CN107012247B - Real-time fluorescence PCR detection method for detecting goat-derived ingredients in food and feed by using single-copy nuclear gene - Google Patents
Real-time fluorescence PCR detection method for detecting goat-derived ingredients in food and feed by using single-copy nuclear gene Download PDFInfo
- Publication number
- CN107012247B CN107012247B CN201710335321.0A CN201710335321A CN107012247B CN 107012247 B CN107012247 B CN 107012247B CN 201710335321 A CN201710335321 A CN 201710335321A CN 107012247 B CN107012247 B CN 107012247B
- Authority
- CN
- China
- Prior art keywords
- goat
- derived components
- detecting
- derived
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a real-time fluorescence PCR detection method for detecting goat-derived components in food and feed by using single-copy nuclear genes, which comprises the following steps: the first step, taking DNA of a sample to be detected as a template, and carrying out fluorescent quantitative PCR amplification to obtain a PCR amplification product; secondly, detecting the fluorescence signal of the amplification product; thirdly, judging whether the sample contains goat-derived components or not according to the Ct value of the detection result; wherein, the reaction system for PCR amplification contains a specific primer pair for amplifying goat-derived components and a specific probe for amplifying the goat-derived components. The specific primer pair and the probe for real-time fluorescent PCR amplification of the goat-derived component have good specificity and high sensitivity, provide a quantitative detection method for rapidly and accurately detecting whether the goat-derived component is contained in food and feed, and have good application prospect.
Description
Technical Field
The invention belongs to the field of bioengineering, and particularly relates to a real-time fluorescence PCR detection method for detecting goat-derived components in food and feed by using single-copy nuclear genes.
Background
Since the goat meat and sheep meat are difficult to distinguish, goats and sheep are usually not distinguished in the detection of a lot of foods and feeds, and only sheep components are detected, so that hidden dangers are brought to food safety invisibly, and some lawbreakers are enabled to carry out adulteration and profit-making to have a good opportunity. In the early 2013, a plurality of European countries such as Sweden, England and the like are involved in horse meat wind wave morning smells, and the concern of various countries on the adulteration problem of meat and meat products is caused.
In China, the problem of adulteration is always the focus of consumer complaints and the hot spot of social attention. The low-cost raw materials of pigs, ducks and the like are mixed into high-price meat and meat products of cattle, sheep and the like by illegal vendors and enterprises driven by interests. These behaviors not only harm the interests of consumers, but also may cause disputes due to the non-halal components contained in some religious foods, and if the non-halal components are not quarantined, the propagation of epidemic diseases may be caused, which is not beneficial to maintaining the social stability and the physical health of people, and if the problem products are exported abroad, the overall image of food enterprises in China is damaged. In order to attack the illegal behavior of meat adulteration, maintain the rights and interests of consumers and the life safety, ensure the healthy development of the food industry, it is very important to make strict laws and regulations to restrict the behaviors of producers and operators, and meanwhile, an accurate, sensitive and simple detection method needs to be made.
The common meat and meat product authenticity identification technology mainly comprises the following steps: (1) immunoassay techniques based on the molecular structure of proteins, and the like; the immunoassay method based on the protein macromolecular structure has the characteristics of high sensitivity, high flux and simple and convenient operation, and can realize the rapid detection of a large number of samples. For example, Macedo-Silva et al established an ELISA method for identifying inexpensive meat components that may be incorporated in hamburgers by preparing antiserum raised against bovine, chicken, porcine, and equine albumins with a sensitivity of up to 0.6%. However, immunoassay methods based on antigen-antibody specific binding are susceptible to cross-reactivity for closely related species. It is also an important disadvantage of this method that the tertiary structure of the protein may be destroyed during food processing, which affects antibody recognition. (2) Nucleic acid-based molecular biology techniques such as PCR, real-time fluorescence PCR, and molecular fingerprinting techniques; molecular biology techniques based on DNA sequence specificity are widely used to detect differences in genetic information between animal species as targets for meat identification. Compared with protein, DNA has high thermal stability, and small fragment DNA can be extracted for analysis such as PCR although the DNA is degraded to a certain degree in the processing process. Meanwhile, the DNA has the advantages of high specificity, high sensitivity, no limitation of tissue types and the like, and has higher resolution capability on species with relatively close relativity. In recent years, the research on methods for authenticating meat and meat products based on DNA detection technology has been increasing. Currently, the focus is mainly on various analysis methods based on PCR, including DNA sequencing, multiplex PCR, real-time fluorescence quantitative PCR, etc. Particularly, the real-time fluorescent quantitative PCR technology is gradually becoming the mainstream detection technology in the field of detection of animal-derived components.
