CN102776289A - Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof - Google Patents
Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof Download PDFInfo
- Publication number
- CN102776289A CN102776289A CN2012102810343A CN201210281034A CN102776289A CN 102776289 A CN102776289 A CN 102776289A CN 2012102810343 A CN2012102810343 A CN 2012102810343A CN 201210281034 A CN201210281034 A CN 201210281034A CN 102776289 A CN102776289 A CN 102776289A
- Authority
- CN
- China
- Prior art keywords
- pcr
- food
- primer
- chicken
- meat
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of food quality safety detection, particularly relates to a reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at the same time and application of the reagent kit. Based on a two-step semi-nested type-multiplex PCR (Polymerase Chain Reaction) technology, the invention designs the high-sensitivity reagent kit for distinguishing four meet components including pork, beef, mutton and chicken in deeply processed food at the same time. It is proved that the detection sensitivity of the conventional PCR-based food component detection method is greatly improved by using the semi-nested type-multiplex PCR technology under the condition that the detection specificity is ensured; the sensitivity of the reagent kit provided by the invention is improved by 2-3 orders of magnitude as compared with the sensitivity of a common PCR method, and is improved by 1-2 orders of magnitude as compared with the sensitivity of a fluorescent quantitation PCR method. The reagent kit can be used for successfully and accurately distinguishing meet components of deeply processed food such as dried meat floss and burger, which cannot be effectively distinguished by the PCR method and the fluorescent quantitation PCR method.
Description
One. technical field
The invention belongs to food quality safety detection technology field, be specifically related to a kind of test kit and application of differentiating four kinds of compositions of pig, cattle and sheep chicken in the food simultaneously.Use two-step approach half-nest type-multiple PCR technique; Be designed for the test kit that chicken in the deep-processed food, ox, sheep, pig detect simultaneously; Existing P CR and fluorescent quantitative PCR technique are compared in its sensitivity improved the 1-3 one magnitude, can be used for the detection of meat kind in the deep-processed food of DNA severely degrade.
Two. background technology
It is that China's food quality is controlled one of significant challenge that faces that the doping of meat product is mingled.In recent years, illegal enterprise uses meat raw materials such as relatively inexpensive pork, chicken under the ordering about of interests, pretend to be the higher relatively meat products of price such as beef, mutton to sell the human consumer's that constituted a serious infringement legitimate rights and interests.The exposure of " Carnis Bovis seu Bubali cream " incident makes the focus that meat is mingled further becomes public attention.In the recent period, ground such as Henan has occurred again using chicken, duck etc. to pretend to be the incident of mutton cubes roasted on a skewer.Meat-based food is mingled another " underlying rule " that becomes China's food quality safety.
The technology that is the basis with polymerase chain reaction (PCR) has become the core methed that the meat kind is identified in the food.According to the difference site design specific primers of different plant species gene order, utilize the PCR reaction to realize the segmental exponential amplification of characterizing gene in the food, differentiate possible source of species in the food through electrophoresis detection then.In recent years, the develop rapidly of real-time fluorescence PCR technology has improved species are differentiated in the food efficient and sensitivity greatly, and makes quantitatively tracing to the source of meat content become possibility.Nowadays; According to Mitochondrial Genome Overview dna sequence dna difference design species specificity primer; Set up PCR and real time fluorescent PCR method and seen a large amount of reports; And got into domestic authority's detection technique standard (in SN/T 2051-2008 food, makeup and the feed in cattle and sheep pig derived component detection method PCR in real time method, the animal derived feed of GB/T 21101-2007 pig derived component qualitative checking method PCR method); Also occur relevant commercial kit (Takara Real Time PCR Porcine DNA Detection Kit) on the market, brought into play vital role in controlling and supervising in that meat product is mingled.This laboratory been has also has been researched and developed four kinds of meats has been carried out simultaneously the application multiple PCR method (number of patent application: 201210099651.1), can carry out the high-throughout while to pig, cattle and sheep chicken composition in the food and differentiate fast of discriminating fast.
Yet; In our (national agricultural byproducts quality inspection center) actual detected to meat sample kind; No matter use PCR or fluorescence quantifying PCR method in the above-mentioned standard; Still the PCR test kit of commodity in useization when some are detected through the DNA that extracts in the meat product of deep processing, usually can't obtain amplified band or fluorescent signal.These deep processing meat products mainly comprise the meat stuffing in dried meat floss, ham sausage and bologna sausage, the shortening flour products etc.According to statistics, in 108 parts of deep-processed foods that we detect in the recent period, what the existing method of use failed to differentiate has 27 parts, accounts for 25.0%.We infer; Meat DNA process deep processing in these food is severely degrade and fragmentation; Cause as the complete object dna fragmentation that detects template few; Might have certain PCR reaction suppressor, the sensitivity of existing P CR or fluorescence quantifying PCR method can not have been satisfied the needs of detection in addition.In order to address this problem; We have attempted the optimization reaction conditions, have used multiple strategies such as two-step approach half-nest type-multiple PCR technique, brachymemma primer; Through overtesting, use half-nest type-multiplex PCR guaranteeing significantly to have promoted detection sensitivity under the specific prerequisite, on this basis; We have developed the highly sensitive test kit of differentiating four kinds of compositions of pig, cattle and sheep chicken in the food simultaneously, can carry out kind to deep-processed food effectively and differentiate.
Three. summary of the invention
The problem that the present invention need solve is: at present meat kind in the deep-processed food of DNA severely degrade being identified the present situation that lacks effective ways; Use two-step approach half-nest type-multiple PCR technique; Develop a kind of highly sensitive test kit of differentiating four kinds of compositions of pig, cattle and sheep chicken in the food simultaneously; Optimize and the method for use of definite test kit, can carry out the kind discriminating with the deep processing meat-based food that kit method can't detect using the existing standard method.
General technical route of the present invention is: with the total DNA that extracts in the deep-processed food is template; At first use a pair of universal primer to carry out first round amplification, the amplification target is the homologous fragment of 490bp on pig, ox, sheep (comprising goat and sheep), 4 species Mitochondrial Genome Overview of chicken; Then with first round amplified production as second take turns amplification template; Forward primer still uses the forward primer of first round amplification; Reverse primer uses the Auele Specific Primer of pig, ox, sheep, 4 species of chicken; Carry out second and take turns the multiplex PCR amplification, amplified production is carried out agarose gel electrophoresis, the meat kind is differentiated according to band molecular weight difference.Based on above-mentioned two-step approach half-nest type-multiple PCR technique; Committed step condition in the experiment flow, reagent composition and concentration are optimized; Two-wheeled PCR in half-nest type-multiplex PCR is reacted required reagent be formulated as premixed liquid 1 and premixed liquid 2 respectively, develop the highly sensitive test kit of differentiating pig in the food, ox, sheep, four kinds of compositions of chicken simultaneously.The user only need with the total DNA that extracts in the deep-processed food with carry out first round PCR after premixed liquid 1 mixes and react; Then with first round PCR product with carry out second after premixed liquid 2 mixes and take turns the PCR reaction; Simplified operation steps greatly; Reduced professional requirement, can accurately differentiate 4 kinds of meat kinds in the deep-processed food in 3-4 hour the operator.
Use the test kit of the present invention's development that species DNA such as pig, ox, sheep, four kinds of target dnas of chicken and combination thereof, soybean, fish, goose, horse, donkey are detected, the result shows that the specificity of this test kit is good, and cross reaction and non-specific amplification are not arranged; Use the dna profiling of 10 times of gradient dilutions respectively; This test kit is detected in the fluorescence quantitative kit (Real Time PCR Porcine DNA Detection Kit), entry and exit industry standard of pig derived component in the food multiple PCR method of cattle and sheep pig derived component detection method-PCR in real time method, this laboratory development in SN/T 2051-2008 food, makeup and the feed (number of patent application: sensitivity 201210099651.1) is verified and relatively to the detection sensitivity of four kinds of target species, Takara company; The detection sensitivity of this kit method has improved the 2-3 one magnitude than multiple PCR method, has improved the 1-2 one magnitude than standard and commercialization fluorescence quantitative kit method.
Described in " background technology ", in 108 parts of deep-processed foods that national agricultural byproducts quality inspection center is detected in the recent period, what use existing standard method and test kit failed to differentiate has 27 parts, accounts for 25.0%.Use the kit method of the present invention's development, successfully this 27 duplicate samples has been carried out the kind discriminating, found that 12 routine meats mingle, verified unique advantage and the actual application value of this test kit aspect the discriminating of deep-processed food meat kind.
Technical scheme of the present invention comprises: 1. the primer sequence that designs two-step approach half-nest type-multiplex PCR according to pig, ox, sheep, 4 species plastosomes of chicken homologous sequence.2. use two-step approach half-nest type-multiplex PCR each target species DNA and contrast species DNA are detected the specificity of verification method.3. optimize reaction conditions and reagent concentration, design construction is differentiated the test kit of pig, ox, sheep, 4 kinds of compositions of chicken in the food, confirms the method for use of test kit.4. use the target species DNA of gradient dilution, verify the detection sensitivity of test kit of the present invention, and make comparisons with the sensitivity of standard method and commercial kit.5. use kit method of the present invention, carry out kind and detect using food samples that existing method fails to differentiate.Details are as follows:
1. design the primer sequence of two-step approach half-nest type-multiplex PCR according to pig, ox, sheep, 4 species plastosomes of chicken homologous sequence.
The primer that the present invention uses comprises the employed forward universal primer of first round PCR SIM1 and reverse universal primer SIM2, and second takes turns the forward primer that multiplex PCR uses still is SIM1, and reverse primer is C (chicken), M (sheep), B (ox), P (pig).Among the present invention; SIM1 and C, M, B, P differentiate the same primers as (number of patent application: 201210099651.1) of the multiple PCR technique of these 4 kinds of target meat compositions in the food when all adopting this laboratory to research and develop; SIM2 is the reverse universal primer of the present invention according to the height homologous sequence design of 4 kinds of target species Mitochondrial Genome Overview; Use with forward universal primer SIM1 pairing and to carry out first round PCR reaction, the homologous sequence that can amplify 4 target species 490 bp simultaneously as second take turns multiplex PCR template.Primer sequence is seen table 1, and the binding site of primer and each species Mitochondrial Genome Overview is seen accompanying drawing 1.
Table 1. half-nest type-multiple PCR reagent kit the primer sequence
2. use two-step approach half-nest type-multiplex PCR each target species DNA and contrast species DNA are detected the specificity of verification method.
Use the genome DNA of 100 pg chickens, ox, sheep, 4 kinds of target species of pig and hybrid dna that each 100 pg makes up in twos thereof and 100 pg soybean, fish, horse, four kinds of contrasts of donkey species DNA as template respectively; At first use SIM1 and SIM2 to carry out 20 round-robin first round PCR reactions as primer; Get 1 μ L reaction product again as template; Use SIM1, C, B, M, P mix primer to carry out second and take turns multi-PRC reaction; Get 10 μ L products and carry out agarose gel electrophoresis, collection of illustrative plates (accompanying drawing 2) shows that cross reaction and non-specific amplification all do not take place each reaction tubes; Other species DNA as contrast does not all increase yet, and shows that application two-step approach half-nest type-multiplex PCR detects a target species and the hybrid dna specificity is good.
3. optimize reaction conditions and reagent concentration, design construction is differentiated the highly sensitive test kit of pig, ox, sheep, 4 kinds of compositions of chicken in the food, confirms its method of use.
Verifying that two-step approach half-nest type-multiplex PCR differentiates on the specificity basis of target species simultaneously, we to the reaction system that first round PCR and second takes turns multiplex PCR form, the PCR reaction conditions optimizes, with design highly sensitive test kit.The index of optimizing comprises: primer concentration, multiple PCR primer proportioning, annealing temperature, reaction cycle number, extension time.Under optimized conditions, we take turns first round PCR and second premixed liquid 1 and premixed liquid 2 that the outer all the components of removing template in the reaction system of multiplex PCR is formulated as test kit respectively, make test kit, and its composition is respectively:
(1) premixed liquid 1: wherein comprise primer SIM1 0.4 μ M, primer SIM2 0.4 μ M, Taq enzyme 1.25 U, each 0.2 μ M of dNTP, Tris-HCl 10 mM of PH8.5, KCl 50mM, MgCl
21.5 mM, premixed liquid 1 storage condition is 4 oC, half a year quality guaranteed period.
(2) premixed liquid 2: wherein comprise primer SIM1 0.4 μ M, primer P 0.4 μ M, primer C 0.4 μ M, primer B 0.4 μ M, primer S 0.4 μ M, Taq enzyme 1.25 U, each 0.2 μ M of dNTP, Tris-HCl 10 mM of PH8.5, KCl 50mM, MgCl
21.5 mM, tetrabromophenol sulfonphthalein 5% (v/v) premixed liquid 1 storage condition is 4oC, half a year quality guaranteed period.
With the specification sheets of two-step approach half-nest type-multi-PRC reaction condition of optimizing as this test kit, details are as follows:
After total DNA 1 μ L that (1) will from deep-processed foods such as dried meat floss, ham sausage, extract and the premixed liquid in 19 these test kits of μ L 1 mix on ice; On the regular-PCR appearance, carry out amplified reaction; Reaction conditions is following: preparatory sex change 3 min of 95 oC; 20 round-robin 95 oC 30 s, 54 oC, 30 s, 72 oC, 40 s, last 72 oC extend 7 min.
(2) get 2 μ L reaction product; After mixing on ice with premixed liquid in 48 these test kits of μ L 2; On the regular-PCR appearance, carry out amplified reaction; Reaction conditions is following: preparatory sex change 3 min of 95 oC, and 30 round-robin 95 oC 30 s, 52 oC, 30 s, 72 oC, 40 s, last 72 oC extend 7 min.
(3) get 10 μ L reaction product and carry out 2% agarose gel electrophoresis, the dna molecular amount standard of using 100 bp to 1000 bp is as contrast.Gel is observed, taken pictures under uv lamp, the kind of four kinds of meats in the food is identified simultaneously according to the molecular weight size of specific band the specific band size of chicken, ox, sheep, pig is respectively 216 bp, 263 bp, 322 bp and 387 bp.
4. use the target species DNA of gradient dilution, verify the detection sensitivity of test kit of the present invention, and make comparisons with the sensitivity of standard method and commercial kit.
Use 4 kinds of target species DNA of 10 times of gradient dilutions to be template respectively; Using test kit of the present invention detects; When in reaction system, only adding 1 pg template DNA, still can be observed target stripe (accompanying drawing 3), show that this test kit reaches the 1pg/ reaction for the detection sensitivity of target species.
Use 4 kinds of target species DNA of 10 times of gradient dilutions to be template equally, (number of patent application: 201210099651.1) 4 kinds of target species are detected, its detection is limited to 100-1000 pg/ reaction to use the multiple PCR method of this development in laboratory; The real-time fluorescence PCR method that cattle and sheep pig derived component detection method and Takara company pig source property detection kit provide in application China entry and exit industry standard SN/T 2051-2008 food, makeup and the feed detects the genomic dna of pig; Carry out sensitivity according to the Ct value less than 35 template amount and confirm that its detection is limited to 10-100 pg/ reaction.
To sum up, test kit of the present invention sensitivity that four kinds of species of chicken cattle and sheep pig in the food are differentiated is than the high 2-3 one magnitude of multiplex PCR method, than the real-time fluorescence PCR method raising 1-2 one magnitude that provides in commercial reagent box and the standard.
5. use kit method of the present invention, carry out kind and detect using food samples that existing method fails to differentiate.
In 108 portions of deep processing meat products that national agricultural byproducts quality inspection center is detected in the recent period; Use existing standard method and test kit to fail there are 27 parts to what its kind was differentiated; Account for 25.0%; Comprise 25 portions of dried meat floss, 1 portion of ham sausage and 1 portion of frying meat stuffing, any fluorescent signal is not all arranged when using Takara kind identification kit to identify with the Real-time PCR method of entry and exit industry standard.Use the half-nest type-multiple PCR reagent kit method of the present invention's development; Successfully this 27 duplicate samples has been carried out the kind discriminating; 12 parts of situation that the meat kind that all exists actual kind and mark is not inconsistent wherein; Be and use pork to pretend to be forcemeat veal or mutton filling, proved the evaluation of meat kind in the deep-processed food that this test kit is applicable to that existing method can not differentiate.
The invention has the beneficial effects as follows: quick, sensitive detection technique are provided although existing examination criteria, commercial kit PCR and real-time fluorescence PCR method have been identified for the meat product kind; But in actual detected; Still have part deep processing meat product because the existence of DNA severely degrade and PCR reaction suppressor makes the sensitivity of aforesaid method can't reach the requirement that kind is identified.Unresolved this problem; The present invention has developed the highly sensitive test kit that detects simultaneously based on pig, ox, sheep, four kinds of meat compositions of chicken in the food of half-nest type-multiplex PCR; The existing PCR method of its sensitivity has improved each order of magnitude of 2-3; Improve the 1-2 one magnitude than the real-time fluorescence PCR method, can reach the 1pg/ reaction.Under the prerequisite that guarantees detection specificity and accuracy, can be the highest kind detection method of prior art medium sensitivity to using the deep-processed food realization kind evaluation that prior art can't detect.Use this test kit, the deep-processed food that can successfully can not differentiate existing method carries out the evaluation of meat kind, meat in the deep-processed food is mingled controlled.In addition, this test kit carries out the reagent of heminested PCR two-step reaction integrated, easy and simple to handle respectively, has reduced personnel's requirement.Therefore; Test kit provided by the invention is at present unique special method of differentiating to multiple meat in the deep-processed food; The sensitivity of method is superior to prior art; Can be used for supervision and control that food safety detection department of government, large-scale food selling enterprise are mingled the deep processing meat product, have significant practical value.
Four. description of drawings
Half-nest type-multiple PCR primer binding sequence in each target species Mitochondrial Genome Overview of Fig. 1.C: chicken; B: ox; P: pig; M: sheep (comprising sheep S and goat G); SIM1: forward universal primer; SIM2: reverse universal primer.Sequence in the square frame is the primer binding site.
Fig. 2 half-nest type-multiple PCR reagent kit method is to the detection specificity of each target species with the contrast species.Swimming lane 1-15 adds total DNA that pig, Niu Jiayang, ox add mixture that pig, sheep add pig, 4 kinds of target meats, fish, horse, donkey, soybean as template with chicken, ox, sheep, pig, Ji Jianiu, Ji Jiayang, chicken respectively, uses half-nest type-multiple PCR reagent kit to carry out species and detects.The template DNA of every kind of target species is 100 pg/ reactions.The M:DNA molecular weight standard.
Fig. 3 half-nest type-multiple PCR reagent kit method is to the sensitivity checking of each target species.Template amount in every reaction of each swimming lane representative is respectively: swimming lane 1-3: total DNA 10 pg of chicken, 1 pg and 0.1 pg; Swimming lane 4-6: total DNA 10 pg of ox, 1 pg and 0.1 pg; Swimming lane 7-9: total DNA 10 pg of sheep, 1 pg and 0.1 pg; Swimming lane 10-12: total DNA 10 pg of pig, 1 pg and 0.1 pg.The M:DNA molecular weight standard.
Five. embodiment
1. material and reagent
Ex Taq DNA polysaccharase and reaction buffer, dNTP, MgCl
2, reagent such as dna molecular amount standard DL 1000, electrophoresis sample-loading buffer, Tris-HCl is all available from precious biotechnology (Dalian) ltd; Electrophoresis level agarose is available from Nanjing Sheng Xing biotech firm; Primer and probe entrust Nanjing Genscript Biotechnology Co., Ltd. synthetic.
2. instrument and equipment
PCR appearance (Veritee96-well, American AB I company); Nucleic acid electrophoresis apparatus (SUB-cell GT, U.S. Bio-Rad company); Gel imaging system (Universal Hood II, U.S. Bio-Rad company); High speed freezing centrifuge (3-18K, U.S. Sigma company); Quantitative real time PCR Instrument (7500, American AB I company).
3. two-step approach half-nest type-multiplex PCR is to each target species DNA detection specificity checking
The design of primers of two-step approach half-nest type-multiplex PCR is seen Fig. 1, and the method layout strategy is seen " summary of the invention ".Measure total DNA concentration of the target meat of test kit method or atmosphere-chloroform extraction method extraction, adjustment concentration to 100 pg/ μ l is as the template of method specificity checking.Hybrid dna that respectively genome DNA of 100 pg chickens, ox, sheep, 4 kinds of target species of pig and each 100 pg thereof is made up in twos and 100 pg soybean, fish, horse, four kinds of contrasts of donkey species DNA are as template; At first use SIM1 and SIM2 to carry out 20 round-robin first round PCR reactions as primer; Reaction system 20 μ L; Reaction conditions is: preparatory sex change 3 min of 95 oC, and 20 round-robin 95 oC 30 s, 54 oC, 30 s, 72 oC, 40 s, last 72 oC extend 7 min.Get 1 μ L reaction product again as template; Use SIM1, C, B, M, P mix primer to carry out second and take turns multi-PRC reaction; Reaction system 50 μ L; Reaction conditions is: preparatory sex change 3 min of 95 oC, and 30 round-robin 95 oC 30 s, 52 oC, 30 s, 72 oC, 40 s, last 72 oC extend 7 min.Get 10 μ L products and carry out 1% agarose gel electrophoresis, observe cross reaction and non-specific amplification whether occur, judge the specificity of half-nest type-multiple PCR method.
4. half-nest type-multi-PRC reaction condition optimizing and test kit design
Adjust primer concentration, multiple PCR primer proportioning, annealing temperature, reaction cycle number, extension time in the two-step reaction respectively, through comparison, to obtain The optimum reaction conditions to band brightness and atopic.
Under optimized conditions, first round PCR and second is taken turns premixed liquid 1 and premixed liquid 2 that the outer all the components of removing template in the reaction system of multiplex PCR is formulated as test kit, the first round and second that directly is used for half-nest type-multiplex PCR is respectively taken turns reaction.
Half-nest type-multiple PCR reagent kit sensitivity confirm and with the comparison of existing standard, kit method
Total DNA10 times of gradient dilution with above-mentioned target species; 201210099651.1), fluorescence quantitative PCR method (entry and exit industry standard SN/T2051-2008, Takara test kit) carries out species and detect use test kit of the present invention, multiplex PCR method (number of patent application: respectively; Confirming the detection sensitivity of half-nest type-multiplex PCR and multiplex PCR through observing electrophoretic band, is that 35 template amount is confirmed the sensitivity of quantitative fluorescent PCR and compared through the Ct value.
< 110>Nanjing Quality Supervision and Examination Institute
< 120>a kind of test kit and application of differentiating four kinds of compositions of pig, cattle and sheep chicken in the food simultaneously
<160>?6
<210>?1
<211>?27
<212>?DNA
< 213>artificial sequence
<400>?1
cccatcaaacatctcatcttgatgaaa
<210>?2
<211>?20
< 213>artificial sequence
<400>?2
aagtggaaggcgaagaatcg
<210>?3
<211>?27
< 213>chicken (Gallus gallus)
<400>?3
aagatacagatgaagaagaatgaggcg
<210>?4
<211>?28
< 213>ox (Bos taurus)
<400>?4
ctagaaaagtgtaagacccgtaatataa
<210>?5
<211>?27
< 213>sheep or goat (Ovis aries, Capra hircus)
<400>?5
gcctatgaatgctgtggctattgtcgc
<210>?6
<211>?27
< 213>pig (Sus scrofa)
<400>?6
gctgatagtagatttgtgatgaccgta
Claims (3)
1. test kit of differentiating four kinds of meat compositions of pig, cattle and sheep chicken in the food based on half-nest type-multiplex PCR the time is characterized in that being made up of following reagent:
(1) premixed liquid 1: contain primer SIM1 0.4 μ M, primer SIM2 0.4 μ M, Taq enzyme 1.25 U, each 0.2 μ M of dNTP, Tris-HCl 10 mM of PH8.5, KCl 50mM, MgCl
21.5 mM, premixed liquid 1 storage condition is 4 oC, half a year quality guaranteed period;
(2) premixed liquid 2: contain primer SIM1 0.4 μ M, primer P 0.4 μ M, primer C 0.4 μ M, primer B 0.4 μ M, primer S 0.4 μ M, Taq enzyme 1.25 U, each 0.2 μ M of dNTP, Tris-HCl 10 mM of PH8.5, KCl 50mM, MgCl
21.5 mM, tetrabromophenol sulfonphthalein 5%v/v, premixed liquid 2 storage conditions are 4oC, half a year quality guaranteed period.
2. the said test kit of claim 1 is used for the kind authentication method of deep-processed food meat composition, it is characterized in that being made up of following steps:
After total DNA 1 μ L that (1) will from dried meat floss, ham sausage deep-processed food, extract and the premixed liquid in 19 these test kits of μ L 1 mix on ice; On the regular-PCR appearance, carry out first round amplified reaction; Reaction conditions is following: preparatory sex change 3 min of 95 oC; 20 round-robin 95 oC 30 s, 54 oC, 30 s, 72 oC, 40 s, last 72 oC extend 7 min;
(2) get 2 μ L reaction product; After mixing on ice with premixed liquid in 48 these test kits of μ L 2; On the regular-PCR appearance, carry out second and take turns amplified reaction; Reaction conditions is following: preparatory sex change 3 min of 95 oC, and 30 round-robin 95 oC 30 s, 52 oC, 30 s, 72 oC, 40 s, last 72 oC extend 7 min;
(3) get 10 μ L reaction product and carry out 2% agarose gel electrophoresis; The dna molecular amount standard of using 100 bp to 1000 bp is as contrast; Gel is observed, taken pictures under uv lamp, the kind of four kinds of meats in the food is identified simultaneously according to the molecular weight size of specific band the specific band size of chicken, ox, sheep, pig is respectively 216 bp; 263 bp, 322 bp and 387 bp.
3. the said test kit of claim 1 can't differentiate that at existing PCR, fluorescence quantifying PCR method the deep-processed food of meat kind detects or meat is mingled the application in the discriminating.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210281034.3A CN102776289B (en) | 2012-08-09 | 2012-08-09 | Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210281034.3A CN102776289B (en) | 2012-08-09 | 2012-08-09 | Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102776289A true CN102776289A (en) | 2012-11-14 |
| CN102776289B CN102776289B (en) | 2014-04-30 |
Family
ID=47121391
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210281034.3A Active CN102776289B (en) | 2012-08-09 | 2012-08-09 | Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102776289B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243165A (en) * | 2013-05-13 | 2013-08-14 | 长沙市食品质量安全监督检测中心 | Method for rapidly detecting pig source components in red meat through real-time fluorescence loop-mediated isothermal amplification (LAMP) method |
| CN104673900A (en) * | 2015-02-05 | 2015-06-03 | 中国肉类食品综合研究中心 | Method for identifying animal-derived ingredients in meat or meat product |
| CN104988231A (en) * | 2015-07-01 | 2015-10-21 | 山东世通检测评价技术服务有限公司 | Semi-nested-multiple PCR (Polymerase Chain Reaction) method for discerning authenticity of donkey-hide gelatin |
| CN105969880A (en) * | 2016-06-21 | 2016-09-28 | 北京农学院 | Quadruple PCR detection method for meat component and application |
| CN107858443A (en) * | 2017-12-08 | 2018-03-30 | 锡林郭勒职业学院 | Quantitatively detect primer, probe and the kit of sheep, ox and pig source property in meat products |
| CN108977552A (en) * | 2018-08-14 | 2018-12-11 | 北华大学 | Meat identifies positive reference substance and its preparation method and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102605090A (en) * | 2012-03-31 | 2012-07-25 | 南京市产品质量监督检验院 | Multiplex PCR method for distinguishing four meat components in food at the same time |
-
2012
- 2012-08-09 CN CN201210281034.3A patent/CN102776289B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102605090A (en) * | 2012-03-31 | 2012-07-25 | 南京市产品质量监督检验院 | Multiplex PCR method for distinguishing four meat components in food at the same time |
Non-Patent Citations (3)
| Title |
|---|
| MIGUEL A. RODRı´GUEZ: "TaqMan real-time PCR for the detection and quantitation of pork in meat mixtures", 《MEAT SCIENCE》, vol. 70, 31 December 2005 (2005-12-31), pages 113 - 120 * |
| P.S. GIRISHA: "Sequence analysis of mitochondrial 12S rRNA gene can identify meat species", 《MEAT SCIENCE》, vol. 66, 31 December 2004 (2004-12-31), pages 551 - 556 * |
| T. MATSUNAG: "A quick and simple method for the identification of meat species and meat products by PCR assay", 《MEAT SCIENCE》, vol. 51, 31 December 1999 (1999-12-31), pages 143 - 148 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243165A (en) * | 2013-05-13 | 2013-08-14 | 长沙市食品质量安全监督检测中心 | Method for rapidly detecting pig source components in red meat through real-time fluorescence loop-mediated isothermal amplification (LAMP) method |
| CN104673900A (en) * | 2015-02-05 | 2015-06-03 | 中国肉类食品综合研究中心 | Method for identifying animal-derived ingredients in meat or meat product |
| CN104673900B (en) * | 2015-02-05 | 2018-07-13 | 中国肉类食品综合研究中心 | A method of differentiating animal derived materials in meat or meat products |
| CN104988231A (en) * | 2015-07-01 | 2015-10-21 | 山东世通检测评价技术服务有限公司 | Semi-nested-multiple PCR (Polymerase Chain Reaction) method for discerning authenticity of donkey-hide gelatin |
| CN104988231B (en) * | 2015-07-01 | 2017-09-01 | 山东世通检测评价技术服务有限公司 | A kind of half-nest type Multiplex PCR for differentiating authenticity of hide glue |
| CN105969880A (en) * | 2016-06-21 | 2016-09-28 | 北京农学院 | Quadruple PCR detection method for meat component and application |
| CN107858443A (en) * | 2017-12-08 | 2018-03-30 | 锡林郭勒职业学院 | Quantitatively detect primer, probe and the kit of sheep, ox and pig source property in meat products |
| CN107858443B (en) * | 2017-12-08 | 2020-08-04 | 锡林郭勒职业学院 | Primer, probe and kit for quantitatively detecting sources of sheep, cattle and pigs in meat products |
| CN108977552A (en) * | 2018-08-14 | 2018-12-11 | 北华大学 | Meat identifies positive reference substance and its preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102776289B (en) | 2014-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104673900B (en) | A method of differentiating animal derived materials in meat or meat products | |
| CN102776289B (en) | Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof | |
| CN102605090A (en) | Multiplex PCR method for distinguishing four meat components in food at the same time | |
| CN104946788B (en) | A kind of PCR primer and kit for differentiating 8 kinds of animal derived materials | |
| CN103361422B (en) | Multiplex-PCR rapid detection method for identification of adulterated meat and products thereof | |
| CN102864243B (en) | Taqman probe fluorescent quantitation polymerase chain reaction (PCR) method for rapidly detecting pork or chicken compositions in food added with internal amplification control | |
| CN105648046B (en) | Method for identifying sheep, goat, mink, nutria and duck meat at one time | |
| CN103642917A (en) | Kit for identifying murine components in food, preparation method and detection method | |
| CN113073140B (en) | PCR detection primer group and method for simultaneously identifying 7 meat-derived foods | |
| Kesmen et al. | Detection of seagull meat in meat mixtures using real-time PCR analysis | |
| Liu et al. | A multiplex PCR assay mediated by universal primers for the detection of adulterated meat in mutton | |
| CN104946790A (en) | PCR method for tracking source identification of origin components of eight kinds of animals | |
| CN104099405A (en) | PCR (polymerase chain reaction) detection method and kit for one-time identification of mutton, chicken, duck and pork | |
| Zhao et al. | Development of a species-specific PCR coupled with lateral flow immunoassay for the identification of goose ingredient in foods | |
| Hubalkova et al. | Identification of gadoid species in fish meat by polymerase chain reaction (PCR) on genomic DNA | |
| CN103525908A (en) | Method for rapidly detecting chicken, duck and pig blood components in blood jelly | |
| CN106834461B (en) | Universal detection method for high-throughput next generation sequencing of animal-derived components in biological products | |
| CN102242220A (en) | Polymerase chain reaction (PCR) primer pair for identifying or assisting in identifying duck tissues and/or organs and application of PCR primer pair | |
| CN109852705B (en) | Method and kit for rapidly detecting horse-derived components in food | |
| CN107012247B (en) | Real-time fluorescence PCR detection method for detecting goat-derived ingredients in food and feed by using single-copy nuclear gene | |
| CN106995852B (en) | Real-time fluorescence PCR detection method for detecting sheep-derived components in food and feed by using single-copy nuclear gene | |
| CN108085374B (en) | Dual digital PCR method for quantitatively detecting turkey-derived components | |
| CN103451304A (en) | Primer probe and method for performing real-time fluorescent polymerase chain reaction (PCR) detection on origin ingredients of raccoon | |
| CN114686600B (en) | Primer group and method for meat detection based on seven-fold PCR technology | |
| CN104962650A (en) | PCR method and kit for synchronously identifying animal-derived ingredients |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhang Chi Inventor before: Zhang Chi |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |