CN102807991B - Application of deinococcus radiodurans R1 trkB genes to cultivation of salt-tolerant plants - Google Patents
Application of deinococcus radiodurans R1 trkB genes to cultivation of salt-tolerant plants Download PDFInfo
- Publication number
- CN102807991B CN102807991B CN201210291616.XA CN201210291616A CN102807991B CN 102807991 B CN102807991 B CN 102807991B CN 201210291616 A CN201210291616 A CN 201210291616A CN 102807991 B CN102807991 B CN 102807991B
- Authority
- CN
- China
- Prior art keywords
- trkb
- radiodurans
- gene
- rape
- salt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discovers that trkB genes (DR1667) in Deinococcus radiodurans R1 are capable of enhancing resistance capability of prokaryotes and plants. Recombinant vectors comprising the trkB genes (DR1667) are constructed and are respectively transferred into prokaryotic and eukaryotic host cells. Experiments prove that salt tolerance of the prokaryotic host cells and rape can be enhanced after the trkB genes (DR1667) are expressed in the prokaryotic host cells and rape.
Description
Technical field
The present invention relates to Deinococcus radiodurans R1(Deinococcus radiodurans R1) the new function of trkB gene (DR1667, GeneID:1799538), be specifically related to this gene and strengthening plant to the application aspect salt stress resistance.
Background technology
Saline and alkaline being lost in that farm crop are caused accounts for first place (Dracup et al., 1998) in all abiotic stress.Deinococcus radiodurans R1(D.radiodurans R1) because long-term dry and strong oxidative stress is had to extremely strong resistance, and become the desirable strain of microorganisms abiotic stress adaptation mechanism.
HKT (high-affinity K+transporter) gene family translocator has can the interior K of regulating plant body
+/ Na
+the ability of balance, is extensively present in plant, fungi, eubacterium and archeobacteria.Deinococcus radiodurans R1(D.radiodurans R1) contain 2 HKT proteinoids, in close relations closely related with plant Na+ transhipment, long-term dry and strong oxidative stress is had to extremely strong resistance.
Potassium is one of essential nutritive element of plant materials, and sodium is the functional element of plant-growth, for most plants, useful on a small quantity, excessively can produce murder by poisoning.Plant mainly leans on channel protein and the transport vehicle in its body to their absorption.Contacting closely of the K translocator of plant HKT translocator and fungi Trk translocator, procaryotic KtrB and TrkH, in fungi, Trk translocator is K absorption system main under low K concentration.In most plants, all may have HKT translocator, this gene family is not very large, only has a member in Arabidopis thaliana Zhong Gai family.Sequential analysis supposition, the translocator of this family may be evolved by the K passage of 2 of bacterium time cross-film structure, form 8 times present cross-films and a pore structure albumen of 4 circles.HKT family gene is mainly divided into 2 subfamilies; subfamily 1 member is the low affinity translocator of specific Na; major part is distributed on the cytoplasmic membrane of root system center pillar, especially on xylem parenchyma cell film, is responsible for again obtaining Na from xylem sap and stops its transportation to overground part; And the subfamily 2 members high affinity translocator that is K/Na, thereby especially under K shortage condition, be responsible for the absorption of Na to promote the growth of crop, be mainly distributed on the cortex and endodermis cytolemma of root system.
Deinococcus radiodurans (D.radiodurans) is one of biology of the highest radiation resistance in known organism so far.This bacterium has the extreme resistance of ionizing rays, UV radiation and DNA damage reagent to lethal dose, ionizing rays can be caused to the complete recovery of genome of up to a hundred DNA double splitting of chain as before, and the ability of not undergoing mutation.1999 gene studies institute (TIGR) complete and announced D.radiodurans genom sequence (White 1999).Although radiation hardness bacterial strain and drought stress resistance may have synergetic property on evolving, but the trkB gene (DR1667, GeneID:1799538) having no at present in the different coccus Deinococcus of radiation hardness radiodurans R1 is reported in the research of the function aspect enhancing plant salt endurance.
Summary of the invention
The object of the invention is from D.radiodurans R1 genome, to find to strengthen the resistant gene of plant to high salt.And by this gene transferred plant, make the ability of the plant acquisition salt tolerant that proceeds to this gene.
The present invention finds by following research, discovery first, and the trkB gene (DR1667, GeneID:1799538) of the Deinococcus radiodurans R1 of sequence shown in SEQ ID NO:1 has the function of salt stress-resistant, can be used for cultivating the plant of salt-tolerance character:
1, obtain the recombinant strain that contains D.radiodurans R1 trkB gene (DR1667)
1) by PCR from D.radiodurans R1(DSM 20539) strain gene group amplifies D.radiodurans R1trkB gene (DR1667), gene order number is: GeneID:1799538.Its size is 1377bp, and 456 amino acid of this genes encoding are cloned in carrier pGEMT-easy upper, have built the recombinant plasmid pGEMT-trkB that contains complete trkB gene;
2) trkB gene (DR1667) is connected on pRADZ3 shuttle plasmid, this plasmid contains the groEL promotor that can all work in intestinal bacteria and the different coccus of radiation hardness, builds complete trkB gene (DR1667) the recombinant plasmid pRADZ3-trkB G that contains groEL promotor;
3) the recombinant plasmid pRADZ3-trkB G that imports trkB gene (DR1667) is proceeded in acceptor e. coli jm109, obtain engineering strain JM-trkB(and refer to embodiment 1);
2, the salt tolerant experiment that contains D.radiodurans R1 trkB engineering strain
Experiment confirmation, after 4M NaCl impacts, the JM-trkB recombinant bacterial strain upgrowth situation that contains D.radiodurans R1 trkB gene (DR1667) is good, and colony number is higher than a JM-Z3 bacterial strain (seeing embodiment 2 and Fig. 4) that only contains empty plasmid.This project bacterial strain has the ability that tolerance 4M NaCl impacts.
This experiment shows: D.radiodurans R1 trkB gene (DR1667) has the ability that strengthens procaryotic biological salt-resistant.
3, trkB gene (DR1667) is expressed and the salt tolerant Resistance Identification of transfer-gen plant in rape
1) D.radiodurans R1 trkB gene (DR1667) is connected in plant expression vector pBI121, builds the recombinant plasmid pBI121-trkB with trkB gene (DR1667);
2) by pBI121-trkB recombinant plasmid transformed rape, obtained can salt tolerant transgene rape plant;
This experiment shows: D.radiodurans R1 trkB gene (DR1667) has the purposes (seeing embodiment 3 and Fig. 5～6) of cultivating salt-tolerant plant.
Accompanying drawing explanation:
Fig. 1 is the PCR product checking electrophoretogram that contains D.radiodurans R1 trkB gene (DR1667) sequence;
Fig. 2 is the structure checking electrophoretogram of the prokaryotic expression carrier that contains D.radiodurans R1 trkB gene (DR1667) and groEL promotor;
Fig. 3 is the bacterium colony photo of the colibacillary upgrowth situation of the prokaryotic expression carrier that contains empty carrier and contain D.radiodurans R1 trkB gene (DR1667) sequence before high salt concentration (4M NaCl) impacts, wherein:
A is intestinal bacteria JM 109 bacterial strains that contain empty expression vector;
B is the intestinal bacteria recombinant bacterial strain that contains D.radiodurans R1 trkB gene (DR1667) expression vector;
Fig. 4 be the intestinal bacteria (E.coli) of the prokaryotic expression carrier that contains D.radiodurans R1 trkB gene (DR1667) and empty carrier at the bacterium colony photo of the growing state containing in 4M NaCl substratum, the bacterial strain in figure is as follows:
A is intestinal bacteria JM 109 bacterial strains that contain empty expression vector;
B is the intestinal bacteria recombinant bacterial strain that contains D.radiodurans R1 trkB gene (DR1667) expression vector.
Fig. 5 cultivates non-transgenic rape after 15 days on the substratum of 250mmol NaCl, wilts;
Fig. 6 cultivates transgene rape after 15 days on the substratum of 250mmol NaCl, transgene rape can be under the coercing containing the NaCl of 250mmol normal growth.
Embodiment
The plasmid lifted in following examples, bacterial strain, only for the present invention is described in further detail, are not limited flesh and blood of the present invention.All unreceipted specific experiment conditions, be according to normal condition well known to those skilled in the art, for example Sambrook equimolecular clone: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Plasmid, the bacterium source in embodiment, lifted are as follows:
Cloning vector pGEMT-easy: be Promrga company commercially available prod;
Shuttle plasmid pRADZ3: for preserving in this laboratory;
Plant expression vector pBI121: be Clontech company commercially available prod;
Intestinal bacteria JM 109: be Beijing Quan Shi King Company commercially available prod.Agrobacterium tumefaciens EHA 105 is preserved by this laboratory.
Embodiment 1 expression of D.radiodurans R1 trkB gene (DR1667) sequence in intestinal bacteria
According to trkB gene (DR1667) sequences Design 1 in the D.radiodurans R1 genome of having announced to PCR Auele Specific Primer:
Up?5′ATTAACTAGTATGACCCGGAACGCCGCGCT?3′
Down?5′ACGCCATATGCTACCCCACCAGAATGTCGT3
From D.radiodurans R1 genomic dna, amplify goal gene sequence by PCR method.Reaction conditions: 94 ℃ of 10min, [94 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 1.5min] 35 circulations, 72 ℃ of 10min.PCR product, after glue reclaims, is cloned in carrier pGEMT-easy upper, called after pGEMT-trkB, and sequence verification; Then obtain the trkB gene (DR1667) that contains sticky end and the pRADZ3 carrier that contains promotor groEL by SpeI/NdeI double digestion, trkB gene (DR1667) is connected on pRAD Z3 carrier, build coli expression carrier pRADZ3-trkB G, this expression vector is transformed to e. coli jm109, cut through PCR, enzyme, sequence verification insertion sequence correct (seeing Fig. 1,2), by this bacterial strain called after JM-trkB.
By the E.coli JM109 called after JM-Z3 that contains pRADZ3 empty plasmid.
Embodiment 2 is containing the salt tolerant experiment of D.radiodurans R1 trkB gene (DR1667) recombinant bacterial strain
One, experimental technique
1, the intestinal bacteria of 2 restructuring that obtain in embodiment 1 are inoculated in respectively in 20mL LB liquid nutrient medium (containing Amp microbiotic), after shaking flask incubated overnight (37 ℃), transfer again in the LB of 100mL liquid nutrient medium, keep the consistent of inoculum size as far as possible, be cultured to OD
600approximately 0.5 left and right (keeps OD as far as possible
600value is consistent).
2, get the bacterium liquid of 10mL centrifugal after, in isopyknic 4M NaCl solution, impact 2h, each sample is used aseptic deionized water doubling dilution to 10 immediately
-4, get 10 μ L points at LB solid culture primary surface, cultivate 16h, observation bacterium colony formational situation photograph through 37 ℃.
Two, experimental result
Fig. 3 demonstration, before 4M NaCl fluid challenge, the JM-trkB bacterial strain that contains D.radiodurans R1 trkB gene (DR1667) is basically identical with the JM-Z3 strain growth state containing empty plasmid; After 4M NaCl fluid challenge, the JM-trkB recombinant bacterial strain upgrowth situation that contains D.radiodurans R1 trkB gene (DR1667) is good, and colony number is more than the JM-Z3 bacterial strain (see figure 4) that only contains empty plasmid.
Three, experiment conclusion
D.radiodurans R1 trkB gene (DR1667) has strengthened the ability of procaryotic biological salt-resistant.
Embodiment 3 trkB genes (DR1667) are expressed and the Salt-Tolerance Identification of transfer-gen plant in rape
(1) agrobacterium mediation converted rape experiment
1. the competent preparation of agrobacterium tumefaciens EHA105
1) picking list bacterium colony, is inoculated in 5mL YEB liquid nutrient medium (containing Rifampin Rif 50mg/L), and 28 ℃, 250rpm shaking culture is spent the night;
2) get 2mL bacterium liquid, add in 50mL YEB liquid nutrient medium (containing Rif 50mg/L), 28 ℃, 250rpm shaking culture is to OD
600approximately 0.6 left and right;
3) bacterium liquid is gone in the aseptic centrifuge tube of 50mL to ice bath 30min, the centrifugal 5min of 5000 × g;
4) abandon supernatant, 2mL 20mM CaCl for precipitation
2resuspended, every part of 100 μ L divide and install in 1.5mL centrifuge tube, in liquid nitrogen, save backup.
2. recombinant plasmid dna proceeds to Agrobacterium
1) the pBI121-trkB plasmid DNA of approximately 1 μ g is joined respectively in 100 μ L EHA105 competent cells, mix ice bath 5min;
2) centrifuge tube is put to freezing 8min in liquid nitrogen, gone to rapidly temperature in 37 ° of C water-baths and bathe 5min;
3) add 1mL YEB liquid nutrient medium, 250rpm recovery 4～5h on 28 ℃ of shaking tables;
4) get appropriate bacterium liquid and be applied on the YEB solid medium containing Rifampin (Rif) 50mg/L and kantlex (Kan) 100mg/L, put 28 ℃ and cultivate 24～48h.
3. the extraction of Agrobacterium plasmid DNA
1) picking colony is in the YEB liquid nutrient medium containing Rifampin (Rif) 50mg/L and kantlex (Kan) 100mg/L (YEB: Tryptones 5g/L, yeast extract 1g/L, sucrose 5g/L, magnesium sulfate 0.5g/L), 28 ° of C, 250rpm shaking culture 20h;
2) get 1.5mL bacterium liquid centrifugal after, abandon supernatant, with STE solution (Tris-HCI 10mM pH8.0, NaCl 10mM, EDTA 10mM pH 8.0) wash 2 times, abandon supernatant, add solution I (50mM glucose, the 25mM Tris-HCl pH8.0 of precooling, 10mM EDTA pH 8.0, RNase A 100 μ g/mL) 300 μ L, repeatedly to aspirate and mix with pipettor, room temperature leaves standstill 10min;
3) add solution II (0.2M NaOH, 1%SDS) the 600 μ L of fresh configuration, turn upside down and mix several times;
4) add solution III (5M potassium acetate pH 5.2, Glacial acetic acid 11.5mL, adds water to 100mL) the 450 μ L of precooling, fully mix, ice bath 5min, 4 ° of centrifugal 5min of C 12000 × g, supernatant adds the isopropanol precipitating of 0.6 times of volume;
5) precipitation adds 50 μ L TE(Tris-HCl 10mmol/L, 1mmol/L EDTA, pH 8.0) dissolve after, through PCR, Bam HI, the checking of Sac I double digestion.
4. the preparation of rape aseptic seedling and agriculture bacillus mediated trkB gene (DR1667) genetic transformation
1) cultivation of rape aseptic seedling
Swede type rape (Brassica napus L.) (84100-18) seed soaks 10min with aqua sterilisa on Bechtop, 10% NaClO sterilizing 12min, again with 0.1% mercuric chloride solution sterilization 7-8min, with sterilizing washing 3-5 time, and the Semen Brassicae campestris of sterilizing is placed in to (7.5% agar) on the pre-culture medium without hormone equably.Illumination cultivation, 4-5d Brassica Napus Seedling in age is suitable for genetic transformation most.
2) preculture
Alcohol with 75% and the scissors of high-temp sterilizing are cut cotyledon and vegetative point, and the long hypocotyl of about 0.5cm under clip rape aseptic seedling next-door neighbour vegetative point, is placed in pre-culture medium (MS+6-BA 2mg/L+2,4-D 1mg/L+AgNO
32.5mg/L+AS 19.62mg/L) upper, illumination preculture 2d.
3) cultivation of Agrobacterium
In 50mL LB liquid nutrient medium (containing kantlex 100mg/L, Rifampin 50mg/L), add 0.1mLlea-EHA 105 bacterium liquid, 220rpm shaking culture 16h left and right at 28 ℃, the centrifugal 10min of 4000 × g under room temperature, abandon supernatant liquor, thalline suspends with the MS liquid nutrient medium (containing AS 100 μ mol/L) of sterilizing, be diluted to the 5-20 of original volume doubly, 220rpm shaking culture 1h at 28 ℃, makes the OD of bacterium liquid
600reach 0.5 left and right.
4) cultivate altogether
The hypocotyl of preculture 2d is put into bacterium liquid and contaminate 1min, medication spoon is pulled hypocotyl out, be placed on the thieving paper of sterilizing, blot the unnecessary bacterium liquid on hypocotyl, be put into again on the pre-culture medium that is coated with sterilizing filter paper, seal culture dish with sealed membrane, 25 ° of C left and right, cultivate altogether about 2d(and secretly cultivate in dark place).
5) inducing culture
The hypocotyl of cultivating altogether 2d is put into inducing culture (MS+6-BA 2mg/L+AgNO
32.5mg/L) upper, seal culture dish with sealed membrane, 25 ° of C left and right illumination cultivation, every 2 weeks subcultures 1 time, until grow the callus expanding.
6) select to cultivate
The callus expanding is transferred to screening culture medium (MS+6-BA 2mg/L+AgNO
32.5mg/L+Kan 100mg/L) upper, seal culture dish with sealed membrane, 25 ° of C left and right illumination cultivation, every 2 weeks subcultures 1 time, until grow seedling.
7) root culture
When young shoot grows to 1-2cm when high, they are separated from callus, transfer to (1/2MS+NAA 0.5mg/L+Kan 25mg/L) on root media and carry out root culture.Under antibiotic-screening condition, approximately 87% bud formed root after 2 weeks.
8) hardening and transplanting
Seedling after taking root grows to 5-6cm when high, and half opens wide culturing bottle lid, carries out hardening; Treat that seedling adapts to after external environment, transfer to plantation in the vermiculite of indoor sterilizing and cultivate, and water with 1/2MS nutrient solution.When growth of seedling is during to 7-9cm, transplant seedlings in earth and grow, and then carry out next step experiment.
(2) containing the Salt-Tolerance Identification of trkB gene (DR1667) sequence transgene rape
1, experiment purpose
In view of this nucleotide sequence is proved to be in intestinal bacteria salt stress is had to resistance, further transfer-gen plant is carried out to Identification of Drought.
2, experimental technique
Transgene rape plant to seedling stage and non-transgenic the rapeseed plants respectively disposable foot that waters do not rewater containing after the nutritive medium of 250NaCl, within 15 days, observe afterwards the growing state of two kinds of rapeseed plants of contrast.
3, experimental result:
Can be observed from Fig. 5, cultivate after 15 days on the substratum of 250mmol NaCl, non-transgenic rape is wilted;
Can be observed from Fig. 6, cultivate after 15 days on the substratum of 250mmol NaCl, transgene rape still can normal growth under the NaCl of 250mmol coerces.
4, experiment conclusion
Above-mentioned all results all show, the trkB gene (DR1667) of cloning has the resistance to salt stress, can be used for utilizing in the research and industrialization of transgenic technology control plant to salt stress.
Claims (6)
1. the gene shown in sequence SEQ ID NO:1 is cultivated the purposes of salt tolerant rape.
2. cultivate the purposes of salt tolerant rape containing the recombinant plasmid of gene shown in sequence SEQ ID NO:1.
3. purposes claimed in claim 2, described recombinant plasmid is can be at the plasmid of escherichia coli expression.
4. purposes claimed in claim 2, described recombinant plasmid is the plasmid that can express in rape.
5. the purposes that contains the host cell cultivation salt tolerant rape of the recombinant plasmid transformed of gene shown in sequence SEQ ID NO:1, described host cell comprises prokaryotic cell prokaryocyte and eukaryotic cell.
6. cultivate the purposes of salt tolerant rape containing the recombinant strain of gene shown in SEQ ID NO:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210291616.XA CN102807991B (en) | 2012-08-15 | 2012-08-15 | Application of deinococcus radiodurans R1 trkB genes to cultivation of salt-tolerant plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210291616.XA CN102807991B (en) | 2012-08-15 | 2012-08-15 | Application of deinococcus radiodurans R1 trkB genes to cultivation of salt-tolerant plants |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102807991A CN102807991A (en) | 2012-12-05 |
| CN102807991B true CN102807991B (en) | 2014-05-14 |
Family
ID=47231862
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210291616.XA Active CN102807991B (en) | 2012-08-15 | 2012-08-15 | Application of deinococcus radiodurans R1 trkB genes to cultivation of salt-tolerant plants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102807991B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108893470B (en) * | 2018-06-26 | 2021-10-08 | 中国农业科学院生物技术研究所 | Non-coding RNA OsiR with oxidation resistance and high temperature stress resistance and application thereof |
-
2012
- 2012-08-15 CN CN201210291616.XA patent/CN102807991B/en active Active
Non-Patent Citations (8)
| Title |
|---|
| Deinococcus radiodurans R1 chromosome 1,complete sequence;White O等;《Genbank》;20100305;全文 * |
| Faillie等.Potassium and sodium transport in non-animal cells:the Trk/Ktr/HKT transporter family.《Cellular and molecular life sciences》.2010,第67卷(第15期),2511-2532. |
| Genome of the extremely radiation-resistant bacterium deinococcus radiodurans viewed from the perspective of comparative genomics;Makarova等;《Microbiology and molecular biology reviews》;20010331;第65卷(第1期);第56页表2 * |
| kazuya yoshida.Plant biotechnology-genetic engineering to enhance plant salt tolerance.《journal of bioscience and bioengineering》.2002,第94卷(第6期),585-590. |
| Makarova等.Genome of the extremely radiation-resistant bacterium deinococcus radiodurans viewed from the perspective of comparative genomics.《Microbiology and molecular biology reviews》.2001,第65卷(第1期),44-79. |
| Plant biotechnology-genetic engineering to enhance plant salt tolerance;kazuya yoshida;《journal of bioscience and bioengineering》;20021231;第94卷(第6期);585-590 * |
| Potassium and sodium transport in non-animal cells:the Trk/Ktr/HKT transporter family;Faillie等;《Cellular and molecular life sciences》;20100831;第67卷(第15期);第2517、2528页 * |
| WhiteO等.DeinococcusradioduransR1chromosome1 complete sequence.《Genbank》.2010 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102807991A (en) | 2012-12-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102234318A (en) | Plant stress tolerance related protein TaTPRPK1, encoding gene thereof, and application thereof | |
| CN103194456B (en) | Lilium regale antifungal gene Lr14-3-3 and application thereof | |
| CN102851305B (en) | Application of HIN protein gene of deinococcus radiodurans R1 in salt-tolerant plant cultivation | |
| CN102586282B (en) | Application of lea-like gene in deinococcus radiodurans R1 to cultivating drought-resistant plants | |
| CN105218650B (en) | A kind of and plant adversity resistance related protein Prp1 and its encoding gene and application | |
| CN101748144B (en) | Torch pear haloduric gene PpGST and application thereof | |
| CN102807990B (en) | Application of trkA genes in deinococcus radiodurans R1 to culture of drought-resistant plant | |
| CN105296492B (en) | A kind of javanese root knot nematode effector Mj-1-1, GAP-associated protein GAP and its application | |
| CN106367433B (en) | Plant is improved to the method and its application of gibberellin inhibitor sensitiveness | |
| CN104744577B (en) | Beauveria bassiana antibacterial protein Bbafp and its expression vector, genetically modified plants containing its gene preparation method and application | |
| CN102807991B (en) | Application of deinococcus radiodurans R1 trkB genes to cultivation of salt-tolerant plants | |
| CN111424037A (en) | Cymbidium CgWRKY70 gene and application thereof | |
| Frame et al. | Maize (Zea mays L.) | |
| CN103145816B (en) | Application of protein elicitor Hripl for improving and perfecting salt tolerance and drought resistance of plants | |
| CN102586283B (en) | Application of ytxH gene in deinococcus radiodurans R1 to cultivating salt-tolerant plants | |
| CN107586324B (en) | TabZIP15 albumen and its encoding gene and application | |
| CN106191059A (en) | Application in Herba Capsellae peroxidase gene promoter and improvement plant cold resistance thereof | |
| CN104628840B (en) | Plant stress tolerance correlative protein VrDREB2A and its encoding gene and application | |
| CN107602679B (en) | TabHLH44 albumen and its encoding gene and application | |
| CN102234319B (en) | Plant stress tolerance related protein GmTPRPK1, encoding gene thereof, and application thereof | |
| CN111454966A (en) | Cymbidium CgWRKY4 gene and application thereof | |
| CN102399815A (en) | Application of thermophilic autotrophic methanobacteria MTH1745 gene in improving plant stress tolerance | |
| WO2022082866A1 (en) | Stress-resistant gene line acdwem and use thereof in improvement of salt tolerance, drought resistance and high temperature resistance of crops | |
| CN102559703A (en) | Glyphosate-resistant herbicide gene AroA-Ra from grape crown gall antagonistic bacteria rahnella aquatilis and application thereof | |
| CN111424039B (en) | Cymbidium CgWRKY65 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220324 Address after: 572025 building 3, nuclear energy R & D and Industrial Park, Yiju Road, Yazhou District, Sanya City, Hainan Province Patentee after: Longping Biotechnology (Hainan) Co.,Ltd. Address before: 100081 No. 12 South Main Street, Haidian District, Beijing, Zhongguancun Patentee before: BIOTECHNOLOGY Research Institute CHINESE ACADEMY OF AGRICULTURAL SCIENCES |