The amplification of DNA fragments by Species-specific primers, the separation and observation of specific bands by agarose electrophoresis are the most fundamental method for identifying Species constituents in PCR technology, mitochondrial DNA has a large copy number in cells, high sensitivity, a fast evolution speed, high interspecies diversity and low intraspecies variation, and has been widely used in primer design and amplification of target sequences, for example, the commonly used mitochondrial genes have cytochrome b gene, 12S and 16S ribosomal RNA subunit, D-loop region, but, due to the high and non-constant copy number of mitochondrial DNA sequences, it is difficult to apply quantitative detection to qualitative detection of animal-derived constituents, and it is difficult to apply quantitative detection to quantitative detection of "specificity and quantification in animal and products using primer pair digital PCR (PCR) analysis, C.rei. red, I.E. Bruce, B. ü. this results in quantitative PCR (primer pair) and primer pair) show that the bias of the DNA fragments of interest, DNA sequence 1058, and DNA sequence 1058. the results of this strain are clearly observed in the research section 1058.
At present, primers and probes for detecting animal components at home and abroad are generally designed aiming at mitochondrial genes, and the copy number of the mitochondrial genes in cells is 5000-6000 copies or more. However, in actual research work, it was found that: when a set of primers and probes are designed by using multi-copy mitochondrial genes for detection, the Ct value can be as low as about 13, and the Ct value is still about 37 when the animal-derived component in the sample is 0.00000001%. At such low detection concentrations of the target detection substance, such Ct values appear, making it difficult for the detection personnel to determine whether the actual sample actually contains the target component or whether the sample is very slightly contaminated. Therefore, when the primer and the probe are designed by utilizing the mitochondrial gene for detection, false positive results are easy to appear or the detection result under low target content is difficult to judge. If a positive detection report is given according to the Ct value which is low, great trade disputes can be led out.
Therefore, a real-time fluorescent quantitative PCR detection method for goat-derived ingredients in food and feed, which has good specificity and high sensitivity and can avoid false positive results, is needed to be established.
Disclosure of Invention
The invention discovers that: detecting animal-derived components in a certain animal pure meat sample, detecting by using a primer and a probe designed by single-copy nuclear genes, wherein the Ct value is about 37 when the animal-derived components in the sample are 0.001 percent when the Ct value is 22-24. Therefore, the invention utilizes the single-copy nuclear gene to carry out species identification detection, and finds out that the single-copy gene detection can avoid the occurrence of false positive results or the occurrence of the situation that the results are difficult to judge, and utilizes the single-copy nuclear gene to carry out detection and can also carry out quantitative detection, so that the finding of the single-copy nuclear gene for detection and the establishment of a standard method are very necessary.
The invention aims to provide a real-time fluorescence PCR detection method for goat-derived ingredients in food and feed, so as to overcome the defects of difficult quantitative detection, easy occurrence of false positive results and the like in the prior art. The second purpose of the invention is to provide a detection kit and application of the detection kit. The third purpose of the invention is to provide a primer pair and a probe of the real-time fluorescence PCR detection method of goat-derived ingredients in food and feed.
In order to achieve the purpose, the invention adopts the following technical scheme:
as a first aspect of the present invention, a real-time fluorescence PCR detection method for detecting goat-derived components in food and feed using single-copy nuclear genes, the method comprising the steps of:
the first step, taking DNA of a sample to be detected as a template, and carrying out fluorescent quantitative PCR amplification to obtain a PCR amplification product;
secondly, detecting the fluorescence signal of the amplification product;
thirdly, judging whether the sample contains goat-derived components or not according to the Ct value of the detection result and quantitatively detecting the content of the goat-derived components in the sample;
the reaction system for PCR amplification contains a specific primer pair for amplifying goat-derived components and a specific probe for the goat-derived components, wherein the sequences of the specific primer pair for amplifying the goat-derived components are shown as SEQ ID NO.1 and SEQ ID NO.2, and the sequence of the specific probe for the goat-derived components is shown as SEQ ID NO. 3.
According to the invention, the conditions for the PCR amplification are as follows:
the reaction system is 25 μ L: real-time fluorescent PCR reagent (2X) 12.5. mu.L, primers each 10. mu.M, probe 5. mu.M, DNA template 5. mu.L;
and (3) PCR reaction conditions: 10min at 95 ℃; 15s at 95 ℃; 1min at 60 ℃; for a total of 45 cycles.
As a second aspect of the present invention, a detection kit for a goat-derived component, comprising the following reagents:
(a) amplifying a specific primer pair of goat-derived components;
(b) a specific probe for goat derived components;
wherein, the sequence of the specific primer pair for amplifying the goat derived component is shown as SEQ ID NO.1 and SEQ ID NO.2, and the sequence of the specific probe for amplifying the goat derived component is shown as SEQ ID NO. 3.
Further, the detection kit further comprises:
(c) and the standard reference substance is used for quantitatively detecting the content of the goat-derived component in the sample.
As a third aspect of the invention, the application of the detection kit is provided, and the detection kit is used for qualitatively or quantitatively detecting goat-derived ingredients in food or feed.
As a fourth aspect of the invention, a specific primer pair and a probe of goat derived components are provided, wherein the sequence of the specific primer pair is shown as SEQ ID NO.1 and SEQ ID NO.2, and the sequence of the specific probe is shown as SEQ ID NO. 3.
The invention has the beneficial effects that:
1. the primer pair and the probe which are derived from the nuclear gene and can specifically identify the goat-derived component are provided, the specificity is good, the specific amplification can be realized for the goat-derived component, and the specific amplification cannot be realized for other components except the goat; moreover, the primer pair and the probe have good reproducibility and stable and reliable results.
2. The primer pair and the probe can be used for rapidly detecting whether goat-derived components exist in food or feed in a large batch and quantitatively detecting the content of the goat-derived components in the food or feed, and the method has the advantages of small required sample amount, simple operation and high sensitivity.
3. The real-time fluorescence PCR detection method of the goat-derived component has wide application range, is particularly suitable for detecting the goat-derived component in various foods or feeds, can be popularized and applied, provides technical support for guaranteeing the quality of products, protecting the right of knowledge and selection of consumers, maintaining normal economic order and the like, and provides technical support for the food market supervision department and the inspection and quarantine department.
Drawings
FIG. 1 is a graph of real-time fluorescent PCR sensitivity assay amplification curves for the first set of primer pairs and probes of example 1. Wherein, the amplification curves are 40 ng/. mu.L, 20 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 0.1 ng/. mu.L and 0.01 ng/. mu.L goat DNA samples from left to right respectively.
FIG. 2 is a graph of real-time fluorescent PCR sensitivity assay amplification curves for the second set of primer pairs and probes of example 1. Wherein, the amplification curves are 40 ng/. mu.L, 20 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 0.1 ng/. mu.L and 0.01 ng/. mu.L goat DNA samples from left to right respectively.
FIG. 3 is a graph of the amplification curves for real-time fluorescent PCR primer-specific assays for the first set of primer pairs and probes of example 1. Wherein the amplification curve is a goat standard.
FIG. 4 is a quantitative standard curve of goat-derived components.
Detailed Description
The present invention will be further described with reference to the following examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, in which specific conditions are not specified, are generally performed according to conventional conditions, such as "molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) or the conditions provided by the manufacturer.
The experimental materials of the invention are as follows:
(1) DNA standards for goats (Capra hircus), sheep (Ovis aries), cattle (Bos taurus), donkeys (Equussasinus), horses (Equus caballus), chickens (Gallus gallicus), ducks (Anas platyrhynchos), geese (Anseranser), turkeys (Melegaris gallopavo), pigs (Sus scrofa), quail (Coturnix Coturnix), camels (Camels dromedarius), and domestic cats (Felis catus) are available from Zyagen laboratories, Inc. of America.
(2) The animal components such as goat meat, beef, bream meat, pomfret meat, yellow croaker meat, salmon meat and the like are commercially available products.
(3) Rat meat and mouse meat were purchased from Shanghai Sphall-BiKai laboratory animals Co.
(4) The plant components of rice, corn, soybean, millet, mung bean, sweet potato, white kidney bean, apple, celery and the like are commercially available products.
(5) The chicken ham sausage (imported), the pork ham sausage (imported), the beef ham sausage (imported), the goat meat sausage, the goat steak, the beef luncheon meat, the pork luncheon meat, the canned braised beef, the beef jerky, the dried pork slice, the beef ball, the curry beef paste, the mutton-flavored dog food, the chicken-flavored dog food (imported), the beef-flavored dog food (imported) and the canned swallow-and-Na cat (imported) used for practical verification are commercially available products.
(6) Australian pet-grade chicken bone meal is provided by Shanghai customs Port.
Example 1 design of primer pairs and probes
(1) Design of first set of primer pairs and probes
Based on the published DNA sequence (accession number: NC-022301) of chromosome 9 of a goat (Capra hircus bred Yunnan black goat) in NCBI, an appropriate sequence fragment was selected for primer probe design. The length of the target fragment aiming at the goat derived component is 87 bp. The sequences of the fluorescent PCR primer pairs and probes are as follows:
Goat-87bp-F：5’-GGAAGGAAAGAGAATGGGGATATGG-3’(SEQ ID NO：1)
Goat-87bp-R：5’-TCTCCACACACAGCCAAAACC-3’(SEQ ID NO：2)
Goat-87bp-P：FAM-ATCCATCTCTCCCTCCACTCCCTGCCTAA-TAMRA(SEQ ID NO：3)
wherein FAM represents a fluorescent reporter group and TAMRA represents a quencher group. The invention adopts a fluorescent probe method, and the detection principle is to utilize a fluorescent labeled specific probe to identify a template. Compared with SYBR dye method in the prior art, the fluorescence labeling specific probe has stronger specificity and lower background interference.
(2) Design of the second set of primer pairs and probes
Based on the published DNA sequence (accession number: NC-022301) of chromosome 9 of a goat (Capra hircus bred Yunnan black goat) in NCBI, a primer pair and a probe were designed by selecting appropriate fragments, wherein the primer pair and the probe are as follows:
Goat-105bp-F：5’-ATGAGTGTCTGTGTCTCTGTGTAAG-3’(SEQ ID NO：4)
Goat-105bp-R：5’-ACAAATTTCTTCACATGCACAATAAGC-3’(SEQ ID NO：5)
Goat-105bp-P:FAM-ACCCACAGCCCAGTCTCTACAAACACACA-TAMRA(SEQ ID NO：6)
Goat-105bp-P:FAM-ACCCACAGCCCAGTCTCTACAAACACACA-TAMRA(SEQ ID NO：6)
wherein FAM represents a fluorescent reporter group and TAMRA represents a quencher group. The invention adopts a fluorescent probe method, and the detection principle is to utilize a fluorescent labeled specific probe to identify a template. Compared with SYBR dye method in the prior art, the fluorescence labeling specific probe has stronger specificity and lower background interference.
(3) Reaction system and reaction program for real-time fluorescent PCR of first set of primer pairs and probes and second set of primer pairs and probes
The real-time fluorescent PCR reaction system is shown in Table 1:
wherein, the real-time fluorescent PCR reaction program is as follows: 10min at 95 ℃; 95 ℃ for 15s and 60 ℃ for 1 min; for a total of 45 cycles.
TABLE 1 real-time fluorescent PCR reaction System for goat-derived ingredients
EXAMPLE 2 preparation of test samples
Animal meat samples were shredded, oven dried, and ground to a powder using a freeze grinder (SPEX 6850). Plant samples and samples for practical validation were directly ground into powder using a freeze grinder (SPEX 6850).
EXAMPLE 3 extraction of DNA
Animal sample DNA is extracted by using an animal genome extraction kit (Tiangen Biochemical technology Co., Ltd.; catalog number: DP323), plant sample DNA is extracted by using a plant genome extraction kit (Tiangen Biochemical technology Co., Ltd.; catalog number: DP305), mixed sample and actual verification sample DNA are extracted by using an animal-derived plant feed genome extraction kit (Tiangen Biochemical technology Co., Ltd.; catalog number: DP323), and the extraction method is detailed in the kit operation instruction. The DNA solution was stored at-20 ℃ for further use.
Example 4 sensitive detection of primer pairs and probes for goat derived components
And performing real-time fluorescence PCR detection by using goat DNA contents of 40 ng/mu L, 20 ng/mu L, 10 ng/mu L, 1 ng/mu L, 0.1 ng/mu L, 0.01 ng/mu L, 0.001 ng/mu L and 0.0001 ng/mu L as sample DNA as templates, and repeating the test for 6 times.
As a result: (1) first set of primer pairs and probes: in 6 tests, amplification curves appeared in the goat sample DNA at 40 ng/. mu.L, 20 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 0.1 ng/. mu.L and 0.01 ng/. mu.L, while no amplification curves appeared in the goat sample DNA at 0.001 ng/. mu.L and 0.0001 ng/. mu.L, as shown in FIG. 1.
(2) Second set of primer pairs and probes: in 6 tests, amplification curves appeared in the goat sample DNA at 40 ng/. mu.L, 20 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 0.1 ng/. mu.L, and 0.01 ng/. mu.L, but the amplification curves were not proportional to the DNA concentration, as shown in FIG. 2.
And (4) conclusion: 1. when the usage amount of the template of the first group of primer pairs and probes is 0.01 ng/mu L, the obvious S-shaped amplification curve is obtained, the detection sensitivity reaches 0.01 ng/mu L, and the primer pairs and probes of the first group of goat-derived components have better accuracy; 2. the second set of primer pairs and probes are significantly different from the first set of primer pairs and probes. The effect of the second set of primer pairs and probes in sensitive detection is insignificant.
Because the effect of the primer pair and the probe of the second group of goat-derived components in the sensitivity detection is not obvious, the subsequent test only aims at the primer pair and the probe of the first group of goat-derived components.
Example 5 specific detection of primer pairs and probes for goat-derived Components
In this example, 32 kinds of DNA samples of animal and plant materials tested in example 3 were tested using the primer set and probe for goat-derived components in example 1, and fluorescence signals of the amplified products were detected. The results of the tests are summarized in table 2 and fig. 3.
TABLE 2 specificity test results of goat-derived ingredients
| Serial number | Sample name | Test results | Serial number | Sample name | Test results |
| 1 | Goat DNA | + | 17 | Beef | — |
| 2 | Sheep DNA | — | 18 | Bream fish meat | — |
| 3 | Donkey DNA | — | 19 | Pomfret fish meat | — |
| 4 | DNA of cattle | — | 20 | Yellow croaker meat | — |
| 5 | Equine DNA | — | 21 | Salmon meat | — |
| 6 | Chicken DNA | — | 22 | Rat meat | — |
| 7 | Duck DNA | — | 23 | Mouse meat | — |
| 8 | Goose DNA | — | 24 | Rice | — |
| 9 | Quail DNA | — | 25 | Corn (corn) | — |
| 10 | DNA of turkey | — | 26 | Soybean | — |
| 11 | Pig DNA | — | 27 | Millet | — |
| 12 | Camel DNA | — | 28 | Mung bean | — |
| 13 | DNA of domestic cat | — | 29 | Sweet potato | — |
| 14 | Dog DNA | — | 30 | Potato | — |
| 15 | Deer DNA | — | 31 | White kidney bean | — |
| 16 | Celery | — | 32 | Apple (Malus pumila) | — |
As can be seen from FIG. 3 and Table 2, the primer pair and the probe only amplify positive to the goat DNA meat sample, and have obvious S-shaped amplification curve, while amplify negative to other DNA samples of various species, and have no obvious S-shaped amplification curve.
And (4) conclusion: the detection method of the invention has good species specificity.
Example 6 practical verification of primer pairs and probes for goat-derived ingredients
By the detection method of example 5, 17 samples of meat-based food, animal feed, and the like collected in the market and import and export trade routes were detected. The results are shown in Table 3.
TABLE 317 detection results of goat-derived components of samples to be tested
As can be seen from table 3, goat derived ingredients were detected in 2 servings of meat food (goat sausage, goat steak); no goat derived component was detected in the remaining food and feed.
And (4) conclusion: the meat source of the extracted sample is consistent with the detection result, which shows that the method can accurately detect whether the goat-derived ingredients are contained in the food and the feed. Meanwhile, the method for detecting goat-derived components in food or feed can be used for detecting goat-derived components in large batch by adopting the detection method of the embodiment 4.
Example 7 establishment of quantitative Standard Curve
(1) Quantitative detection of goat-derived component primer pair and probe
The goat DNA extracted in example 3 was diluted to 100 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 0.1 ng/. mu.L, and 0.01 ng/. mu.L for five concentration gradients, and detection was performed using the primer set and probe of example 1 at 6 replicates per concentration to obtain Ct values. The negative control was water. As shown in table 4, where Ct values are the average of 6 replicates.
TABLE 4 Ct values for real-time fluorescent PCR quantitative determination assays
| Template dose (ng/ul) | Ct value |
| 100 | 22.736 |
| 10 | 26.471 |
| 1 | 30.206 |
| 0.1 | 34.099 |
| 0.01 | 37.492 |
| Negative control | - |
And (4) conclusion: it can be seen that the Ct value of the amplification is increased in a gradient manner and shows a certain linear relationship (R) along with the decrease of the concentration of the goat-derived component2＝0.999)。
(2) Processing and computing of data
The results are shown in FIG. 4, where the logarithm of the DNA concentration is plotted as the abscissa and the average of the Ct values of 6 replicates of the sample is plotted as the ordinate, and curve fitting is performed on the points to obtain a quantitative standard straight line, the linear equation is that y is 3.714x +19.05, and R is20.999. For the sample needing to be quantified, the respective Ct value of the sample to be measured is measured each time, and the corresponding x value is obtained by utilizing a standard curve formula. The content of goat-derived components of the sample to be detected can be obtained。
(3) Verification of quantitative standard curves
DNA was extracted by the method of example 3, 6 independent samples were diluted and quantified, respectively, at concentrations of 50 ng/. mu.L and 0.5 ng/. mu.L, and the Ct values were measured, and the goat-derived component content was calculated by a quantitative standard curve to verify the reproducibility of the method.
The results showed that the average of the values measured for the 50ng sample was 52.3ng and the average of the values measured for the 0.5ng sample was 0.44 ng.
And (4) conclusion: the method of the present example is demonstrated to have the ability to quantify accurately over a dynamic range. Therefore, the actually measured value of the method is consistent with the theoretical value, and the repeatability is good.
The invention establishes a real-time fluorescence PCR method for detecting goat-derived components in food and feed by using single-copy nuclear genes, designs a primer pair and a probe aiming at the nuclear genes of goat species, only needs to combine with a real-time fluorescence amplification curve chart, can accurately detect whether the goat-derived components exist in a sample within no more than two hours, and has the sensitivity of 0.01 ng/mu L.
In conclusion, the specific primer pair and the probe for real-time fluorescence PCR amplification of the goat-derived components designed by the invention have good specificity and high sensitivity, provide a good detection method for rapidly and accurately distinguishing whether the goat-derived components are contained, and have good application prospects in the detection of the field of food safety. Furthermore, the specific primer pair and the probe can be further prepared into a detection kit by a method known in the art, and the detection kit can further comprise a standard reference substance in addition to the specific primer pair and the probe, which is obvious to those skilled in the art.
The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are given by way of illustration of the principles of the present invention, and that various changes and modifications may be made without departing from the spirit and scope of the invention as defined by the appended claims. The scope of the invention is defined by the appended claims and equivalents thereof.
Sequence listing
<110> Shanghai entry and exit inspection and quarantine bureau animal and plant and food inspection and quarantine technology center
<120> real-time fluorescence PCR method for detecting goat-derived ingredients in food and feed by using single-copy nuclear gene
<130>171009
<160>6
<170>PatentIn version 3.3
<210>1
<211>25
<212>DNA
<213> Artificial sequence 1
<400>1
ggaaggaaag agaatgggga tatgg 25
<210>2
<211>21
<212>DNA
<213> Artificial sequence 2
<400>2
tctccacaca cagccaaaac c 21
<210>3
<211>29
<212>DNA
<213> Artificial sequence 3
<400>3
atccatctctccctccactc cctgcctaa 29
<210>4
<211>25
<212>DNA
<213> Artificial sequence 4
<400>4
atgagtgtct gtgtctctgt gtaag 25
<210>5
<211>27
<212>DNA
<213> Artificial sequence 5
<400>5
acaaatttct tcacatgcac aataagc 27
<210>6
<211>29
<212>DNA
<213> Artificial sequence 6
<400>6
acccacagcc cagtctctac aaacacaca 29
Claims (6)
1. A real-time fluorescence PCR detection method for detecting goat-derived components in food and feed by using single-copy nuclear genes is characterized by comprising the following steps:
the first step, taking DNA of a sample to be detected as a template, and carrying out fluorescent quantitative PCR amplification to obtain a PCR amplification product;
secondly, detecting the fluorescence signal of the amplification product;
thirdly, judging whether the sample contains goat-derived components or not according to the Ct value of the detection result and quantitatively detecting the content of the goat-derived components in the sample;
the reaction system for PCR amplification contains a specific primer pair for amplifying goat-derived components and a specific probe for detecting the goat-derived components, wherein the sequences of the specific primer pair for amplifying the goat-derived components are shown as SEQ ID NO.1 and SEQ ID NO.2, and the sequence of the specific probe for detecting the goat-derived components is shown as SEQ ID NO. 3.
2. The real-time fluorescent PCR assay of claim 1 wherein the PCR amplification conditions are as follows:
the reaction system is 25 μ L: 2 x 12.5 muL of real-time fluorescent PCR reagent, 10 muM of each primer, 5 muM of probe and 5 muL of DNA template;
and (3) PCR reaction conditions: 10min at 95 ℃; 95 ℃ for 15s and 60 ℃ for 1 min; for a total of 45 cycles.
3. A detection kit for goat-derived components is characterized by comprising the following reagents:
(a) amplifying a specific primer pair of goat-derived components;
(b) a specific probe for detecting goat-derived components;
wherein, the sequence of the specific primer pair for amplifying the goat-derived component is shown as SEQ ID NO.1 and SEQ ID NO.2, and the sequence of the specific probe for detecting the goat-derived component is shown as SEQ ID NO. 3.
4. The test kit of claim 3, further comprising:
(c) a standard reference.
5. Use of the test kit according to claim 3 or 4 for qualitative or quantitative detection of goat derived components in food or feed.
6. A specific primer pair and a probe for detecting goat-derived components are characterized in that the sequences of the specific primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2, and the sequence of the specific probe is shown as SEQ ID NO. 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710335321.0A CN107012247B (en) | 2017-05-12 | 2017-05-12 | Real-time fluorescence PCR detection method for detecting goat-derived ingredients in food and feed by using single-copy nuclear gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710335321.0A CN107012247B (en) | 2017-05-12 | 2017-05-12 | Real-time fluorescence PCR detection method for detecting goat-derived ingredients in food and feed by using single-copy nuclear gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107012247A CN107012247A (en) | 2017-08-04 |
| CN107012247B true CN107012247B (en) | 2020-01-10 |
Family
ID=59449634
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710335321.0A Active CN107012247B (en) | 2017-05-12 | 2017-05-12 | Real-time fluorescence PCR detection method for detecting goat-derived ingredients in food and feed by using single-copy nuclear gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107012247B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825602B (en) * | 2019-03-26 | 2021-09-21 | 上海海关动植物与食品检验检疫技术中心 | Real-time fluorescent PCR detection method for equine derived components in food and feed |
| CN109825608B (en) * | 2019-04-11 | 2021-04-23 | 中国农业大学 | Kit for rapidly identifying goat-derived ingredients in food and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104673900A (en) * | 2015-02-05 | 2015-06-03 | 中国肉类食品综合研究中心 | Method for identifying animal-derived ingredients in meat or meat product |
| CN105296647A (en) * | 2015-11-20 | 2016-02-03 | 华中农业大学 | Detection kit for sheep origin component identification and detection of multi-species origin components in products |
-
2017
- 2017-05-12 CN CN201710335321.0A patent/CN107012247B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104673900A (en) * | 2015-02-05 | 2015-06-03 | 中国肉类食品综合研究中心 | Method for identifying animal-derived ingredients in meat or meat product |
| CN105296647A (en) * | 2015-11-20 | 2016-02-03 | 华中农业大学 | Detection kit for sheep origin component identification and detection of multi-species origin components in products |
Non-Patent Citations (3)
| Title |
|---|
| Multiplex real-time PCR for the detection and quantification of DNA from beef, pork, horse and sheep;Rene Koppel et al.;《Eur Food Res Technol》;20101015;第232卷;151-155 * |
| PCR identification of beef，sheep，goat，and pork in raw and heat-treated meat mixtures;Miguel A.Rodriguez et al.;《Journal of Food Protection》;20040131;第67卷(第1期);172-177 * |
| 多重实时荧光PCR检测牛、山羊和绵羊源性成分;曾少灵等;《生物工程学报》;20090125;第25卷(第1期);139-146 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107012247A (en) | 2017-08-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108330168B (en) | Primer combination for synchronously detecting 14 animal-derived components in meat or meat product and application thereof | |
| Wang et al. | Multiplex PCR assay for identification and quantification of bovine and equine in minced meats using novel specific nuclear DNA sequences | |
| Dalsecco et al. | A fast and reliable real‐time PCR method for detection of ten animal species in meat products | |
| CN113073140B (en) | PCR detection primer group and method for simultaneously identifying 7 meat-derived foods | |
| CN111334585B (en) | Primer and kit for simultaneously detecting 8 animal components, detection method and application | |
| Wu et al. | Species identification of fox-, mink-, dog-, and rabbit-derived ingredients by multiplex PCR and real-time PCR assay | |
| Liu et al. | A multiplex PCR assay mediated by universal primers for the detection of adulterated meat in mutton | |
| Fontanesi | Meat authenticity and traceability | |
| CN106521016B (en) | The real-time fluorescence PCR detection method of calf-derived Cyclospora in food and feed is detected using single-copy nuclear gene | |
| CN107012247B (en) | Real-time fluorescence PCR detection method for detecting goat-derived ingredients in food and feed by using single-copy nuclear gene | |
| CN102776289A (en) | Reagent kit for distinguishing four components including pork, beef, mutton and chicken in food at same time and application thereof | |
| CN106995852B (en) | Real-time fluorescence PCR detection method for detecting sheep-derived components in food and feed by using single-copy nuclear gene | |
| CN109852705B (en) | Method and kit for rapidly detecting horse-derived components in food | |
| CN114686600B (en) | Primer group and method for meat detection based on seven-fold PCR technology | |
| CN114752690A (en) | Method for rapidly identifying duck-origin components in meat products based on MIRA technology | |
| CN114561476A (en) | Primer group and method for multiplex PCR detection for simultaneously identifying 12 meat-derived foods | |
| CN114836523B (en) | Real-time fluorescence PCR detection method for detecting turkey-derived components in foods and feeds by utilizing single copy nuclear genes | |
| CN109825613B (en) | Method and kit for rapidly detecting duck-origin components in food | |
| Mei et al. | Establishment and application of a 10‐plex liquid bead array for the simultaneous rapid detection of animal species | |
| CN109609662B (en) | Nucleic acid of multiple liquid phase gene chip for synchronously detecting and identifying three major components of poultry, fish and ruminants, method and kit | |
| CN104894263A (en) | Multiple-species-component real-time fluorescence PCR (polymerase chain reaction) combined detection method | |
| Porzahmat Shirvan et al. | TaqMan real-time PCR: a reliable method to detect meat species | |
| CN113444806B (en) | Kit for detecting wolf-derived components and application thereof | |
| CN116411086B (en) | Murine component RPA nucleic acid isothermal amplification primer probe group, kit, detection method and application thereof | |
| CN109825611B (en) | Method and kit for rapidly detecting goose-derived components in food |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |