CN102747088B - Cloning, identification and use of cotton fiber development-related GhLIM5 gene - Google Patents
Cloning, identification and use of cotton fiber development-related GhLIM5 gene Download PDFInfo
- Publication number
- CN102747088B CN102747088B CN201210214442.7A CN201210214442A CN102747088B CN 102747088 B CN102747088 B CN 102747088B CN 201210214442 A CN201210214442 A CN 201210214442A CN 102747088 B CN102747088 B CN 102747088B
- Authority
- CN
- China
- Prior art keywords
- ghlim5
- gene
- actin
- protein
- cotton fiber
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses cloning, identification and use of a cotton fiber development-related GhLIM5 gene. The invention discloses a full-length sequence of the cotton fiber development-related GhLIM5 gene. The cotton fiber development-related GhLIM5 gene codes a protein comprising a LIM structural domain. A large amount of mRNAs of the cotton fiber development-related GhLIM5 gene are accumulated in a cotton fiber cell fast-elongation phase. A subcellular localization analysis shows that a GhLIM5 protein binds with an F-actin of a cotton cell. In-vitro high-speed and low-speed co-precipitation experiments show that the GhLIM5 protein and the F-actin are co-precipitated because the GhLIM5 protein can directly interact with the F-actin; and co-precipitation effects gradually become obvious with increasing of a GhLIM5 protein concentration. Therefore, after binding of the GhLIM5 protein and the F-actin, a fasciculation reaction of the F-actin is promoted and the GhLIM5 protein can produce important effects in cotton fiber development. The cotton fiber development-related GhLIM5 gene can be used for a research of cotton fiber quality-improvement molecular breeding.
Description
Technical field
The present invention relates to cotton gene.The specifically LIM family gene of a cotton fibre rapid elongation phase predominant expression
ghLIM5clone and Function Identification.
Background technology
China is maximum in the world Cotton Production state and country of consumption, also be maximum textiles, garment production state and export State, therefore, the yield and quality of its cotton fibre is not only directly connected to the income of vast farmers and a large amount of textile workers' employment and income, is also related to lasting, the healthy development of China's textile industry and foreign trade.China is one of five great Chan Mian states of the world, no matter lint yield or single rate are all in world's umber one.But, growing along with textile industry, more and more higher to the requirement of raw material.New textile technology needs the cotton fibre that fiber is longer, intensity is higher and more neat.And the length type of the current domestic raw cotton of China is single, its length and intensity all cannot reach the requirement of weaving spun yarn, highly dependence on import; And the raw cotton of requirement to the coarse yarn that is applicable to weave, due to output and price low, cotton grower is reluctant plantation more.Therefore, China needs more than 100 ten thousand tons of import high-quality gined cottons every year, causes domestic raw cotton to overstock.Fibrous quality problem has become one of major obstacle of restriction Cotton in China industry Sustainable development as can be seen here.
The yield and quality that how to improve cotton fiber is the ultimate aim of cotton genetic improvement all the time, and conventional breeding means, be difficult to accomplish that quality and yield improves simultaneously simultaneously, therefore progressively use genetic engineering by good economical character, the good character that particularly fibrous quality is relevant with output is introduced cotton main breed, not only can improve output of cotton and fibrous quality, reduce production costs, and can alleviate the disadvantageous effect to environment.The identification that the carrying out of this work depends on cotton fiber development genes involved with separate.By the key function gene of clone's cotton fiber development, the expression regulation of analyzing gene and the biological function of expression product, illustrate the molecular mechanism of Fibre Development, for the cotton variety of cultivating good quality and high output provides theoretical foundation and gene element.
LIM domain protein family is the class protein being extensively present in various biologies, and its name derives from three LIM domain protein white matters that are cloned into the earliest: LIN11, the initial of ISL1 and MEC3.In these albumen, conventionally contain one or more LIM structural domains, each LIM structural domain has [C-X
2-C-X
16 – 23-H-X
2-C]-X
2-[C-X
2-C-X
16 – 21c-X
2 – 3-(C/D/H)] conserved structure.In this structural domain, have two zinc fingerses, between be very short amino acid residue sequence.The LIM domain protein that animal gene group coding is a large amount of, they have very large difference on structure and function.By contrast, only find a small amount of LIM domain protein in plant, they belong to halfcystine is rich in the protein subfamily of class.In research before, some plants and vertebrate LIM domain protein are proved the ability having in conjunction with Actin muscle.Plant LIM domain protein all belongs to the protein group that a class is relatively little, and they are made up of two LIM structural domains and a longer LIM interval region (an about 40-50 amino-acid residue) conventionally.Previous research shows that tobacco WLIM1 has stable and the filametntary function of bunchy Actin muscle in BY-2 cell.After using relevant chemicals to process, the WLIM1 of Green Fluorescent Protein is proved and is gathered on tobacco BY-2 cells matter skeleton.High speed and low speed co-precipitation experiment show that WLIM1 can be attached on Actin filaments and make its bunchy.Therefore someone infers that plant LIM domain protein makes the model of microfilament bunchy.
According to the difference of expression tissue, plant LIM domain protein was once divided into two classes: specific expressed pLIM and have the wLIM that the popularity organized is expressed in pollen.But this sorting technique along with research to go deep into its limitation day by day obvious.At present, new sorting technique is, according to the analysis of information biology, the protein of this family is divided into four large class α LIM1, β LIM1, γ LIM2 and δ LIM2.Although the LIM domain protein of plant high conservative in its structure, their function in development of plants process is variant.The people such as Kawaoka point out that tobacco Ntlim1 is an important transcription factor, participate in regulating the expression of phenylpropyl alcohol alkyl compound synthesis related gene to bring into play biological function.Gel retardation assasy also confirms that this protein can be attached to the conservative region of related gene promoter (CCAC (A/C) AN (A/C) N (C/T) (A/C)).When after Ntlim1 silence, the expression level of the phenylpropyl alcohol alkane passageway related genes of several keys is lowered.The people's such as Wang research finds, a LIM domain protein-Lilim1 in lily belongs to actin binding protein family, can make actin filament bunchy, the depolymerization of modulate actin microfilament dynamically and in protection flower of Greenish Lily cell.Recently, a research group also confirms that 6 LIM domain proteins of Arabidopis thaliana belong to two different plant LIM protein families, and they are vital for the bunchy of actin filament and the depolymerization of actin cytoskeleton.And the research of Zhe Liangge group all shows that lily Lilim1 and Arabidopis thaliana AtPLIM2C are all subject to the adjusting of pH value and low calcium ion concn.In the time of low pH value and low concentration of calcium ionic concn they more easily with microfilament interaction.
Summary of the invention
The object of the present invention is to provide new cotton fibre rapid elongation phase advantage specifically expressing
lIMgene (
ghLIM5), analyze and disclose this gene function, explore its molecular mechanism to Fibre Development regulation and control, and then apply this improvement of genes cotton fibre quality, create cotton improved seeds.
In this research, applicant isolates the GhLIM5 protein gene of 1 cotton fiber predominant expression from cotton fiber cDNA library, utilizes quantitative RT-PCR technology, verifies the express spectra of this gene, shows that this gene is fiber predominant expressed gene.
ghLIM5the open reading frame that cDNA comprises 570 bp, the 189 amino acid whose albumen of encoding, its molecular weight is 20.73KD, iso-electric point (pI) is 8.84.
GhLIM5 albumen contains two conservative LIM structural domains, has higher homology with Arabidopis thaliana LIM albumen.6 LIM domain proteins having there are some researches show Arabidopis thaliana are vital for the bunchy of actin filament and the depolymerization of actin cytoskeleton, are implying that GhLIM5 also may participate in the adjusting of actin filament dynamic change in cotton fiber development process.Utilize quantitative RT-PCR technology to analyze at the express spectra of cotton different tissues and cotton fibre different developmental phases this gene, result shows
ghLIM5gene is expressed in cotton fibre rapid elongation phase a large amount, and a little less than expressing in other tissue of cotton.Subcellular Localization demonstration, this albumen presents the network-like structure being combined by filament in whole cell, illustrates that GhLIM5 is positioned on the actin cytoskeleton of cotton cells (F-actin).For understand this albumen be directly or indirectly and F-actin contact, applicant obtains soluble g hLIM5 albumen by prokaryotic expression system, carry out in vitro high speed co-precipitation experiment, with verify GhLIM5 albumen can with F-actin (F-actin) direct interaction.Result show this protein can with F-actin generation co-precipitation, illustrate that GhLIM5 can interact with F-actin.Subsequently, whether can impel F-actin bunchy for further understanding this albumen, applicant has adopted the experimental technique of external low speed co-precipitation to analyze it.Result show GhLIM5 can with F-actin generation co-precipitation, and along with the increase of GhLIM5 concentration, the effect of co-precipitation is obvious gradually.These presentation of results GhLIM5 can impel the reaction of F-actin generation bunchy after being combined with F-actin.
advantage of the present invention:
1. provide a new cotton fibre relevant
ghLIM5gene (cDNA) sequence.This gene, at cotton fibre rapid elongation phase predominant expression, shows that this gene plays an important role in cotton fiber development process.
2. GhLIM5 is positioned on the Actin filaments of vegetable cell, shows that this albumen participates in the adjusting of cotton fibre Actin muscle dynamic change.
External high speed co-precipitation experimental analysis show GhLIM5 can with F-actin generation coprecipitation reaction, illustrate that this albumen directly can interact with F-actin.
The experimental analysis of external low speed co-precipitation show GhLIM5 can with F-actin generation co-precipitation, and along with the increase of GhLIM5 concentration, the effect of co-precipitation is obvious gradually.This means the bunchy reaction of F-actin in GhLIM5 possibility direct regulation and control cotton fiber development process.
The present invention is further elaborated by the following drawings and enforcement, but does not limit the scope of the invention.
Brief description of the drawings
Fig. 1
fluorescence quantitative RT-RCR is analyzed
ghLIM5in the expression of the each tissue of cotton
In figure: 1-root; 2-hypocotyl; 3-cotyledon; 4-blade; 5-petal; 6-flower pesticide; 7-ovule; 8-fiber.
fig. 2. fluorescence quantitative RT-RCR analysis
ghLIM5in the expression of cotton fiber different developmental phases
In figure: the 1-latter 3 days fibers of blooming; The 2-latter 6 days fibers of blooming; The 3-latter 9 days fibers of blooming; The 4-latter 15 days fibers of blooming; The 5-latter 18 days fibers of blooming; The 6-latter 20 days fibers of blooming.
fig. 3. the Subcellular Localization of GhLIM5 in cotton cells
In figure: green fluorescence shows that GhLIM5 is positioned on actin cytoskeleton, A figure: dark field; B figure: bright field; C figure: A figure and B figure amalgamation.
fig. 4. GhLIM5 and the co-precipitation of F-actin high speed are analyzed.
In figure: 1-reacts with bovine serum albumin separately; 2-reacts with F-actin with bovine serum albumin; 3-reacts with GhLIM5 albumen separately; 4-reacts with F-actin with GhLIM5 albumen; Supernatant liquor after supernatant-fingering row high speed centrifugation directly carries out electrophoresis; Precipitate-refer to after precipitation after centrifugal is dissolved in deionized water and carry out electrophoresis; The arrow on the picture left side is indicated different protein ingredients present position.
fig. 5. GhLIM5 and the co-precipitation of F-actin low speed are analyzed
In figure :+representative adds corresponding composition ， – representative not add corresponding composition; Supernatant: the supernatant liquor after fingering row low-speed centrifugal directly carries out electrophoresis; Precipitation: refer to carry out electrophoresis after precipitation after centrifugal is dissolved in deionized water; Arrow is indicated different protein ingredients present position.
Embodiment
A new gene of cotton LIM family
ghLIM5clone identification and functional analysis:
1.
ghLIM5the isolation identification of cDNA sequence
From cotton fibre cDNA library, separate more than 10,000 cotton cDNA clone, carried out DNA sequencing.By bioinformatic analysis, obtain 5
ghLIMthe full length cDNA sequence of gene, one of them called after
ghLIM5.
quantitative RT-PCR is analyzed
ghLIM5the expression of gene
(1) total RNA of cotton tissue extracts and (presses Li XB, Cai L, Cheng NH, Liu JW, 2002. Molecular characterization of the cotton
ghTUB1gene that preferentially expressed in fiber. Plant Physiol. 130:666-674 carries out).
(2) expression of real-time fluorescence quantitative RT-PCR research gene (according to Li XB, Fan XP, Wang XL, Cai L, Yang WC, 2005. The Cotton
aCTIN1gene is functionally expressed in fibers and participates in fiber elongation. Plant Cell 17:859 – 875 carries out).First, by total RNA (2 μ g/ sample) M-MLV RNase H of cotton different tissues (root, hypocotyl, cotyledon, leaf, petal, flower pesticide, bloom after 0 and 10 day ovule, bloom latter 3 days fibers, 6 days fibers, 9 days fibers, 12 days fibers, 15 days fibers, 18 days fibers, 20 days fibers etc.)
-reverse Transcriptase (Promega) reverse transcription becomes cDNA; Then, taking cDNA as template, the primer of use gene specific (
ghLIM5rTP1 and
ghLIM5rTP2) and Real-time PCR Master Mix (TOYOBO, Japan) carry out quantitative PCR reaction.Cotton
ghUBI1gene is as the interior mark of RT-PCR reaction, and the amplification of each circulation of target gene is by SYBR-Green fluoroscopic examination.The expression level relative value of each gene is pressed formula Y=10
△ct/3.57
× 100% calculates (wherein △ Ct=CtGhUBI1-CtGhLIM5, the 3.57th, utilization
ghUBI1the inverse of slope in the typical curve y=– 0.28x+9.87 of preparation, represents that genetic expression differs the PCR cycle number of 10 times).Repeat statistical study experimental result 3 times.
the Subcellular Localization of albumen
Will
ghLIM5after terminator codon is gone in coding region, (primer is with eGFP fusion
ghLIM5gUp and
ghLIM5gDn), build pBI121-GhLIM5:eGFP plant expression vector, this carrier is proceeded in GV3101 Agrobacterium by electrotransformation, then contaminate converting cotton by hypocotyl, screen positive callus, be placed in and under Laser Scanning Confocal Microscope, observe GFP fluorescence.
the transactional analysis in vitro of albumen and F-actin
(primer is to build prokaryotic expression carrier pET-28a-GhLIM5 carrier
ghLIM5eUp and
ghLIM5eDn), be transformed in e. coli bl21, purify this albumen with IPTG induction GhLIM5 protein expression and with the non-sex change of nickel post.Then, the GhLIM5 albumen of purifying and F-actin are reacted after for some time in vitro, after high speed centrifugation, supernatant liquor and precipitation are separated.Use SDS-PAGE gel electrophoresis to detect the protein in supernatant liquor and precipitation.
low speed co-precipitation and visualized experiment prove that GhLIM5 albumen promotes the polymerization of Actin.
After the GhLIM5 of different concns is reacted to for some time with F-actin, after low-speed centrifugal, supernatant liquor and precipitation are separated.Use SDS-PAGE gel electrophoresis to detect the protein in supernatant liquor and precipitation.
This project the primer sees the following form:
table 1 gene-specific primer
| Primer | Sequence (5' to 3') |
| GhLIM5 RTP1 | AGGAGACGGGTAACTTCAACAA |
| GhLIM5 RTP2 | CTCCCGAGCATAAATCCAAAA |
| GhUBIRTP1 | CTGAATCTTCGCTTTCACGTTATC |
| GhUBI RTP2 | GGGATGCAAATCTTCGTGAAAAC |
| GhLIM5 GUp | GGGGGATCCATGTCATTTATTGGTACCCA |
| GhLIM5 GDn | GGGTCTAGAAGCTTCAGGAACGGATGCAG |
| GhLIM5 EUp | GGGGGATCCATGTCATTTATTGGTACCCA |
| GhLIM5 EDn | GGGTCTAGATCAAGCTTCAGGAACGGATG |
1. cotton
ghLIM5the cDNA sequence of gene is as follows:
ACTCCTTTTT?ATACTCTCAT?TTTACGTTTA?TTTCTTCTTT?CTTTCATAGA?TCCAGGCCTT?60
CTTCTTCTTC?TTCTTCTTCT?TCTTCTTCTT?CTATCAAAGT?TAATATAGGC?AAATATAAGA?120
GAAGAAATCG?AATTAAAGTT?GATCCGTGAA?ACTAGATAAA?GAACAGTACG?ATTTGTTTTG?180
ACCAAAGCAC?ATTCGAGCC
A?TGTCATTTAT?TGGTACCCAA?CAGAAATGCA?AGGCTTGTGA?240
GAAGACTGTT?TATCCAGTTG?AACTTTTGTC?TGCAGATGGA?GTTCCTTACC?ATAAATCTTG?300
CTTCAAGTGC?AGTCATTGCA?AAGGGACACT?AAAGTTGGCT?AATTACTCCT?CAATGGAAGG?360
TGTTCTTTAC?TGCAAGCCTC?ATTTCGAGCA?ACTCTTCAAG?GAGACGGGTA?ACTTCAACAA?420
GAATTTCCAA?TCGTCTGCAA?AGGCAGCTGA?GAAGTTAACT?CCCGAGATGA?CGAGATCACC?480
AAGCAAAGCT?GCCAGCATGT?TTTCCGGGAC?AGTCGAAAAA?TGTGCTACTT?GTGGCAAAAC?540
TGCATATCCA?CTTGAGAAGG?TAACTGTAGA?AGGACAGTCT?TACCACAAAT?CATGTTTCAA?600
GTGCTCTCAT?GGTGGCTGCT?CTTTGAGTCC?ATCAAATTAT?GCAGCACTTG?AAGGCATTTT?660
GTACTGCAAA?CATCACTTTT?CCCAGCTCTT?CAAGGAGAAA?GGAAGCTACA?ATCATCTTAT?720
CAAATCCGCA?TCAATCAAGC?GTGCCGCTGC?ATCCGTTCCT?GAAGCT
TGAA?TACCTATTTC?780
ATGTTTTTTG?TTTATTCCCA?TGTTTGCCGG?TGTGTTTTTT?TATTGATTTT?TTGGATTTAT?840
GCTCGGGAGG?GGAACTGGAA?AGAAAGAACT?TGGGTTTCTT?TCCGTTTTTT?TGAGGCCTTG?900
GTATTTGATT?GATTTAAGTA?GAAGTGAATG?TTGTAACAGG?ACTCTGTGCA?AGATTTTTTA?960
TGCAATCCAA?ATTTGGCTCA?TTTCGAATGA?ATATTTTTAT?AAATAATAAA?AATGTTAGAT?1020
ACACTACTTG?GCAAT 1035
Gene coding region (ORF) is from initiator codon
aTGto terminator codon
tGA(200 – 769bp).
cotton
ghLIM5the protein sequence of genes encoding is as follows:
Met?Ser?Phe?Ile?Gly?Thr?Gln?Gln?Lys?Cys?Lys?Ala?Cys?Glu?Lys?Thr?Val?Tyr?Pro?Val?Glu
5 10 15 20
Leu?Leu?Ser?Ala?Asp?Gly?Val?Pro?Tyr?His?Lys?Ser?Cys?Phe?Lys?Cys?Ser?His?Cys?Lys?Gly
25 30 35 40
Thr?Leu?Lys?Leu?Ala?Asn?Tyr?Ser?Ser?Met?Glu?Gly?Val?Leu?Tyr?Cys?Lys?Pro?His?Phe?Glu
45 50 55 60
Gln?Leu?Phe?Lys?Glu?Thr?Gly?Asn?Phe?Asn?Lys?Asn?Phe?Gln?Ser?Ser?Ala?Lys?Ala?Ala?Glu
65 70 75 80
Lys?Leu?Thr?Pro?Glu?Met?Thr?Arg?Ser?Pro?Ser?Lys?Ala?Ala?Ser?Met?Phe?Ser?Gly?Thr?Val
85 90 95 100 105
Glu?Lys?Cys?Ala?Thr?Cys?Gly?Lys?Thr?Ala?Tyr?Pro?Leu?Glu?Lys?Val?Thr?Val?Glu?Gly?Gln
110 115 120 125
Ser?Tyr?His?Lys?Ser?Cys?Phe?Lys?Cys?Ser?His?Gly?Gly?Cys?Ser?Leu?Ser?Pro?Ser?Asn?Tyr
130 135 140 145
Ala?Ala?Leu?Glu?Gly?Ile?Leu?Tyr?Cys?Lys?His?His?Phe?Ser?Gln?Leu?Phe?Lys?Glu?Lys?Gly
150 155 160 165
Ser?Tyr?Asn?His?Leu?Ile?Lys?Ser?Ala?Ser?Ile?Lys?Arg?Ala?Ala?Ala?Ser?Val?Pro?Glu?Ala
170 175 180 185 189。
1. cotton
ghLIM5the cDNA sequence of gene is as follows:
ACTCCTTTTT?ATACTCTCAT?TTTACGTTTA?TTTCTTCTTT?CTTTCATAGA?TCCAGGCCTT?60
CTTCTTCTTC?TTCTTCTTCT?TCTTCTTCTT?CTATCAAAGT?TAATATAGGC?AAATATAAGA?120
GAAGAAATCG?AATTAAAGTT?GATCCGTGAA?ACTAGATAAA?GAACAGTACG?ATTTGTTTTG?180
ACCAAAGCAC?ATTCGAGCC
A?TGTCATTTAT?TGGTACCCAA?CAGAAATGCA?AGGCTTGTGA?240
GAAGACTGTT?TATCCAGTTG?AACTTTTGTC?TGCAGATGGA?GTTCCTTACC?ATAAATCTTG?300
CTTCAAGTGC?AGTCATTGCA?AAGGGACACT?AAAGTTGGCT?AATTACTCCT?CAATGGAAGG?360
TGTTCTTTAC?TGCAAGCCTC?ATTTCGAGCA?ACTCTTCAAG?GAGACGGGTA?ACTTCAACAA?420
GAATTTCCAA?TCGTCTGCAA?AGGCAGCTGA?GAAGTTAACT?CCCGAGATGA?CGAGATCACC?480
AAGCAAAGCT?GCCAGCATGT?TTTCCGGGAC?AGTCGAAAAA?TGTGCTACTT?GTGGCAAAAC?540
TGCATATCCA?CTTGAGAAGG?TAACTGTAGA?AGGACAGTCT?TACCACAAAT?CATGTTTCAA?600
GTGCTCTCAT?GGTGGCTGCT?CTTTGAGTCC?ATCAAATTAT?GCAGCACTTG?AAGGCATTTT?660
GTACTGCAAA?CATCACTTTT?CCCAGCTCTT?CAAGGAGAAA?GGAAGCTACA?ATCATCTTAT?720
CAAATCCGCA?TCAATCAAGC?GTGCCGCTGC?ATCCGTTCCT?GAAGCT
TGAA?TACCTATTTC?780
ATGTTTTTTG?TTTATTCCCA?TGTTTGCCGG?TGTGTTTTTT?TATTGATTTT?TTGGATTTAT?840
GCTCGGGAGG?GGAACTGGAA?AGAAAGAACT?TGGGTTTCTT?TCCGTTTTTT?TGAGGCCTTG?900
GTATTTGATT?GATTTAAGTA?GAAGTGAATG?TTGTAACAGG?ACTCTGTGCA?AGATTTTTTA?960
TGCAATCCAA?ATTTGGCTCA?TTTCGAATGA?ATATTTTTAT?AAATAATAAA?AATGTTAGAT?1020
ACACTACTTG?GCAAT 1035
Gene coding region (ORF) is from initiator codon
aTGto terminator codon
tGA(200 – 769bp).
2. cotton
ghLIM5the protein sequence of genes encoding is as follows:
Met?Ser?Phe?Ile?Gly?Thr?Gln?Gln?Lys?Cys?Lys?Ala?Cys?Glu?Lys?Thr?Val?Tyr?Pro?Val?Glu
5 10 15 20
Leu?Leu?Ser?Ala?Asp?Gly?Val?Pro?Tyr?His?Lys?Ser?Cys?Phe?Lys?Cys?Ser?His?Cys?Lys?Gly
25 30 35 40
Thr?Leu?Lys?Leu?Ala?Asn?Tyr?Ser?Ser?Met?Glu?Gly?Val?Leu?Tyr?Cys?Lys?Pro?His?Phe?Glu
45 50 55 60
Gln?Leu?Phe?Lys?Glu?Thr?Gly?Asn?Phe?Asn?Lys?Asn?Phe?Gln?Ser?Ser?Ala?Lys?Ala?Ala?Glu
65 70 75 80
Lys?Leu?Thr?Pro?Glu?Met?Thr?Arg?Ser?Pro?Ser?Lys?Ala?Ala?Ser?Met?Phe?Ser?Gly?Thr?Val
85 90 95 100 105
Glu?Lys?Cys?Ala?Thr?Cys?Gly?Lys?Thr?Ala?Tyr?Pro?Leu?Glu?Lys?Val?Thr?Val?Glu?Gly?Gln
110 115 120 125
Ser?Tyr?His?Lys?Ser?Cys?Phe?Lys?Cys?Ser?His?Gly?Gly?Cys?Ser?Leu?Ser?Pro?Ser?Asn?Tyr
130 135 140 145
Ala?Ala?Leu?Glu?Gly?Ile?Leu?Tyr?Cys?Lys?His?His?Phe?Ser?Gln?Leu?Phe?Lys?Glu?Lys?Gly
150 155 160 165
Ser?Tyr?Asn?His?Leu?Ile?Lys?Ser?Ala?Ser?Ile?Lys?Arg?Ala?Ala?Ala?Ser?Val?Pro?Glu?Ala
170 175 180 185 189。
1. the cDNA sequence of cotton GhLIM5 gene is as follows:
ACTCCTTTTT?ATACTCTCAT?TTTACGTTTA?TTTCTTCTTT?CTTTCATAGA?TCCAGGCCTT?60
CTTCTTCTTC?TTCTTCTTCT?TCTTCTTCTT?CTATCAAAGT?TAATATAGGC?AAATATAAGA?120
GAAGAAATCG?AATTAAAGTT?GATCCGTGAA?ACTAGATAAA?GAACAGTACG?ATTTGTTTTG?180
ACCAAAGCAC?ATTCGAGCCA?TGTCATTTAT?TGGTACCCAA?CAGAAATGCA?AGGCTTGTGA?240
GAAGACTGTT?TATCCAGTTG?AACTTTTGTC?TGCAGATGGA?GTTCCTTACC?ATAAATCTTG?300
CTTCAAGTGC?AGTCATTGCA?AAGGGACACT?AAAGTTGGCT?AATTACTCCT?CAATGGAAGG?360
TGTTCTTTAC?TGCAAGCCTC?ATTTCGAGCA?ACTCTTCAAG?GAGACGGGTA?ACTTCAACAA?420
GAATTTCCAA?TCGTCTGCAA?AGGCAGCTGA?GAAGTTAACT?CCCGAGATGA?CGAGATCACC?480
AAGCAAAGCT?GCCAGCATGT?TTTCCGGGAC?AGTCGAAAAA?TGTGCTACTT?GTGGCAAAAC?540
TGCATATCCA?CTTGAGAAGG?TAACTGTAGA?AGGACAGTCT?TACCACAAAT?CATGTTTCAA?600
GTGCTCTCAT?GGTGGCTGCT?CTTTGAGTCC?ATCAAATTAT?GCAGCACTTG?AAGGCATTTT?660
GTACTGCAAA?CATCACTTTT?CCCAGCTCTT?CAAGGAGAAA?GGAAGCTACA?ATCATCTTAT?720
CAAATCCGCA?TCAATCAAGC?GTGCCGCTGC?ATCCGTTCCT?GAAGCTTGAA?TACCTATTTC?780
ATGTTTTTTG?TTTATTCCCA?TGTTTGCCGG?TGTGTTTTTT?TATTGATTTT?TTGGATTTAT?840
GCTCGGGAGG?GGAACTGGAA?AGAAAGAACT?TGGGTTTCTT?TCCGTTTTTT?TGAGGCCTTG?900
GTATTTGATT?GATTTAAGTA?GAAGTGAATG?TTGTAACAGG?ACTCTGTGCA?AGATTTTTTA?960
TGCAATCCAA?ATTTGGCTCA?TTTCGAATGA?ATATTTTTAT?AAATAATAAA?AATGTTAGAT?1020
ACACTACTTG?GCAAT 1035
Gene coding region (ORF) is (200 – 769bp) from initiator codon ATG to terminator codon TGA.
2. the protein sequence of cotton GhLIM5 genes encoding is as follows:
Met?Ser?Phe?Ile?Gly?Thr?Gln?Gln?Lys?Cys?Lys?Ala?Cys?Glu?Lys?Thr?Val?Tyr?Pro?Val?Glu
5 10 15 20
Leu?Leu?Ser?Ala?Asp?Gly?Val?Pro?Tyr?His?Lys?Ser?Cys?Phe?Lys?Cys?Ser?His?Cys?Lys?Gly
25 30 35 40
Thr?Leu?Lys?Leu?Ala?Asn?Tyr?Ser?Ser?Met?Glu?Gly?Val?Leu?Tyr?Cys?Lys?Pro?His?Phe?Glu
45 50 55 60
Gln?Leu?Phe?Lys?Glu?Thr?Gly?Asn?Phe?Asn?Lys?Asn?Phe?Gln?Ser?Ser?Ala?Lys?Ala?Ala?Glu
65 70 75 80
Lys?Leu?Thr?Pro?Glu?Met?Thr?Arg?Ser?Pro?Ser?Lys?Ala?Ala?Ser?Met?Phe?Ser?Gly?Thr?Val
85 90 95 100 105
Glu?Lys?Cys?Ala?Thr?Cys?Gly?Lys?Thr?Ala?Tyr?Pro?Leu?Glu?Lys?Val?Thr?Val?Glu?Gly?Gln
110 115 120 125
Ser?Tyr?His?Lys?Ser?Cys?Phe?Lys?Cys?Ser?His?Gly?Gly?Cys?Ser?Leu?Ser?Pro?Ser?Asn?Tyr
130 135 140 145
Ala?Ala?Leu?Glu?Gly?Ile?Leu?Tyr?Cys?Lys?His?His?Phe?Ser?Gln?Leu?Phe?Lys?Glu?Lys?Gly
150 155 160 165
Ser?Tyr?Asn?His?Leu?Ile?Lys?Ser?Ala?Ser?Ile?Lys?Arg?Ala?Ala?Ala?Ser?Val?Pro?Glu?Ala
170 175 180 185 189。
GhLIM5 gene
2
100002
2010.2
Claims (2)
1. a cotton GhLIM5 gene, is characterized in that the cDNA sequence of this gene is as follows:
ACTCCTTTTT?ATACTCTCAT?TTTACGTTTA?TTTCTTCTTT?CTTTCATAGA?TCCAGGCCTT?60
CTTCTTCTTC?TTCTTCTTCT?TCTTCTTCTT?CTATCAAAGT?TAATATAGGC?AAATATAAGA?120
GAAGAAATCG?AATTAAAGTT?GATCCGTGAA?ACTAGATAAA?GAACAGTACG?ATTTGTTTTG?180
ACCAAAGCAC?ATTCGAGCCA?TGTCATTTAT?TGGTACCCAA?CAGAAATGCA?AGGCTTGTGA?240
GAAGACTGTT?TATCCAGTTG?AACTTTTGTC?TGCAGATGGA?GTTCCTTACC?ATAAATCTTG?300
CTTCAAGTGC?AGTCATTGCA?AAGGGACACT?AAAGTTGGCT?AATTACTCCT?CAATGGAAGG?360
TGTTCTTTAC?TGCAAGCCTC?ATTTCGAGCA?ACTCTTCAAG?GAGACGGGTA?ACTTCAACAA?420
GAATTTCCAA?TCGTCTGCAA?AGGCAGCTGA?GAAGTTAACT?CCCGAGATGA?CGAGATCACC?480
AAGCAAAGCT?GCCAGCATGT?TTTCCGGGAC?AGTCGAAAAA?TGTGCTACTT?GTGGCAAAAC?540
TGCATATCCA?CTTGAGAAGG?TAACTGTAGA?AGGACAGTCT?TACCACAAAT?CATGTTTCAA?600
GTGCTCTCAT?GGTGGCTGCT?CTTTGAGTCC?ATCAAATTAT?GCAGCACTTG?AAGGCATTTT?660
GTACTGCAAA?CATCACTTTT?CCCAGCTCTT?CAAGGAGAAA?GGAAGCTACA?ATCATCTTAT?720
CAAATCCGCA?TCAATCAAGC?GTGCCGCTGC?ATCCGTTCCT?GAAGCTTGAA?TACCTATTTC?780
ATGTTTTTTG?TTTATTCCCA?TGTTTGCCGG?TGTGTTTTTT?TATTGATTTT?TTGGATTTAT?840
GCTCGGGAGG?GGAACTGGAA?AGAAAGAACT?TGGGTTTCTT?TCCGTTTTTT?TGAGGCCTTG?900
GTATTTGATT?GATTTAAGTA?GAAGTGAATG?TTGTAACAGG?ACTCTGTGCA?AGATTTTTTA?960
TGCAATCCAA?ATTTGGCTCA?TTTCGAATGA?ATATTTTTAT?AAATAATAAA?AATGTTAGAT?1020
ACACTACTTG?GCAAT 1035
Gene coding region is the 200th – 769 bit bases.
2. cotton GhLIM5 gene as claimed in claim 1, is characterized in that the protein sequence of this genes encoding is as follows:
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210214442.7A CN102747088B (en) | 2012-06-27 | 2012-06-27 | Cloning, identification and use of cotton fiber development-related GhLIM5 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210214442.7A CN102747088B (en) | 2012-06-27 | 2012-06-27 | Cloning, identification and use of cotton fiber development-related GhLIM5 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102747088A CN102747088A (en) | 2012-10-24 |
| CN102747088B true CN102747088B (en) | 2014-07-09 |
Family
ID=47027579
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210214442.7A Expired - Fee Related CN102747088B (en) | 2012-06-27 | 2012-06-27 | Cloning, identification and use of cotton fiber development-related GhLIM5 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102747088B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950632A (en) * | 2016-05-25 | 2016-09-21 | 华中师范大学 | Cotton fiber development related GhFSN1 gene identification and application |
| CN109536511A (en) * | 2018-12-13 | 2019-03-29 | 浙江农林大学 | One cotton actin gene mutant and its application |
| CN111662921B (en) * | 2019-02-21 | 2022-10-14 | 中国科学院微生物研究所 | Cultivation method and application of transgenic cotton tag strain tracing positive end of microtubule in cotton cell |
| CN111662920B (en) * | 2019-02-21 | 2022-10-14 | 中国科学院微生物研究所 | Cultivation method and application of transgenic cotton tag strain for marking cotton cell microfilament skeleton |
| CN116516053B (en) * | 2023-05-23 | 2023-11-10 | 中国农业科学院郑州果树研究所 | Primer pair, kit and method for detecting watermelon LIM gene family and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1715412A (en) * | 2005-07-20 | 2006-01-04 | 中国科学院微生物研究所 | Gene relevant and proteins encoded and application with cotton fiber development |
-
2012
- 2012-06-27 CN CN201210214442.7A patent/CN102747088B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1715412A (en) * | 2005-07-20 | 2006-01-04 | 中国科学院微生物研究所 | Gene relevant and proteins encoded and application with cotton fiber development |
Non-Patent Citations (4)
| Title |
|---|
| Luo M.等.Gossypium hirsutum LIM domain protein (LIM-1) mRNA |
| Luo,M.等.Gossypium hirsutum LIM domain protein (LIM-1) mRNA,complete cds.《NCBI数据库,登陆号:AF443117.1》.2001, * |
| 植物LIM蛋白家族研究进展;蔡兴怀等;《黑龙江农业科学》;20110630(第6期);146-149 * |
| 蔡兴怀等.植物LIM蛋白家族研究进展.《黑龙江农业科学》.2011,(第6期),146-149. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102747088A (en) | 2012-10-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102747088B (en) | Cloning, identification and use of cotton fiber development-related GhLIM5 gene | |
| Tang et al. | The herbaceous peony transcription factor WRKY41a promotes secondary cell wall thickening to enhance stem strength | |
| CN101698839B (en) | Uridine diphosphate xylose isomerase, coding gene thereof and use thereof | |
| CN102399792A (en) | Cloning and identification of cotton fiber cell secondary wall development-associated GhNAC1 gene | |
| CN106589087A (en) | Dendrobium bHLH transcription factor and encoding protein and application thereof | |
| Wang et al. | Heterologous overexpression of the GbTCP5 gene increased root hair length, root hair and stem trichome density, and lignin content in transgenic Arabidopsis | |
| CN109609514A (en) | Pears transcription factor PbrMYB169 and its application | |
| CN103981193A (en) | Identification and application of cotton gene BZR1 | |
| CN103602687A (en) | Cotton GhMATE1 gene and application thereof to improvement of cotton brown fiber color | |
| CN108948169A (en) | It is a kind of promote cotton fiber green pigment synthesis protein, gene and its coded sequence and application | |
| CN106916817A (en) | The drought-resistant and high salt promoter of tree peony PsDREB1 genes and its expression and application | |
| Gao et al. | GhERF41, a group IIIe ERF protein, participates in regulating cell wall synthesis in cotton fiber | |
| CN114540372B (en) | Upland cotton GhLTP17-A and application thereof in aspect of regulating and controlling fiber development | |
| CN102492029A (en) | Cotton acetylcysteine (NAC) transcription factor NST sub-family and application thereof | |
| CN111218454B (en) | GhRFP1 gene and recombinant vector thereof | |
| CN102492693A (en) | Identification and application of cotton fibre-specific HB (homeobox) transcription factor gene KNAT7 | |
| CN101818148B (en) | Identification of cotton fiber specificity promoter GhFLA1 | |
| CN110106184A (en) | The clone of alfalfa salt tolerance and drought resistance gene MsBBX a kind of and application | |
| CN102786587B (en) | Transcription factor for improving plant seed aliphatic acid content and application thereof | |
| CN112410362A (en) | Rhododendron micranthum TPS gene, primer for cloning Rhododendron micranthum TPS gene, cloning method and application thereof | |
| CN108715854A (en) | Applications of the cotton AINTEGUMENTA genes GhANT in cotton breeding | |
| CN114480447A (en) | Application of kenaf thioredoxin analog protein gene HcTrx and recombinant vector thereof in VIGS silencing system | |
| CN109234290B (en) | Brassica napus BnKAT2 gene and promoter and application thereof | |
| CN104313032B (en) | The function of cotton GhTT8A genes and the application using animal nutrition in brown fibre cotton is improved | |
| CN113151231A (en) | Rhododendron phenylalanine ammonia lyase PAL protein, coding gene and gene cloning method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140709 Termination date: 20170627 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |