CN102776289B - Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof - Google Patents
Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof Download PDFInfo
- Publication number
- CN102776289B CN102776289B CN201210281034.3A CN201210281034A CN102776289B CN 102776289 B CN102776289 B CN 102776289B CN 201210281034 A CN201210281034 A CN 201210281034A CN 102776289 B CN102776289 B CN 102776289B
- Authority
- CN
- China
- Prior art keywords
- food
- primer
- chicken
- pcr
- meat
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of food quality safety detection, particularly relates to a reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at the same time and application of the reagent kit. Aiming at seriously degradative total DNA in deep processing food, firstly a premixing liquid comprising general primers SIM1 and SIM2 are used for first amplification, an amplification produce is used as a template of second amplification; then the premixing liquid comprising the general primer SIM1 and five species specificity primers P, C, B, M are used for the second multiple PCR amplification to the template, the second amplification product is detected by electrophoresis, and four meat ingredients of pork, beef, cotton and chicken in the food are identified according to the molecular weight size of electrophoresis strips. It is proved that the detection sensitivity of the conventional PCR-based food component detection method is greatly improved by using the semi-nested type-multiplex PCR technology under the condition that the detection specificity is ensured. The reagent kit can be used for the meet type screen and detection and supervision of meet adulteration in the deep processing food.
Description
One. technical field
The invention belongs to Safety of Food Quality detection technique field, be specifically related to a kind of test kit and application of simultaneously differentiating pig in food, ox, sheep, four kinds of compositions of chicken.Its sensitivity is compared to existing PCR and fluorescent quantitative PCR technique and improve 1-3 the order of magnitude, can be used for the detection of meat kind in the deep-processed food of DNA severely degrade.
Two. background technology
The doping of meat product is adulterated is that China's food quality is controlled one of significant challenge facing.In recent years, illegal enterprise, under the ordering about of interests, is used the meat raw materials such as relatively inexpensive pork, chicken, pretends to be the relatively high meat products of price such as beef, mutton to sell, the human consumer's that constituted a serious infringement legitimate rights and interests.The exposure of " extractum carnis " event makes the adulterated focus that further becomes public attention of meat.In the recent period, the ground such as Henan has occurred again using chicken, duck etc. to pretend to be the event of mutton cubes roasted on a skewer.Adulterated another " underlying rule " that has become China's Safety of Food Quality of meat-based food.
The polymerase chain reaction (PCR) of take has become the core methed that meat kind in food is identified as basic technology.Difference site design Auele Specific Primer according to different plant species gene order, utilizes PCR reaction to realize the exponential amplification of characterizing gene fragment in food, then by electrophoresis detection, differentiates source of species possible in food.In recent years, the develop rapidly of real-time fluorescence PCR technology has improved efficiency and sensitivity that in food, species are differentiated greatly, and makes quantitatively tracing to the source of meat content become possibility.Nowadays, according to Mitochondrial Genome Overview DNA sequence dna difference design Species-specific primer, set up PCR and real time fluorescent PCR method and seen a large amount of reports, and entered domestic authority's detection technique standard (SN/T2051-2008 food, cattle and sheep pig derived component detection method PCR in real time method in makeup and feed, pig derived component qualitative checking method PCR method in the animal derived feed of GB/T21101-2007), on market, also there is relevant commercial kit (Takara Real Time PCR Porcine DNA Detection Kit), to meat product adulterated control with supervision in brought into play vital role.This laboratory been has also has been researched and developed four kinds of meats has been carried out to the application multiple PCR method (number of patent application: 201210099651.1), can carry out the high-throughout while to pig, cattle and sheep chicken composition in food and differentiate fast of simultaneously differentiating fast.
Yet, we (national agricultural byproducts Product Quality Verification Centers) to the actual detection of meat sample kind in, no matter use PCR or fluorescence quantifying PCR method in above-mentioned standard, or the PCR test kit of commodity in use, when some are detected through the DNA extracting in the meat product of deep processing, usually cannot obtain amplified band or fluorescent signal.These deep processing meat products mainly comprise the meat stuffing in dried meat floss, ham sausage and bologna sausage, shortening flour products etc.According to statistics, in 108 parts of deep-processed foods that detect in the recent period at us, what the existing method of use failed to differentiate has 27 parts, accounts for 25.0%.We infer, meat DNA process deep processing in these food is severely degrade fragmentation, cause as the complete object DNA fragmentation that detects template few, in addition likely have certain PCR reaction suppressor, the sensitivity of existing PCR or fluorescence quantifying PCR method can not meet the needs of detection.In order to address this problem, we have attempted optimization reaction conditions, have used the multiple strategies such as two-step approach half-nest type-multiple PCR technique, brachymemma primer, through overtesting, use half-nest type-multiplex PCR guaranteeing under specific prerequisite, significantly to have promoted detection sensitivity, on this basis, we have developed the highly sensitive test kit of simultaneously differentiating four kinds of compositions of pig, cattle and sheep chicken in food, can effectively to deep-processed food, carry out kind discriminating.
Three. summary of the invention
The problem that the present invention need to solve is: at present meat kind in the deep-processed food of DNA severely degrade being identified to the present situation that lacks effective ways, application two-step approach half-nest type-multiple PCR technique, develop a kind of test kit of simultaneously differentiating four kinds of compositions of pig, cattle and sheep chicken in food, optimize and the using method of definite test kit, the deep processing meat-based food that can cannot detect application existing standard method and kit method carries out kind discriminating.
General technical route of the present invention is: the total DNA extracting in deep-processed food of take is template, first use a pair of universal primer to carry out first round amplification, amplification target is the homologous fragment of 490bp in pig, ox, sheep (comprising goat and sheep), 4 species Mitochondrial Genome Overview of chicken; Then using first round amplified production as the second template of taking turns amplification, forward primer is still used the forward primer of first round amplification, reverse primer is used the Auele Specific Primer of pig, ox, sheep, 4 species of chicken, carry out second and take turns multiplex PCR amplification, amplified production is carried out to agarose gel electrophoresis, according to band molecular weight difference, meat kind is differentiated.Based on above-mentioned two-step approach half-nest type-multiple PCR technique, committed step condition in experiment flow, reagent composition and concentration are optimized, two-wheeled PCR in half-nest type-multiplex PCR is reacted to required reagent and be formulated as respectively premixed liquid 1 and premixed liquid 2, develop the test kit of simultaneously differentiating pig in food, ox, sheep, four kinds of compositions of chicken.User carries out first round PCR reaction after only the total DNA extracting in deep-processed food need being mixed with premixed liquid 1, then after first round PCR product being mixed with premixed liquid 2, carry out second and take turns PCR reaction, greatly simplified operation steps, reduced the professional requirement to operator, within 3-4 hour, can accurately differentiate 4 kinds of meat kinds in deep-processed food.
Use the test kit of the present invention's development to detect species DNA such as pig, ox, sheep, four kinds of target dnas of chicken and combination thereof, soybean, fish, goose, horse, donkeys, result shows that the specificity of this test kit is good, does not have cross reaction and non-specific amplification, use respectively the DNA profiling of 10 times of gradient dilutions, detection sensitivity to this test kit to four kinds of target species, the fluorescence quantitative kit (Real Time PCR Porcine DNA Detection Kit) of pig derived component in food detects in Takara company, SN/T2051-2008 food in entry and exit industry standard, cattle and sheep pig derived component detection method-PCR in real time method in makeup and feed, the multiple PCR method of this laboratory development (number of patent application: sensitivity 201210099651.1) is verified and compared, the detection sensitivity of this kit method has improved 2-3 the order of magnitude than multiple PCR method, than standard and commercialization fluorescence quantitative kit method, improved 1-2 the order of magnitude.
Described in " background technology ", in 108 parts of deep-processed foods that detect in the recent period at national agricultural byproducts Product Quality Verification Centers, that uses that existing standard method and test kit fail to differentiate has 27 parts, accounts for 25.0%.The kit method of application the present invention development, has successfully carried out kind discriminating to this 27 duplicate samples, has found that 12 routine meats are adulterated, has verified unique advantage and the actual application value of this test kit aspect the discriminating of deep-processed food meat kind.
