifying PCR method have a lot of advantages in context of detection, all need expensive instrument, and complicated operation, be inappropriate for on-the-spot quick diagnosis, because the detection cost is higher, also strengthened the difficulty of applying simultaneously.
The isothermal amplification (LAMP) of ring mediation is a kind of novel nucleic acids amplification technique (Notomi by inventions such as T.Notomi; T., et al., Loop-mediated isothermal amplification of DNA.Nucleic Acids Res.2000; 28; E63.), this technology relies on 4 special designed primer and a kind of archaeal dna polymerase with strand displacement characteristic, can be efficiently under isothermal condition, high amplified target sequence specifically.In recent years, this technology is widely used in pathogen detection abroad.
Porcine parvovirus L AMP detection kit and detection method thereof have been arranged in the prior art; CN10157565A and CN101818212A all disclose a LAMP detection kit of porcine parvovirus and detection method thereof; Disclose corresponding designed primer, but in actual use, still existed the configuration of detection kit reasonable inadequately; Reaction system is stable inadequately, and defectives such as the specific aim of the primer that designs and insufficient sensitivity height.
Summary of the invention
The object of the invention just is to overcome above-mentioned defective, develops a kind of porcine parvovirus L AMP detection kit and detection method thereof of practicality.Technical scheme of the present invention is:
One LAMP detection kit of porcine parvovirus comprises following composition:
(1) reaction solution A:
Contain 10 * Lamp buffer, Bst archaeal dna polymerase 8U/ μ l, 2.5 mM dNTP, 20-50 μ M inner primer 1,20-50 μ M inner primer 2,3-6 μ M outer primer 1,3-6 μ M outer primer 2,15-25 μ M LooP primer 1,15-25 μ M LooP primer 2; Trimethyl-glycine (5M); The sterilization ultrapure water, wherein:
1) 10 * Lamp buffer contains 200mM Tris-HCl (8.8,25 ℃ of pH), 100mM Repone K, 100mM ammonium sulfate, 20mM sal epsom and 1% triton x-100;
2) sequence of primer is:
The LP primer 2 is: CAACCTGCACTTAACTCCAACA
(2) reaction solution B:1000 * SYBR Green I.
Porcine parvovirus L AMP detection kit; The composition of the every pipe 22 μ l of its reaction solution A: 2.5 μ l, 10 * Lampbuffer, 1.0 μ l Bst archaeal dna polymerases (8U/ μ l), 4 μ l, 2.5 mM dNTP, 0.5 μ l 20-50 μ M inner primer, 1,0.5 μ l 20-50 μ M inner primer, 2,0.5 μ l 3-6 μ M outer primer, 1,0.5 μ l 3-6 μ M outer primer, 2,0.5 μ l15-25 μ M LooP primer, 1,0.5 μ l 15-25 μ M LooP primer 2,5 μ l trimethyl-glycines (5M) and 6.5 μ l sterilization ultrapure water.
Porcine parvovirus L AMP detection kit detects the detection method of pig parvoviral, and its step comprises:
(1) extraction of DNA in the tissue sample
1. sample collecting: dying pig, the adult pig of slaughtering and children pig in age, aborted fetus are got tissues such as kidney, lung, liver and brain; Live hog to be checked is got blood 2～4mL with syringe, is sent to the laboratory immediately;
2. the processing of sample: every duplicate samples is handled respectively;
3. tissue sample is handled: get the about 0.1g of pathological material of disease to be checked and put and shred in the mill and grind, add 1.5mL saline water and continue grinding.Get ground tissue juice to be checked, put in the 1.5mL sterilization centrifuge tube, the centrifugal 5min of 8000g gets supernatant 445 μ L, adds 10%SDS 50 μ L, and Proteinase K (5mg/ml) 5 μ L behind the mixing, put 1h in 55 ℃ of water-baths;
4. serum sample is handled: after treating blood coagulation, get supernatant and be put in the centrifuge tube, 4 ℃ of centrifugal 5min of 8000g get supernatant 100 μ L; Put in the 1.5mL sterilization centrifuge tube, add 345 μ L Digestive systems, 10%SDS50 μ L; Proteinase K (5mg/ml) 5 μ L behind the mixing, put 1h in 55 ℃ of water-baths;
5. take out the sample of having handled to be checked; Every pipe adds 500 μ L phenol/chloroform/primary isoamyl alcohol mixed solutions (ratio is 24: 23: 1, with not rocking before, is not drawn onto phenol/chloroform/primary isoamyl alcohol liquid upper strata protection liquid); Firmly put upside down mixing 10 times, the centrifugal 10min of 12 000g;
6. get supernatant 450 μ L and put in the 1.5mL sterilization centrifuge tube, add absolute ethyl alcohol, the 45 μ LNaAC (3M) of two volumes, mixing, 30min in-20 ℃.Take out centrifuge tube, room temperature is melted ,-4 ℃ of 12 centrifugal 15min of 000g;
7. abandon supernatant, slowly splash into 75% ethanolic soln of 1ml-20 ℃ of precooling along centrifuge tube opening direction tube wall, outwell after rotation is washed once gently, with centrifuge tube back-off 1min on thieving paper, vacuum is drained 15min;
8. take out centrifuge tube, with 30 μ L sterilization ultrapure water dissolution precipitation, subsequent use as template;
(2) ring mediated isothermal amplification of pig parvoviral
In the reaction tubes that 22 μ l reaction solution A are housed, add 3 μ l DNA to be checked, in 62-64 ℃ of constant water bath box, place 43min;
(3) color developing detection of amplified production
After above-mentioned reaction finishes, add the 1 μ l reaction solution B colour-change that directly detects by an unaided eye, become green like color, then contain pig parvoviral in the interpret sample; If color is orange, explain that sample to be checked does not contain pig parvoviral (seeing accompanying drawing 1).
The present invention compared with prior art; Its advantage and positively effect show: the present invention has set up porcine parvovirus L AMP detection kit and detection method thereof; Present method according to six sequences Design of the gene conserved regions of pig parvoviral two specificity inner primers and two specificity outer primers and two ring primers; This conservative gene sequence is that pig parvoviral is common; And this cover primer is different from the porcine parvovirus L AMP that has announced and detects primer, and its specificity, susceptibility and amplification efficiency all have obvious lifting; Particularly importantly the configuration of present method reagent is more reasonable; The specificity of test kit, susceptibility and stability are all improved; Increased the safety in the testing, test kit lowest detection amount of the present invention can reach 12fgPPV DNA, and the reaction times shortening is merely 43min.The present invention adopts the LAMP technology, and high specificity has higher sensitivity than PCR detection method, but does not need expensive PCR appearance, only needs common metal bath or water bath to get final product, simply and fast.Can be used for the detection of pig parvoviral, be particularly suitable for basic unit's rig-site utilization.
The invention solves long, defectives such as sensitivity is lower, cost is high, rig-site utilization difficulty of required cycle of the method that detects pig parvoviral in the prior art; The detection kit of the pig parvoviral that provides and detection method thereof; Pig parvoviral is carried out LAMP to be detected; Fast, accuracy is high, susceptibility is good, rig-site utilization is convenient, can be widely used in fields such as animal doctor, food, entry and exit quarantine.
Description of drawings
Fig. 1: porcine parvovirus L AMP detects colour developing figure as a result.
The green interpret sample of liquid is positive in 1 reaction tubes.The orange interpret sample of liquid is negative in 2 reaction tubess;
Fig. 2: test kit specific detection result of the present invention: 1:PPV; 2:PPV; 3:PCV2; 4:PRRSV; 5:PEDV; 6:CSFV; 7: negative control.
Fig. 3: test kit sensitivity Detection result of the present invention: 1:10
-1Dilution; 2:10
-2Dilution; 3:10
-3Dilution; 4:10
-4Dilution; 5:10
-5Dilution; 6:10
-6Dilution; 7:10
-7Dilution; 8:10
-8Dilution; 9:10
-9Dilution; 10: negative control.
Embodiment
Following instance further specifies the present invention, but should not be used as restriction of the present invention.
Make the loop-mediated isothermal amplification detection kit of pig parvoviral by following prescription;
1. porcine parvovirus L AMP detection kit detects the detection method of pig parvoviral, and its step comprises:
(1) extraction of DNA in the tissue sample
1. sample collecting: dying pig, the adult pig of slaughtering and children pig in age, aborted fetus are got tissues such as kidney, lung, liver and brain; Live hog to be checked is got blood 2～4mL with syringe, is sent to the laboratory immediately;
2. the processing of sample: every duplicate samples is handled respectively;
3. tissue sample is handled: get the about 0.1g of pathological material of disease to be checked and put and shred in the mill and grind, add 1.5mL saline water and continue grinding.Get ground tissue juice to be checked, put in the 1.5mL sterilization centrifuge tube, the centrifugal 5min of 8000g gets supernatant 445 μ L, adds 10%SDS 50 μ L, and Proteinase K (5mg/ml) 5 μ L behind the mixing, put 1h in 55 ℃ of water-baths;
4. serum sample is handled: after treating blood coagulation, get supernatant and be put in the centrifuge tube, 4 ℃ of centrifugal 5min of 8000g get supernatant 100 μ L; Put in the 1.5mL sterilization centrifuge tube, add 345 μ L Digestive systems, 10%SDS50 μ L; Proteinase K (5mg/ml) 5 μ L behind the mixing, put 1h in 55 ℃ of water-baths;
5. take out the sample of having handled to be checked; Every pipe adds 500 μ L phenol/chloroform/primary isoamyl alcohol mixed solutions (ratio is 24: 23: 1, with not rocking before, is not drawn onto phenol/chloroform/primary isoamyl alcohol liquid upper strata protection liquid); Firmly put upside down mixing 10 times, the centrifugal 10min of 12 000g;
6. get supernatant 450 μ L and put in the 1.5mL sterilization centrifuge tube, add absolute ethyl alcohol, the 45 μ LNaAC (3M) of two volumes, mixing, 30min in-20 ℃.Take out centrifuge tube, room temperature is melted ,-4 ℃ of 12 centrifugal 15min of 000g;
7. abandon supernatant, slowly splash into 75% ethanolic soln of 1ml-20 ℃ of precooling along centrifuge tube opening direction tube wall, outwell after rotation is washed once gently, with centrifuge tube back-off 1min on thieving paper, vacuum is drained 15min;
8. take out centrifuge tube, with 30 μ L sterilization ultrapure water dissolution precipitation, subsequent use as template;
2. the LAMP reaction reagent comprises following composition in the porcine parvovirus L AMP test kit:
(1) reaction solution A:
Contain 10 * Lamp buffer, Bst archaeal dna polymerase 8U/ μ l, 2.5 mM dNTP, 20-50 μ M inner primer 1,20-50 μ M inner primer 2,3-6 μ M outer primer 1,3-6 μ M outer primer 2,15-25 μ M LooP primer 1,15-25 μ M LooP primer 2; Trimethyl-glycine (5M), wherein:
1) 10 * Lamp buffer contains 200mM Tris-HCl (8.8,25 ℃ of pH), 100mM Repone K, 100mM ammonium sulfate, 20mM sal epsom and 1% triton x-100;
2) contained primer sequence is:
The LP primer 2 is: CAACCTGCACTTAACTCCAACA
(2) reaction solution B:1000 * SYBR Green I.
The each reaction of porcine parvovirus L AMP detection kit reaction solution A is made up of 22 μ l; It is prepared as follows: 2.5 μ l, 10 * Lamp buffer, 1.0 μ l Bst archaeal dna polymerases (8U/ μ l), 4 μ l, 2.5 mM dNTP, 0.5 μ l, 40 μ M inner primers, 1,0.5 μ l, 40 μ M inner primers, 2,0.5 μ l, 5 μ M outer primers, 1,0.5 μ l, 5 μ M outer primers, 2,0.5 μ l, 20 μ M LooP primers, 1,0.5 μ l, 20 μ M LooP primer 2s, 5 μ l trimethyl-glycines (5M) and 6.5 μ l sterilization ultrapure water.
(2) ring mediated isothermal amplification of pig parvoviral
In the reaction tubes that 22 μ l reaction solution A are housed, add 3 μ l DNA to be checked, in 62-64 ℃ of constant water bath box, place 43min;
(3) color developing detection of amplified production
After above-mentioned reaction finishes, add μ l reaction solution B, the colour-change that directly detects by an unaided eye becomes green like color, then contains pig parvoviral in the interpret sample; If color is orange, interpret sample does not contain pig parvoviral.
Test Example 1: the effect of test kit of the present invention in detecting PPV: specificity, susceptibility and stability.
One, specificity
1.1 strain: parvovirus (PPV SC strain), pseudo-rabies (PRVLA strain), circovurus type 2 (PCV2), PRRS virus (PRRSV), porcine epizootic diarrhea (PEDV) and swine fever (SFV) are preserved by Binzhou, Shandong Province animal and veterinary research institute.
1.2 extract tissue sample DNA to be detected
1.3 each set of dispense of detection architecture is such as following:
Porcine parvovirus L AMP detection kit reaction solution A is made up of 22 μ l; It is prepared as follows: 2.5 μ l, 10 * Lamp buffer, 1.0 μ l Bst archaeal dna polymerases (8U/ μ l), 4 μ l, 2.5 mM dNTP, 0.5 μ l40 μ M inner primer, 1,0.5 μ l, 40 μ M inner primers, 2,0.5 μ l, 5 μ M outer primers, 1,0.5 μ l, 5 μ M outer primers, 2,0.5 μ l, 20 μ M LooP primers, 1,0.5 μ l, 20 μ M LooP primer 2s, 5 μ l trimethyl-glycines (5M) and 6.5 μ l sterilization ultrapure water.
1.4 the loop-mediated isothermal amplification of pig parvoviral:
In the reaction tubes that 22 μ l reaction solution A are housed, add 3 μ l DNA to be checked, in 62-64 ℃ of constant water bath box, place 43min;
1.5 the color developing detection of amplified production
After above-mentioned reaction finishes, add 1 μ l reaction solution B, the colour-change that directly detects by an unaided eye becomes green like color, then contains pig parvoviral in the interpret sample; If color is orange, interpret sample does not contain pig parvoviral.
1.6 the specificity result of test kit
The result is as shown in Figure 2, can special detection PPV with this test kit, and detected result is positive, specific green fluorescence occurs.And other six kinds with the nucleic acid of PPV correlated virus and to pick up from DNA (negative control) detected result of health pig tissue extraction all negative, specific green fluorescence do not occur, shows that this test kit has very high specificity.
Two, susceptibility
2.1 sample: PPVDNA (original concentration is 12ng/ μ l)
2.2 sample preparation: PPVDNA (original concentration is 12ng/ μ l) is done 10
-1-10
-8Doubling dilution.
2.3 each set of dispense of detection architecture is such as following:
Porcine parvovirus L AMP detection kit reaction solution A is made up of 22 μ l, and it is prepared as follows:
2.5 μ l 10 * Lamp buffer, 1.0 μ l Bst archaeal dna polymerases (8U/ μ l), 4 μ l, 2.5 mM dNTP, 0.5 μ l40 μ M inner primer, 1,0.5 μ l, 40 μ M inner primers, 2,0.5 μ l, 5 μ M outer primers, 1,0.5 μ l, 5 μ M outer primers, 2,0.5 μ l, 20 μ M LooP primers, 1,0.5 μ l, 20 μ M LooP primer 2s, 5 μ l trimethyl-glycines (5M) and 6.5 μ l sterilization ultrapure water.
2.4 the loop-mediated isothermal amplification of pig parvoviral:
In the reaction tubes that 22 μ l reaction solution A are housed, add 3 μ l DNA to be checked, in 62-64 ℃ of constant water bath box, place 43min;
2.5 the color developing detection of amplified production
After above-mentioned reaction finishes, add 1 μ l reaction solution B, the colour-change that directly detects by an unaided eye becomes green like color, then contains pig parvoviral in the interpret sample; If color is orange, interpret sample does not contain pig parvoviral.
2.6 the susceptibility result of test kit
The result is as shown in Figure 3, and test-results shows: adopt test kit lowest detection 12 fg PPV DNA of the present invention, show that test kit of the present invention has very high susceptibility.
Three, stability
3.1 sample: PPV positive
3.2 sample preparation
This is detected same lot sample respectively 3 times with the detection kit that the present invention sets up by 3 different personnel interval 3 d, 7 d.
3.3 each set of dispense of detection architecture is such as following:
Porcine parvovirus L AMP detection kit reaction solution A is made up of 22 μ l; It is prepared as follows: 2.5 μ l, 10 * Lamp buffer, 1.0 μ l Bst archaeal dna polymerases (8U/ μ l), 4 μ l, 2.5 mM dNTP, 0.5 μ l40 μ M inner primer, 1,0.5 μ l, 40 μ M inner primers, 2,0.5 μ l, 5 μ M outer primers, 1,0.5 μ l, 5 μ M outer primers, 2,0.5 μ l, 20 μ M LooP primers, 1,0.5 μ l, 20 μ M LooP primer 2s, 5 μ l trimethyl-glycines (5M) and 6.5 μ l sterilization ultrapure water.
3.4 the loop-mediated isothermal amplification of pig parvoviral:
In the reaction tubes that 22 μ l reaction solution A are housed, add 3 μ l DNA to be checked, in 62-64 ℃ of constant water bath box, place 43min;
3.5 the color developing detection of amplified production
After above-mentioned reaction finishes, add 1 μ l reaction solution B, the colour-change that directly detects by an unaided eye becomes green like color, then contains pig parvoviral in the interpret sample; If color is orange, interpret sample does not contain pig parvoviral.
3.6 the stability result of test kit
Test-results shows: the interassay coefficient of variation that adopts test kit of the present invention to detect sample is 4.7%, shows that test kit of the present invention has very high stability.
Claims (5)
1. a LAMP detection kit of porcine parvovirus comprises and extracts DNA reagent and two components of LAMP reaction reagent, it is characterized in that described reaction reagent comprises following composition:
(1) the DNA extraction reagent according to the LAMP detection kit of porcine parvovirus described in the claim 1 comprises: the NaAC of the SDS of concentration 10%, the Proteinase K of concentration 5mg/ml and concentration 3M.
(2) reaction solution according to the LAMP detection kit of porcine parvovirus described in the claim 1 contains 10 * Lamp buffer, Bst archaeal dna polymerase 8U/ μ l, 2.5 mM dNTP, 20-50 μ M inner primer 1,20-50 μ M inner primer 2,3-6 μ M outer primer 1,3-6 μ M outer primer 2,15-25 μ M LooP primer 1,15-25 μ M LooP primer 2; Trimethyl-glycine (5M), wherein:
10 * Lamp buffer contains the Tris-HCl of 8.8,25 ℃ of 200mM, pH, 100mM Repone K, 100mM ammonium sulfate, 20mM sal epsom and 1% triton x-100;
2. the contained primer sequence according to the LAMP detection kit of porcine parvovirus described in the claim 1 is:
Inner primer 1 is: GTCCTCCTGTATTGGAGTTGCTGTTTTTCCACATCAGTGAAAACTTCG
Inner primer 2 is: CGAGCCAACAACACCAACTTTTTTGTCCGTATTGCTGAATCTGG
Outer primer 1 is: ACACCAACAGACTCTCAGA
Outer primer 2 is: GGTTTCTATTTCCGACCAAG
LP primer 1 is: CGTAGTTGTTGTCCGCTGG
The LP primer 2 is: CAACCTGCACTTAACTCCAACA
3. according to a LAMP detection kit of porcine parvovirus reaction solution B:1000 * SYBR Green I described in the claim 1.
4. according to the LAMP detection kit of porcine parvovirus described in the claim 1; It is characterized in that the each reaction of reaction solution A is made up of 22 μ l: the archaeal dna polymerase of the 8U/ μ l of 2.5 μ l, 10 * Lamp buffer, 1.0 μ l Bst, 4 μ l, 2.5 mM dNTP, 0.5 μ l 20-50 μ M inner primer, 1,0.5 μ l 20-50 μ M inner primer, 2,0.5 μ l 3-6 μ M outer primer, 1,0.5 μ l 3-6 μ M outer primer, 2,0.5 μ l 15-25 μ M LooP primer, 1,0.5 μ l15-25 μ M LooP primer 2, the 5M trimethyl-glycine of 5 μ l and the 6.5 μ l ultrapure water of sterilizing.
5. detect the detection method of pig parvoviral according to the LAMP detection kit of porcine parvovirus described in the claim 1, its step comprises:
(1) extraction of DNA in the tissue sample
1. sample collecting: dying pig, the adult pig of slaughtering and children pig in age, aborted fetus are got tissues such as kidney, lung, liver and brain; Live hog to be checked is got blood 2～4mL with syringe, is sent to the laboratory immediately;
2. the processing of sample: every duplicate samples is handled respectively;
3. tissue sample is handled: get the about 0.1g of pathological material of disease to be checked and put and shred in the mill and grind, add 1.5mL saline water and continue grinding.Get ground tissue juice to be checked, put in the 1.5mL sterilization centrifuge tube, the centrifugal 5min of 8000g gets supernatant 445 μ L, adds 10%SDS 50 μ L, and the 5mg/ml Proteinase K of 5 μ L behind the mixing, is put 1h in 55 ℃ of water-baths;
4. serum sample is handled: after treating blood coagulation, get supernatant and be put in the centrifuge tube, 4 ℃ of centrifugal 5min of 8000g get supernatant 100 μ L; Put in the 1.5mL sterilization centrifuge tube, add 345 μ L Digestive systems, 10%SDS50 μ L; The 5mg/ml Proteinase K of 5 μ L behind the mixing, is put 1h in 55 ℃ of water-baths;
5. take out the sample of having handled to be checked; Ratio is 24: 23: 1, and with not rocking before, the every pipe that is not drawn onto phenol/chloroform/primary isoamyl alcohol liquid upper strata protection liquid adds 500 μ L phenol/chloroform/primary isoamyl alcohol mixed solutions; Firmly put upside down mixing 10 times, the centrifugal 10min of 12 000g;
6. get supernatant 450 μ L and put in the 1.5mL sterilization centrifuge tube, add the absolute ethyl alcohol of two volumes, the NaAC of 45 μ l3M, mixing, 30min in-20 ℃.Take out centrifuge tube, room temperature is melted ,-4 ℃ of centrifugal 15min of 12000g;
7. abandon supernatant, slowly splash into 75% ethanolic soln of 1ml-20 ℃ of precooling along centrifuge tube opening direction tube wall, outwell after rotation is washed once gently, with centrifuge tube back-off 1min on thieving paper, vacuum is drained 15min;
8. take out centrifuge tube, with 30 μ L sterilization ultrapure water dissolution precipitation, subsequent use as template;
(2) ring mediated isothermal amplification of pig parvoviral
In the reaction tubes that 22 μ l reaction solution A are housed, add 3 μ l DNA to be checked, in 62-64 ℃ of constant water bath box, place 43min;
(3) color developing detection of amplified production
After above-mentioned reaction finishes, add 1 μ l reaction solution B: the colour-change that directly detects by an unaided eye, color becomes green, then contains pig parvoviral in the interpret sample; Color is orange, and interpret sample does not contain pig parvoviral.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110142726 CN102808038A (en) | 2011-05-30 | 2011-05-30 | Porcine parvovirus LAMP rapid detection primers, detection kit and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110142726 CN102808038A (en) | 2011-05-30 | 2011-05-30 | Porcine parvovirus LAMP rapid detection primers, detection kit and detection method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102808038A true CN102808038A (en) | 2012-12-05 |
Family
ID=47231907
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110142726 Pending CN102808038A (en) | 2011-05-30 | 2011-05-30 | Porcine parvovirus LAMP rapid detection primers, detection kit and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102808038A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103088164A (en) * | 2013-01-31 | 2013-05-08 | 福建农林大学 | Loop-mediated isothermal amplification reaction primer for detecting porcine parvovirus II |
| CN105349702A (en) * | 2015-11-27 | 2016-02-24 | 广西壮族自治区兽医研究所 | PPV (porcine parvovirus) LAMP (loop-mediated isothermal amplification) kit and application thereof |
| CN106435015A (en) * | 2016-08-30 | 2017-02-22 | 中国农业科学院兰州兽医研究所 | Rapidly color developing LAMP kit for one-step detection of porcine parvoviruses |
-
2011
- 2011-05-30 CN CN 201110142726 patent/CN102808038A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103088164A (en) * | 2013-01-31 | 2013-05-08 | 福建农林大学 | Loop-mediated isothermal amplification reaction primer for detecting porcine parvovirus II |
| CN105349702A (en) * | 2015-11-27 | 2016-02-24 | 广西壮族自治区兽医研究所 | PPV (porcine parvovirus) LAMP (loop-mediated isothermal amplification) kit and application thereof |
| CN106435015A (en) * | 2016-08-30 | 2017-02-22 | 中国农业科学院兰州兽医研究所 | Rapidly color developing LAMP kit for one-step detection of porcine parvoviruses |
| CN106435015B (en) * | 2016-08-30 | 2019-07-26 | 中国农业科学院兰州兽医研究所 | A kind of LAMP kit of quick colour-developing one-step method detection pig parvoviral |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102002531B (en) | Toxoplasma gondii detection kit and application thereof | |
| CN101886138A (en) | Three-color fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) combined detection method of enterovirus 71, Coxsackie virus A16 and other subtypes of enterovirus as well as kit thereof | |
| CN102154510B (en) | Nucleic acid quantitative detection kit for hepatitis C virus (HCV) | |
| CN103060473B (en) | Herpes virus EBV (Epstein-Barr Virus) detection kit | |
| US20200232015A1 (en) | Method for detecting brucella infection and application thereof | |
| CN103409555B (en) | Macrobrachium rosenbergii Nodavirus RT-LAMP-LFD detection method and detection kit thereof | |
| CN100359023C (en) | Multiple RT-PCR identification and detection reagent for animal vesicular disease and preparation method and use thereof | |
| CN102199665A (en) | LAMP (loop-mediated isothermal amplification) rapid detection kit and detection method for salmonella | |
| CN104846122A (en) | Nucleic acid detection kit of enterovirus type 71 (EV71) and coxsackievirus type A16 (CA16) (fluorescent polymerase chain reaction (PCR) method) | |
| CN109136410A (en) | Feline Panleukopenia Virus LAMP detection primer group, kit and detection method | |
| Gou et al. | The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3 | |
| CN105695624A (en) | Rapid identification method for different species of crude heparin sodium | |
| CN102808038A (en) | Porcine parvovirus LAMP rapid detection primers, detection kit and detection method thereof | |
| CN101886139A (en) | Double-color fluorescence polymerase chain reaction (PCR) detection method of novel influenza A virus H1N1 subtype and kit thereof | |
| CN107365684B (en) | A kind of paper micro-fluidic chip and its method for extracting nucleic acid and isothermal amplification method | |
| CN101724712B (en) | Animal insect-borne disease multi-RT-PCR distinguishing and detecting reagent as well as preparation method and application | |
| CN105349661A (en) | Chlamydia trachomatis and gonococcus nucleic acid detection kit | |
| CN112899398A (en) | Fluorescent PCR (polymerase chain reaction) detection kit for African swine fever virus and use method thereof | |
| CN105238880A (en) | Enterovirus real-time fluorescent quantitative detection kit | |
| CN102649985B (en) | Reverse transcription-loop-mediated isothermal amplification (RT-LAMP) visual detection kit for H1N2 avian influenza viruses | |
| CN102002539B (en) | Porcine parvovirus assay kit and application thereof | |
| CN113930418B (en) | Nucleic acid releasing agent and nucleic acid releasing method thereof | |
| CN102978282A (en) | Typhoid fever salmonella and salmonella paratyphi fluorescent quantitative polymerase chain reaction (PCR) detection kit and application thereof | |
| CN104278024B (en) | For identifying Primer composition and their application of human adenovirus 55 type | |
| AU2021103861A4 (en) | Method and kit for differentially detecting porcine pseudorabies vaccine virus and wild virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20121205 |