CN102807991A - Application of deinococcus radiodurans R1 trkB genes to cultivation of salt-tolerant plants - Google Patents

Abstract

The invention discovers that trkB genes (DR1667) in Deinococcus radiodurans R1 are capable of enhancing resistance capability of prokaryotes and plants. Recombinant vectors comprising the trkB genes (DR1667) are constructed and are respectively transferred into prokaryotic and eukaryotic host cells. Experiments prove that salt tolerance of the prokaryotic host cells and rape can be enhanced after the trkB genes (DR1667) are expressed in the prokaryotic host cells and rape.

Description

Radiation hardness abnormal cocci R1 trkB gene is cultivated the application of salt-tolerant plant

Technical field

The present invention relates to radiation hardness abnormal cocci R1 (Deinococcus radiodurans R1) trkB gene (DR1667, new function GeneID:1799538), be specifically related to this gene in enhancement of plant to the application aspect the salt stress resistance.

Background technology

Saline and alkaline being lost in of causing of farm crop accounted for first place (Dracup et al., 1998) in all abiotic stress.Radiation hardness abnormal cocci R1 (D.radiodurans R1) is because of having extremely strong resistance to secular drying and strong oxidative stress, and becomes the desirable strain of research mikrobe abiotic stress adaptation mechanism.

HKT (high-affinity K+transporter) gene family translocator has can regulate K in the plant materials ⁺/ Na ⁺The equilibrated ability extensively is present in plant, fungi, eubacterium and the archeobacteria.Radiation hardness abnormal cocci R1 (D.radiodurans R1) contains 2 HKT proteinoids, transports in close relations closely relatedly with plant Na+, and secular drying and strong oxidative stress are had extremely strong resistance.

Potassium is one of essential nutritive element of plant materials, and sodium is the functional element of plant-growth, and is useful on a small quantity for most plants, excessively then can produce murder by poisoning.Plant mainly leans on its intravital channel protein and transport vehicle to their absorption.Getting in touch closely of the K translocator of plant HKT translocator and fungi Trk translocator, procaryotic KtrB and TrkH, the Trk translocator is a main K absorption system under the low K concentration in the fungi.All possibly have the HKT translocator in the most plants, this gene family is not very big, and this family has only a member in Arabidopis thaliana.Sequential analysis infers that the translocator of this family possibly striden the K passage of membrane structure by 2 times of bacterium and evolved, and forms a present pore structure albumen of striding film and 4 circles for 8 times.The HKT family gene mainly is divided into 2 subfamilies; Subfamily 1 member is the low affinity translocator of specific Na; Major part is distributed on the cytoplasmic membrane of root system center pillar, especially on the xylem parenchyma cell film, is responsible for from xylem sap, obtaining Na again and stops its transportation to overground part; And the subfamily 2 members high affinity translocator that is K/Na, thereby especially under K shortage condition, be responsible for the absorption of Na is promoted the growth of crop, mainly be distributed on the cortex and endodermis cytolemma of root system.

Deinococcus radiodurans (D.radiodurans) is one of biology of the highest radiation resistance in the known organism so far.This bacterium has the extreme resistance of ionizing rays, UV radiation and dna damage reagent to lethal dose, the complete recovery of genome that can ionizing rays be caused up to a hundred dna double splitting of chain as before, and the ability of not undergoing mutation.1999 gene studies institute (TIGR) accomplish and announced D.radiodurans genom sequence (White 1999).Although radiation hardness bacterial strain and drought stress resistance possibly have synergetic property on evolving; But do not see trkB gene (DR1667, GeneID:1799538) research of the function aspect enhancement of plant salt tolerance report among the different coccus Deinococcus of the radiation hardness radiodurans R1 at present.

Summary of the invention

The objective of the invention is from D.radiodurans R1 genome to find can enhancement of plant to the resistant gene of high salt.And, make the plant that changes this gene over to obtain the ability of salt tolerant with this gene transferred plant.

The present invention is through discover as follows, finds first, the trkB gene of the Deinococcus radiodurans R1 of sequence shown in the SEQ ID NO:1 (DR1667 GeneID:1799538) has the function of salt stress-resistant, can be used for cultivating the plant of salt-tolerance character:

1, obtains to contain the recombinant strain of D.radiodurans R1 trkB gene (DR1667)

1) amplify D.radiodurans R1trkB gene (DR1667) through PCR from D.radiodurans R1 (DSM 20539) strain gene group, gene order number is: GeneID:1799538.Its size is 1377bp, and 456 amino acid of this genes encoding are cloned it on carrier pGEMT-easy, have made up the recombinant plasmid pGEMT-trkB that contains complete trkB gene;

2) trkB gene (DR1667) is connected on the pRADZ3 shuttle plasmid; This plasmid contain can be in intestinal bacteria and the different coccus of radiation hardness all acting groEL promotor, make up complete trkB gene (DR1667) the recombinant plasmid pRADZ3-trkB G that contains the groEL promotor;

The recombinant plasmid pRADZ3-trkB G that 3) will import trkB gene (DR1667) changes in the acceptor e. coli jm109, obtains engineering strain JM-trkB (seeing embodiment 1 for details);

2, contain the salt tolerant experiment of D.radiodurans R1 trkB engineering strain

Experiment confirm, after 4M NaCl impacted, the JM-trkB recombinant bacterial strain upgrowth situation that contains D.radiodurans R1 trkB gene (DR1667) was good, and colony count is higher than the JM-Z3 bacterial strain (seeing embodiment 2 and Fig. 4) that only contains empty plasmid.Engineering bacillus strain has the ballistic ability of tolerance 4M NaCl.

This experiment shows: D.radiodurans R1 trkB gene (DR1667) has the ability that strengthens procaryotic biological salt-resistant.

3, trkB gene (DR1667) is expressed in rape and the salt tolerant resistance of transfer-gen plant is identified

1) D.radiodurans R1 trkB gene (DR1667) is connected among the plant expression vector pBI121, makes up recombinant plasmid pBI121-trkB with trkB gene (DR1667);

2) with in the pBI121-trkB recombinant plasmid transformed rape, obtained can salt tolerant the transgene rape plant;

This experiment shows: D.radiodurans R1 trkB gene (DR1667) has the purposes (seeing embodiment 3 and Fig. 5～6) of cultivating salt-tolerant plant.

Description of drawings:

Fig. 1 is the PCR product checking electrophoretogram that contains D.radiodurans R1 trkB gene (DR1667) sequence;

Fig. 2 is the construction of prokaryotic expression vector checking electrophoretogram that contains D.radiodurans R1 trkB gene (DR1667) and groEL promotor;

Fig. 3 is the bacterium colony photo that contains the empty carrier and the colibacillary upgrowth situation of the prokaryotic expression carrier that contains D.radiodurans R1 trkB gene (DR1667) sequence before high salt concentration (4M NaCl) impacts, wherein:

A is intestinal bacteria JM 109 bacterial strains that contain empty expression vector;

B is the intestinal bacteria recombinant bacterial strain that contains D.radiodurans R1 trkB gene (DR1667) expression vector;

Fig. 4 is the bacterium colony photo of the growing state of intestinal bacteria (E.coli) in containing 4M NaCl substratum that contains prokaryotic expression carrier and the empty carrier of D.radiodurans R1 trkB gene (DR1667), and the bacterial strain among the figure is following:

A is intestinal bacteria JM 109 bacterial strains that contain empty expression vector;

B is the intestinal bacteria recombinant bacterial strain that contains D.radiodurans R1 trkB gene (DR1667) expression vector.

Fig. 5 is a non-transgenic rape after cultivating 15 days on the substratum of 250mmol NaCl, wilts;

Fig. 6 is a transgene rape after cultivating 15 days on the substratum of 250mmol NaCl, transgene rape can be under the coercing of the NaCl that contains 250mmol normal growth.

Embodiment

The plasmid of being lifted in following examples, bacterial strain only are used for the present invention is done further explain, flesh and blood of the present invention are not limited.All unreceipted concrete experiment conditions; Be according to normal condition well known to those skilled in the art; For example the Sambrook equimolecular is cloned: laboratory manual (New York:Cold Spring Harbor Laboratory Press; 1989) condition described in, or the condition of advising according to manufacturer.

Plasmid, the bacterium source lifted among the embodiment are following:

Cloning vector pGEMT-easy: be Promrga company commercially available prod;

Shuttle plasmid pRADZ3: for preserving in this laboratory;

Plant expression vector pBI121: be Clontech company commercially available prod;

Intestinal bacteria JM 109: be the full formula in Beijing King Company commercially available prod.Agrobacterium tumefaciens EHA 105 is preserved by this laboratory.

Embodiment 1 expression of D.radiodurans R1 trkB gene (DR1667) sequence in intestinal bacteria

According to the 1 pair of PCR Auele Specific Primer of trkB gene (DR1667) sequences Design in the D.radiodurans R1 genome of having announced:

Up?5′ATTAACTAGTATGACCCGGAACGCCGCGCT?3′

Down?5′ACGCCATATGCTACCCCACCAGAATGTCGT3

From D.radiodurans R1 genomic dna, amplify target gene sequences through PCR method.Reaction conditions: 94 ℃ of 10min, [94 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 1.5min] 35 circulations, 72 ℃ of 10min.The PCR product is cloned on carrier pGEMT-easy called after pGEMT-trkB, and sequence verification after glue reclaims; Obtain to contain the trkB gene (DR1667) of sticky end through the SpeI/NdeI double digestion then and contain the pRADZ3 carrier of promotor groEL; TrkB gene (DR1667) is connected on the pRAD Z3 carrier, makes up coli expression carrier pRADZ3-trkB G, this expression vector transformed into escherichia coli JM109; Cut through PCR, enzyme; Sequence verification insertion sequence correct (seeing Fig. 1,2) is with this bacterial strain called after JM-trkB.

The E.coli JM109 called after JM-Z3 that will contain the pRADZ3 empty plasmid.

Embodiment 2 contains the salt tolerant experiment of D.radiodurans R1 trkB gene (DR1667) recombinant bacterial strain

One, experimental technique

1, the intestinal bacteria with 2 reorganization that obtain among the embodiment 1 are inoculated in respectively in the 20mL LB liquid nutrient medium (containing the Amp microbiotic); Shake (37 ℃) after bottle incubated overnight; Transfer again in the LB of 100mL liquid nutrient medium, keep the unanimity of inoculum size as far as possible, be cultured to OD ₆₀₀About about 0.5 (keep OD as far as possible ₆₀₀Value is consistent).

2, get the bacterium liquid of 10mL centrifugal after, in isopyknic 4M NaCl solution, impact 2h, each sample is used aseptic deionized water doubling dilution to 10 immediately ^-4, get 10 μ L points at LB solid culture primary surface, through 37 ℃ of cultivation 16h, observe bacterium colony formation situation and also take a picture.

Two, experimental result

Fig. 3 shows, before the 4M NaCl fluid challenge, contains the JM-trkB bacterial strain and the JM-Z3 strain growth state basically identical that contains empty plasmid of D.radiodurans R1 trkB gene (DR1667); Behind the 4M NaCl fluid challenge, the JM-trkB recombinant bacterial strain upgrowth situation that contains D.radiodurans R1 trkB gene (DR1667) is good, and colony count is more than the JM-Z3 bacterial strain (see figure 4) that only contains empty plasmid.

Three, experiment conclusion

D.radiodurans R1 trkB gene (DR1667) has strengthened the ability of procaryotic biological salt-resistant.

Embodiment 3 trkB genes (DR1667) are expressed in rape and the salt tolerance of transfer-gen plant is identified

(1) agrobacterium mediation converted rape experiment

1. the competent preparation of agrobacterium tumefaciens EHA105

1) picking list bacterium colony is inoculated in 5mL YEB liquid nutrient medium (containing Rifampin Rif 50mg/L), and 28 ℃, 250 rpm shaking culture are spent the night;

2) get 2mL bacterium liquid, add in the 50mL YEB liquid nutrient medium (containing Rif 50mg/L), 28 ℃, the 250rpm shaking culture is to OD ₆₀₀About about 0.6;

3) bacterium liquid is gone in the aseptic centrifuge tube of 50mL ice bath 30min, the centrifugal 5min of 5000 * g;

4) abandon supernatant, deposition is with 2mL 20mM CaCl ₂Resuspended, every part 100 μ L branch installs in the 1.5mL centrifuge tube, preserves subsequent use in the liquid nitrogen.

2. recombinant plasmid dna changes Agrobacterium over to

1) the pBI121-trkB DNA with about 1 μ g joins in the 100 μ L EHA105 competent cells mixing, ice bath 5min respectively;

2) centrifuge tube is put freezing 8min in the liquid nitrogen, go to temperature bath 5min in 37 ° of C water-baths rapidly;

3) add 1mL YEB liquid nutrient medium, 250rpm recovery 4～5h on 28 ℃ of shaking tables;

4) get an amount of bacterium liquid and be applied on the YEB solid medium that contains Rifampin (Rif) 50mg/L and kantlex (Kan) 100mg/L, put 28 ℃ and cultivate 24～48h.

3. the extraction of Agrobacterium DNA

1) picking colony (YEB: Tryptones 5g/L, yeast extract 1g/L, sucrose 5g/L, sal epsom 0.5g/L) in the YEB liquid nutrient medium that contains Rifampin (Rif) 50mg/L and kantlex (Kan) 100mg/L, 28 ° of C, 250rpm shaking culture 20h;

2) get 1.5mL bacterium liquid centrifugal after, abandon supernatant, with STE solution (Tris-HCI 10mM pH8.0; NaCl 10mM, EDTA 10mM pH 8.0) wash 2 times, abandon supernatant; The solution I (50mM glucose, 25mM Tris-HCl pH8.0, the 10mM EDTA pH 8.0 that add precooling; RNase A 100 μ g/mL) 300 μ L aspirate mixing repeatedly with pipettor, and room temperature leaves standstill 10min;

3) (solution II of the fresh configuration of adding turns upside down mixing several times for 0.2M NaOH, 1%SDS) 600 μ L;

4) solution III (5M potassium acetate pH 5.2, Glacial acetic acid min. 99.5 11.5mL adds water to 100mL) the 450 μ L of adding precooling, abundant mixing, ice bath 5min, 4 ° of centrifugal 5min of C 12000 * g, supernatant adds the isopropanol precipitating of 0.6 times of volume;

5) after deposition adds 50 μ L TE (pH 8.0 for Tris-HCl 10mmol/L, 1mmol/L EDTA) dissolving, through PCR, Bam HI, the checking of Sac I double digestion.

4. the preparation of rape aseptic seedling and agriculture bacillus mediated trkB gene (DR1667) genetic transformation

1) cultivation of rape aseptic seedling

Swede type rape (Brassica napus L.) (84100-18) seed soaks 10min with aqua sterilisa on Bechtop; 10% NaClO sterilization 12min; Again with 0.1% mercuric chloride solution sterilization 7-8min; With sterilization washing 3-5 time, and be placed in the Semen Brassicae campestris of sterilization equably on the pre-culture medium of no hormone (7.5% agar).Illumination cultivation, 4-5d rape in age seedling is suitable for genetic transformation most.

2) cultivate in advance

The scissors of alcohol with 75% and high-temperature sterilization sterilization is cut cotyledon and vegetative point, and clip rape aseptic seedling next-door neighbour vegetative point is the long hypocotyl of about 0.5cm down, places pre-culture medium (MS+6-BA 2mg/L+2,4-D 1mg/L+AgNO ₃2.5mg/L+AS 19.62mg/L), 2d is cultivated in illumination in advance.

3) cultivation of Agrobacterium

In 50mL LB liquid nutrient medium (containing kantlex 100mg/L, Rifampin 50mg/L), add 0.1mLlea-EHA 105 bacterium liquid; About 28 ℃ of following 220rpm shaking culture 16h, the centrifugal 10min of 4000 * g abandons supernatant under the room temperature; Thalline suspends with the MS liquid nutrient medium (containing AS 100 μ mol/L) of sterilization; The 5-20 that is diluted to original volume doubly at 28 ℃ of following 220rpm shaking culture 1h, makes the OD of bacterium liquid ₆₀₀Reach about 0.5.

4) cultivate altogether

Put into bacterium liquid to the hypocotyl of cultivating 2d in advance and contaminate 1min; The medication spoon is pulled hypocotyl out, is placed on the thieving paper of sterilization, blots the unnecessary bacterium liquid on the hypocotyl; Be put into again on the pre-culture medium that is coated with sterilization filter paper; Seal petridish with sealing film, about 25 ° of C, cultivate about 2d (the dark cultivation) altogether in the dark place.

5) inducing culture

Be put into inducing culture (MS+6-BA 2mg/L+AgNO to the hypocotyl of cultivating 2d altogether ₃2.5mg/L) on, seal petridish with sealing film, 25 ° of C left and right sides illumination cultivation, per 2 all subcultures 1 time are until growing the callus that expands.

6) select to cultivate

Transfer to screening culture medium (MS+6-BA 2mg/L+AgNO to the callus that expands ₃2.5mg/L+Kan 100mg/L), seal petridish with sealing film, 25 ° of C left and right sides illumination cultivation, per 2 all subcultures 1 time are until growing seedling.

7) root culture

When high, separate them from callus to 1-2cm when young shoot is long, transfer to that (1/2MS+NAA 0.5mg/L+Kan 25mg/L) carries out root culture on the root media.Under the antibiotic-screening condition, about 87% bud is at 2 weeks back formation root.

8) refining seedling and transplanting

Seedling after taking root is long to 5-6cm when high, and half opens wide the culturing bottle lid, refines seedling; Treat that seedling adapts to after the external environment, transfer in the vermiculite of indoor sterilization plantation and cultivate, and water with the 1/2MS nutrient solution.When growth of seedling during, sprigging is grown in earth, and then carry out next step experiment to 7-9cm.

(2) salt tolerance that contains trkB gene (DR1667) sequence transgene rape is identified

1, experiment purpose

In view of this nucleotide sequence has been proved to be in intestinal bacteria salt stress is had resistance, further transfer-gen plant is carried out drought resistance and identify.

2, experimental technique

Do not rewater after watering the nutritive medium that foot contains 250NaCl to the transgene rape plant in seedling stage and non-transgenic rape plant are disposable respectively, observe the growing state of two kinds of rape plant of contrast after 15 days.

3, experimental result:

Can be observed from Fig. 5, after cultivating 15 days on the substratum of 250mmol NaCl, the non-transgenic rape is wilted;

Can be observed from Fig. 6, after cultivating 15 days on the substratum of 250mmol NaCl, but transgene rape is coerced down still normal growth at the NaCl of 250mmol.

4, experiment conclusion

Above-mentioned all results show that all the trkB gene (DR1667) of being cloned has the resistance to salt stress, can be used for utilizing in the research and industrialization of transgenic technology controlling plant to salt stress.

Claims (10)

1.SEQ the gene of sequence shown in the ID NO:1 is cultivated the purposes of salt-tolerant plant.

2. the recombinant plasmid that contains the gene of sequence shown in the SEQ ID NO:1.

3. the said recombinant plasmid of claim 2 is cultivated the purposes of salt-tolerant plant.

4. the described purposes of claim 3, said recombinant plasmid is can be at the plasmid of escherichia coli expression.

5. the described purposes of claim 3, said recombinant plasmid is the plasmid that can in plant, express.

6. the host cell of the described recombinant plasmid transformed of claim 2 is cultivated the purposes of salt-tolerant plant.

7. the described purposes of claim 6, said host cell comprises prokaryotic cell prokaryocyte and eukaryotic cell.

8. the recombinant strain that contains the gene of sequence shown in the SEQ ID NO:1.

9. the described recombinant strain of claim 8 is cultivated the purposes of salt-tolerant plant.

10. arbitrary described purposes in the claim 1,3～7,9, said plant is a rape.

Images