Technical scheme of the present invention comprises: 1. according to the primer sequence of pig, ox, sheep, 4 species plastosome homologous sequence design two-step approach half-nest type-multiplex PCRs of chicken.2. application two-step approach half-nest type-multiplex PCR detects each target species DNA and contrast species DNA, the specificity of verification method.3. optimize reaction conditions and reagent concentration, design construction is differentiated the test kit of pig, ox, sheep, 4 kinds of compositions of chicken in food, determines the using method of test kit.4. use the target species DNA of gradient dilution, the detection sensitivity of checking test kit of the present invention, and make comparisons with the sensitivity of standard method and commercial kit.5. use kit method of the present invention, to applying the food samples that existing method fails to differentiate, carry out kind detection.Details are as follows:
1. according to the primer sequence of pig, ox, sheep, 4 species plastosome homologous sequence design two-step approach half-nest type-multiplex PCRs of chicken.
The primer that the present invention uses comprises forward universal primer SIM1 that first round PCR is used and reverse universal primer SIM2, and second to take turns the forward primer that multiplex PCR uses be still SIM1, and reverse primer is C (chicken), M(sheep), B(ox), P(pig).In the present invention, SIM1 and C, M, B, P differentiate the same primers (number of patent application: 201210099651.1) of the multiple PCR technique of these 4 kinds of target meat compositions in food when all adopting this laboratory to research and develop, SIM2 is that the present invention is according to the reverse universal primer of the height homologous sequence design of 4 kinds of target species Mitochondrial Genome Overview, use and carry out first round PCR and react with forward universal primer SIM1 pairing, the homologous sequence that can simultaneously amplify 4 target species 490bp is as the second template of taking turns multiplex PCR.Primer sequence is in Table 1, and the binding site of primer and each species Mitochondrial Genome Overview is shown in accompanying drawing 1.
Table 1. half-nest type-multiple PCR reagent kit the primer sequence
2. application two-step approach half-nest type-multiplex PCR detects each target species DNA and contrast species DNA, the specificity of verification method.
Use respectively 100pg chicken, ox, sheep, the genome DNA of 4 kinds of target species of pig and the hybrid dna of each 100pg combination of two thereof, and 100pg soybean, fish, horse, four kinds of contrast species DNA of donkey are as template, first use SIM1 and SIM2 as primer, to carry out the first round PCR reaction of 20 circulations, get again 1 μ L reaction product as template, use SIM1, C, B, M, P mix primer is carried out second and is taken turns multi-PRC reaction, get 10 μ L products and carry out agarose gel electrophoresis, collection of illustrative plates (accompanying drawing 2) shows, all there is not cross reaction and non-specific amplification in each reaction tubes, other species DNA in contrast does not all increase yet, show to apply two-step approach half-nest type-multiplex PCR detection target species and hybrid dna specificity thereof good.
3. optimize reaction conditions and reagent concentration, design construction is differentiated the highly sensitive test kit of pig, ox, sheep, 4 kinds of compositions of chicken in food, determines its using method.
Verifying that two-step approach half-nest type-multiplex PCR differentiates on the specificity basis of target species simultaneously, reaction composition, PCR reaction conditions that we take turns multiplex PCR to first round PCR and second are optimized, to design highly sensitive test kit.The index of optimizing comprises: primer concentration, multiple PCR primer proportioning, annealing temperature, reaction cycle number, extension time.Under the condition of optimizing, we take turns first round PCR and second premixed liquid 1 and premixed liquid 2 that all the components outside removing template in the reaction system of multiplex PCR is formulated as respectively test kit, make test kit, and its composition is respectively:
(1) premixed liquid 1: wherein comprise primer SIM10.4 μ M, primer SIM20.4 μ M, Taq enzyme 1.25U, each 0.2 μ M of dNTP, the Tris-HCl10mM of PH8.5, KCl50mM, MgCl
21.5mM premixed liquid 1 storage condition is 4 ℃, half a year quality guaranteed period.
(2) premixed liquid 2: wherein comprise primer SIM10.4 μ M, primer P0.4 μ M, primer C0.4 μ M, primer B0.4 μ M, primer M0.4 μ M, Taq enzyme 1.25U, each 0.2 μ M of dNTP, the Tris-HCl10mM of PH8.5, KCl50mM, MgCl
21.5mM, tetrabromophenol sulfonphthalein 5%(v/v) premixed liquid 1 storage condition is 4 ℃, half a year quality guaranteed period.
Specification sheets using two-step approach half-nest type-multi-PRC reaction condition of optimizing as this test kit, details are as follows:
(1) by the total DNA1 μ L extracting from the deep-processed foods such as dried meat floss, ham sausage with after premixed liquid 1 in 19 these test kits of μ L mixes on ice, on regular-PCR instrument, carry out amplified reaction, reaction conditions is as follows: 95 ℃ of denaturation 3min, 95 ℃ of 30s of 20 circulations, 54 ℃ of 30s, 72 ℃ of 40s, last 72 ℃ are extended 7min.
(2) get 2 μ L reaction product, after premixed liquid 2 in 48 these test kits of μ L mixes on ice, on regular-PCR instrument, carry out amplified reaction, reaction conditions is as follows: 95 ℃ of denaturation 3min, 95 ℃ of 30s of 30 circulations, 52 ℃ of 30s, 72 ℃ of 40s, last 72 ℃ are extended 7min.
(3) get 10 μ L reaction product and carry out 2% agarose gel electrophoresis, use the DNA molecular amount standard of 100bp to 1000bp in contrast.Gel is observed, taken pictures under ultraviolet lamp, according to the molecular size range of specific band, the kind of four kinds of meats in food is identified simultaneously, the specific band size of chicken, ox, sheep, pig is respectively 216bp, 263bp, 322bp and 387bp.
4. use the target species DNA of gradient dilution, the detection sensitivity of checking test kit of the present invention, and make comparisons with the sensitivity of standard method and commercial kit.
Using respectively 4 kinds of target species DNA of 10 times of gradient dilutions is template, applying test kit of the present invention detects, while only adding 1pg template DNA in reaction system, still can be observed target stripe (accompanying drawing 3), show that this test kit reaches 1pg/ reaction for the detection sensitivity of target species.
4 kinds of target species DNA of 10 times of gradient dilutions of same use are template, apply the multiple PCR method (number of patent application: 201210099651.1) 4 kinds of target species are detected, its detection is limited to 100-1000pg/ reaction of this development in laboratory; The real-time fluorescence PCR method that in application China entry and exit industry standard SN/T2051-2008 food, makeup and feed, cattle and sheep pig derived component detection method and Takara company pig source property detection kit provide detects the genomic dna of pig, 35 the template amount of being less than according to Ct value is carried out sensitivity confirmation, and its detection is limited to 10-100pg/ reaction.
To sum up, the sensitivity that test kit of the present invention is differentiated four kinds of species of chicken cattle and sheep pig in food, compared with the high 2-3 of a Multiplex PCR order of magnitude, improves 1-2 the order of magnitude compared with the real-time fluorescence PCR method providing in commercial reagent box and standard.
5. use kit method of the present invention, to applying the food samples that existing method fails to differentiate, carry out kind detection.
In 108 portions of deep processing meat products that detect in the recent period at national agricultural byproducts Product Quality Verification Centers, that uses that existing standard method and test kit fail its kind to differentiate has 27 parts, account for 25.0%, comprise 25 portions of dried meat floss, 1 portion of ham sausage and 1 portion of frying meat stuffing, while using Takara kind identification kit to identify with the Real-time PCR method of entry and exit industry standard, all do not have any fluorescent signal.Half-nest type-multiple PCR reagent kit method of application the present invention development, successfully this 27 duplicate samples has been carried out to kind discriminating, 12 parts of situations that the meat species that all exists actual kind and mark is not inconsistent wherein, be and use pork to pretend to be forcemeat veal or mutton filling, proved that this test kit is applicable to the evaluation of meat kind in deep-processed food that existing method can not differentiate.
The invention has the beneficial effects as follows: although existing examination criteria, commercial kit PCR and real-time fluorescence PCR method are identified quick, sensitive detection technique is provided for meat product kind, but in reality detects, still have part deep processing meat product due to the existence of DNA severely degrade and PCR reaction suppressor, make the sensitivity of aforesaid method cannot reach the requirement that kind is identified.Unresolved this problem, the present invention has developed the highly sensitive test kit that pig in the food based on half-nest type-multiplex PCR, ox, sheep, four kinds of meat compositions of chicken detect simultaneously, the more existing PCR method of its sensitivity has improved each order of magnitude of 2-3, compared with real-time fluorescence PCR method, improve 1-2 the order of magnitude, can reach 1pg/ reaction.Guaranteeing under the prerequisite of detection specificity and accuracy, the deep-processed food that can cannot detect application prior art is realized kind and is identified, is the kind detection method that prior art medium sensitivity is the highest.Apply this test kit, the deep-processed food that can successfully can not differentiate existing method carries out the evaluation of meat kind, to meat in deep-processed food is adulterated, controls.In addition, this test kit carries out the reagent of heminested PCR two-step reaction respectively integrated, easy and simple to handle, has reduced personnel's requirement.Therefore, test kit provided by the invention is at present unique specially for multiple meat mirror method for distinguishing in deep-processed food, the sensitivity of method is better than prior art, can be used for food safety detection department of government, large-scale food selling enterprise to the adulterated supervision of deep processing meat product and control, there is significant practical value.
Four. accompanying drawing explanation
Half-nest type-multiple PCR primer binding sequence in each target species Mitochondrial Genome Overview of Fig. 1.C: chicken; B: ox; P: pig; M: sheep (comprising sheep S and goat G); SIM1: forward universal primer; SIM2: reverse universal primer.Sequence in square frame is primer binding site.
The detection specificity of Fig. 2 half-nest type-multiple PCR reagent kit method to each target species and contrast species.Swimming lane 1-15 adds chicken, ox, sheep, pig, Ji Jianiu, Ji Jiayang, chicken respectively total DNA that pig, Niu Jiayang, ox add mixture that pig, sheep add pig, 4 kinds of target meats, fish, horse, donkey, soybean as template, uses half-nest type-multiple PCR reagent kit to carry out species detection.The template DNA of every kind of target species is 100pg/ reaction.M:DNA molecular weight standard.
The sensitivity checking of Fig. 3 half-nest type-multiple PCR reagent kit method to each target species.Template amount in every reaction of each swimming lane representative is respectively: swimming lane 1-3: the total DNA10pg of chicken, 1pg and 0.1pg; Swimming lane 4-6: the total DNA10pg of ox, 1pg and 0.1pg; Swimming lane 7-9: the total DNA10pg of sheep, 1pg and 0.1pg; Swimming lane 10-12: the total DNA10pg of pig, 1pg and 0.1pg.M:DNA molecular weight standard.
Five. embodiment
1. material and reagent
Ex Taq archaeal dna polymerase and reaction buffer, dNTP, MgCl
2, the reagent such as DNA molecular amount standard DL1000, electrophoresis sample-loading buffer, Tris-HCl is all purchased from precious biotechnology (Dalian) company limited; Electrophoresis level agarose is purchased from Nanjing Sheng Xing biotech firm; Primer and probe entrust Nanjing Genscript Biotechnology Co., Ltd. synthetic.
2. instrument and equipment
PCR instrument (Veritee96-well, American AB I company); Nucleic acid electrophoresis apparatus (SUB-cell GT, U.S. Bio-Rad company); Gel imaging system (Universal Hood II, U.S. Bio-Rad company); High speed freezing centrifuge (3-18K, U.S. Sigma company); Quantitative real time PCR Instrument (7500, American AB I company).
3. two-step approach half-nest type-multiplex PCR is to each target species DNA detection specificity checking
The design of primers of two-step approach half-nest type-multiplex PCR is shown in Fig. 1, and method layout strategy is shown in " summary of the invention ".Measure total DNA concentration of the target meat of test kit method or atmosphere-chloroform extraction method extraction, adjust concentration to 100pg/ μ l, as the template of method specificity checking.Respectively using 100pg chicken, ox, sheep, the genome DNA of 4 kinds of target species of pig and the hybrid dna of each 100pg combination of two thereof and 100pg soybean, fish, horse, four kinds of contrast species DNA of donkey as template, first use SIM1 and SIM2 as primer, to carry out the first round PCR reaction of 20 circulations, reaction system 20 μ L, reaction conditions is: 95 ℃ of denaturation 3min, 95 ℃ of 30s of 20 circulations, 54 ℃ of 30s, 72 ℃ of 40s, last 72 ℃ are extended 7min.Get again 1 μ L reaction product as template, use SIM1, C, B, M, P mix primer to carry out second and take turns multi-PRC reaction, reaction system 50 μ L, reaction conditions is: 95 ℃ of denaturation 3min, 95 ℃ of 30s of 30 circulations, 52 ℃ of 30s, 72 ℃ of 40s, last 72 ℃ are extended 7min.Get 10 μ L products and carry out 1% agarose gel electrophoresis, observe and whether occur cross reaction and non-specific amplification, the specificity of judgement half-nest type-multiple PCR method.
4. half-nest type-multi-PRC reaction condition optimizing and test kit design
Adjust respectively primer concentration, multiple PCR primer proportioning, annealing temperature, reaction cycle number, extension time in two-step reaction, by the comparison to band brightness and atopic, to obtain best reaction conditions.
Under the condition of optimizing, first round PCR and second is taken turns to premixed liquid 1 and premixed liquid 2 that all the components outside removing template in the reaction system of multiplex PCR is formulated as test kit, the first round and second that is directly used in respectively half-nest type-multiplex PCR is taken turns reaction.
The sensitivity of half-nest type-multiple PCR reagent kit confirm and with the comparison of existing standard, kit method
By total DNA10 times of gradient dilution of above-mentioned target species, 201210099651.1), fluorescence quantitative PCR method (entry and exit industry standard SN/T2051-2008, Takara test kit) carries out species detection apply respectively test kit of the present invention, Multiplex PCR (number of patent application:, the detection sensitivity of determining half-nest type-multiplex PCR and multiplex PCR by observing electrophoretic band, the template amount that is 35 by Ct value is determined the sensitivity of quantitative fluorescent PCR and compares.
<110> Nanjing Quality Supervision and Examination Institute
<120> test kit and application of simultaneously differentiating four kinds of compositions of pig, cattle and sheep chicken in food
<160>?6
<210>?1
<211>?27
<212>?DNA
<213> artificial sequence
<400>?1
cccatcaaacatctcatcttgatgaaa
<210>?2
<211>?20
<213> artificial sequence
<400>?2
aagtggaaggcgaagaatcg
<210>?3
<211>?27
<213> chicken (Gallus gallus)
<400>?3
aagatacagatgaagaagaatgaggcg
<210>?4
<211>?28
<213> ox (Bos taurus)
<400>?4
ctagaaaagtgtaagacccgtaatataa
<210>?5
<211>?27
<213> sheep or goat (Ovis aries, Capra hircus)
<400>?5
gcctatgaatgctgtggctattgtcgc
<210>?6
<211>?27
<213> pig (Sus scrofa)
<400>?6
gctgatagtagatttgtgatgaccgta
Claims (3)
1. a test kit of differentiating pig in food, ox, sheep, four kinds of meat compositions of chicken in the time of based on half-nest type-multiplex PCR, is characterized in that consisting of following reagent:
(1) premixed liquid 1: wherein comprise primer SIM10.4 μ M, sequence is CCCATCAAACATCTCATCTTGATGAAA, primer SIM20.4 μ M, sequence is AAGTGGAAGGCGAAGAATCG, Taq enzyme 1.25U, each 0.2 μ M of dNTP, the Tris-HCl10mM of PH8.5, KCl50mM, MgCl21.5mM, premixed liquid 1 storage condition is 4 ℃, half a year quality guaranteed period;
(2) premixed liquid 2: wherein comprise primer SIM10.4 μ M, primer P0.4 μ M, sequence is GCTGATAGTAGATTTGTGATGACCGTA, primer C0.4 μ M, sequence is AAGATACAGATGAAGAAGAATGAGGCG, primer B0.4 μ M, and sequence is CTAGAAAAGTGTAAGACCCGTAATATA, primer M0.4 μ M, sequence is GCCTATGAATGCTGTGGCTATTGTCGC, Taq enzyme 1.25U, each 0.2 μ M of dNTP, the Tris-HCl10mM of PH8.5, KCl50mM, MgCl21.5mM, tetrabromophenol sulfonphthalein 5%, premixed liquid 2 storage conditions are 4 ℃, half a year quality guaranteed period.
2. the using method that a kind of test kit of differentiating pig in food, ox, sheep, four kinds of meat compositions of chicken based on half-nest type-multiplex PCR time is identified for the kind of deep-processed food meat composition according to claim 1, is characterized in that consisting of following steps:
(1) by the total DNA1 μ L extracting in deep-processed food with after premixed liquid 1 in 19 these test kits of μ L mixes on ice, on regular-PCR instrument, carry out first round amplified reaction, reaction conditions is as follows: 95 ℃ of denaturation 3min, 95 ℃ of 30s of 20 circulations, 54 ℃ of 30s, 72 ℃ of 40s, last 72 ℃ are extended 7min;
(2) get 2 μ L reaction product, after premixed liquid 2 in 48 these test kits of μ L mixes on ice, on regular-PCR instrument, carry out second and take turns amplified reaction, reaction conditions is as follows: 95 ℃ of denaturation 3min, 95 ℃ of 30s of 30 circulations, 52 ℃ of 30s, 72 ℃ of 40s, last 72 ℃ are extended 7min;
(3) get 10 μ L reaction product and carry out 2% agarose gel electrophoresis, use range be 100bp to 1000bp DNA molecular amount standard in contrast, gel is observed, taken pictures under ultraviolet lamp, according to the molecular size range of specific band, the kind of four kinds of meats in food is identified simultaneously, the specific band size of chicken, ox, sheep, pig is respectively 216bp, 263bp, 322bp and 387bp.
Described in claim 1 a kind of test kit of differentiating pig in food, ox, sheep, four kinds of meat compositions of chicken based on half-nest type-multiplex PCR time deep-processed food detect or the adulterated discriminating of meat in application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210281034.3A CN102776289B (en) | 2012-08-09 | 2012-08-09 | Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210281034.3A CN102776289B (en) | 2012-08-09 | 2012-08-09 | Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102776289A CN102776289A (en) | 2012-11-14 |
| CN102776289B true CN102776289B (en) | 2014-04-30 |
Family
ID=47121391
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210281034.3A Active CN102776289B (en) | 2012-08-09 | 2012-08-09 | Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102776289B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243165A (en) * | 2013-05-13 | 2013-08-14 | 长沙市食品质量安全监督检测中心 | Method for rapidly detecting pig source components in red meat through real-time fluorescence loop-mediated isothermal amplification (LAMP) method |
| CN104673900B (en) * | 2015-02-05 | 2018-07-13 | 中国肉类食品综合研究中心 | A method of differentiating animal derived materials in meat or meat products |
| CN104988231B (en) * | 2015-07-01 | 2017-09-01 | 山东世通检测评价技术服务有限公司 | A kind of half-nest type Multiplex PCR for differentiating authenticity of hide glue |
| CN105969880B (en) * | 2016-06-21 | 2020-08-07 | 北京农学院 | Quadruple PCR (polymerase chain reaction) detection method for meat components and application |
| CN107858443B (en) * | 2017-12-08 | 2020-08-04 | 锡林郭勒职业学院 | Primer, probe and kit for quantitatively detecting sources of sheep, cattle and pigs in meat products |
| CN108977552A (en) * | 2018-08-14 | 2018-12-11 | 北华大学 | Meat identifies positive reference substance and its preparation method and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102605090A (en) * | 2012-03-31 | 2012-07-25 | 南京市产品质量监督检验院 | Multiplex PCR method for distinguishing four meat components in food at the same time |
-
2012
- 2012-08-09 CN CN201210281034.3A patent/CN102776289B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102605090A (en) * | 2012-03-31 | 2012-07-25 | 南京市产品质量监督检验院 | Multiplex PCR method for distinguishing four meat components in food at the same time |
Non-Patent Citations (11)
| Title |
|---|
| #305 * |
| ´ |
| & * |
| A quick and simple method for the identification of meat species and meat products by PCR assay;T. Matsunag;《Meat Science》;19991231;第51卷;143-148 * |
| acute * |
| guez.TaqMan real-time PCR for the detection and quantitation of pork in meat mixtures.《Meat Science》.2005,第70卷113-120. * |
| Miguel A. Rodrı |
| Miguel A. Rodr& * |
| P.S. Girisha.Sequence analysis of mitochondrial 12S rRNA gene can identify meat species.《Meat Science》.2004,第66卷551-556. |
| Sequence analysis of mitochondrial 12S rRNA gene can identify meat species;P.S. Girisha;《Meat Science》;20041231;第66卷;551-556 * |
| T. Matsunag.A quick and simple method for the identification of meat species and meat products by PCR assay.《Meat Science》.1999,第51卷143-148. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102776289A (en) | 2012-11-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Detection of goat meat adulteration by real-time PCR based on a reference primer | |
| CN102776289B (en) | Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof | |
| Xu et al. | Multiplex TaqMan locked nucleic acid real-time PCR for the differential identification of various meat and meat products | |
| CN104673900B (en) | A method of differentiating animal derived materials in meat or meat products | |
| Kissenkötter et al. | Recombinase polymerase amplification assays for the identification of pork and horsemeat | |
| Wang et al. | Multiplex PCR assay for identification and quantification of bovine and equine in minced meats using novel specific nuclear DNA sequences | |
| Lin et al. | A visual method to detect meat adulteration by recombinase polymerase amplification combined with lateral flow dipstick | |
| Li et al. | A rapid and reliable multiplex PCR assay for simultaneous detection of fourteen animal species in two tubes | |
| CN102864243B (en) | Taqman probe fluorescent quantitation polymerase chain reaction (PCR) method for rapidly detecting pork or chicken compositions in food added with internal amplification control | |
| CN105274246B (en) | The detection kit of several species kind derived components in calf-derived Cyclospora identification and its product | |
| CN103361422B (en) | Multiplex-PCR rapid detection method for identification of adulterated meat and products thereof | |
| CN102605090A (en) | Multiplex PCR method for distinguishing four meat components in food at the same time | |
| CN108060241B (en) | Double-digital PCR method for quantitatively detecting pigeon-derived components | |
| Kesmen et al. | Detection of seagull meat in meat mixtures using real-time PCR analysis | |
| CN104946788A (en) | PCR primer and kit for identifying eight kinds of animal-derived components | |
| CN103642917A (en) | Kit for identifying murine components in food, preparation method and detection method | |
| CN113073140B (en) | PCR detection primer group and method for simultaneously identifying 7 meat-derived foods | |
| Liu et al. | A multiplex PCR assay mediated by universal primers for the detection of adulterated meat in mutton | |
| CN104946790A (en) | PCR method for tracking source identification of origin components of eight kinds of animals | |
| CN114752690A (en) | Method for rapidly identifying duck-origin components in meat products based on MIRA technology | |
| Zhao et al. | Development of a species-specific PCR coupled with lateral flow immunoassay for the identification of goose ingredient in foods | |
| Zhou et al. | Identification of horse, donkey and pig ingredients by species-specific ERA-based methods to assess the authenticity of meat products | |
| CN103525908A (en) | Method for rapidly detecting chicken, duck and pig blood components in blood jelly | |
| CN109852705B (en) | Method and kit for rapidly detecting horse-derived components in food | |
| CN108085374B (en) | Dual digital PCR method for quantitatively detecting turkey-derived components |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhang Chi Inventor before: Zhang Chi |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |