CN102735664A - Potassium ion concentration detection method - Google Patents

Potassium ion concentration detection method Download PDF

Info

Publication number
CN102735664A
CN102735664A CN2012102062272A CN201210206227A CN102735664A CN 102735664 A CN102735664 A CN 102735664A CN 2012102062272 A CN2012102062272 A CN 2012102062272A CN 201210206227 A CN201210206227 A CN 201210206227A CN 102735664 A CN102735664 A CN 102735664A
Authority
CN
China
Prior art keywords
wavelength
solution
absorbance
sample
concentration
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN2012102062272A
Other languages
Chinese (zh)
Other versions
CN102735664B (en
Inventor
唐亚林
孙红霞
杨千帆
尚倩
姜薇
盖伟
向俊锋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Chemistry CAS
Original Assignee
Institute of Chemistry CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Chemistry CAS filed Critical Institute of Chemistry CAS
Priority to CN201210206227.2A priority Critical patent/CN102735664B/en
Publication of CN102735664A publication Critical patent/CN102735664A/en
Priority to PCT/CN2013/077335 priority patent/WO2013189265A1/en
Application granted granted Critical
Publication of CN102735664B publication Critical patent/CN102735664B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09B—ORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
    • C09B23/00—Methine or polymethine dyes, e.g. cyanine dyes
    • C09B23/0008—Methine or polymethine dyes, e.g. cyanine dyes substituted on the polymethine chain
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09B—ORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
    • C09B23/00—Methine or polymethine dyes, e.g. cyanine dyes
    • C09B23/02—Methine or polymethine dyes, e.g. cyanine dyes the polymethine chain containing an odd number of >CH- or >C[alkyl]- groups
    • C09B23/06—Methine or polymethine dyes, e.g. cyanine dyes the polymethine chain containing an odd number of >CH- or >C[alkyl]- groups three >CH- groups, e.g. carbocyanines
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
    • G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
    • G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
    • G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/84—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving inorganic compounds or pH
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
    • G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
    • G01N2021/7769—Measurement method of reaction-produced change in sensor
    • G01N2021/7786—Fluorescence

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Plasma & Fusion (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Inorganic Chemistry (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)

Abstract

The invention relates to a potassium ion concentration detection method. According to the method, characteristics comprising that potassium ion regulation allows G-quadruplex DNA structure transformation to be formed and cyanine dye supermolecular aggregates identify the G-quadruplex DNA structure transformation are utilized, a sample to be detected is added to a mixed solution of G-quadruplex DNA and the cyanine dye, the absorbance value at 560-590nm, 500-540nm or 610-670nm or the fluorescence intensity value at 580-640nm is determined, and the corresponding potassium ion concentration value can be obtained through finding the value corresponding to the absorbance value or the fluorescence intensity value on a standard curve. The method has a high specificity, so the method is not affected by sodium ions in the sample; and reagent components is simple, and the reaction process is simple, so errors generated by operations can be effectively reduced, and the test accuracy is high. The method can be rapidly realized through a common ultraviolet-visible absorption detector, a spectrophotometer or a fluorescent spectrometer without special or extra instruments, so the detection cost is low, thereby the popularization and the application of the method in industries are convenient.

Description

The potassium concentration detection method
Technical field
The invention belongs to biomedicine field, in particular to a kind of potassium concentration detection method.
Background technology
Potassium in the human body is to keep the movable main kation of cell physiological, is normal osmotic pressure and the acid base equilibrium that keeps body, and involved in sugar and protein metabolism guarantee that nervimuscular normal function institute is essential, and its content is human physiological activity's important indicator.In urine, the serum contents level of potassium ion available clinically diagnose the disease of aspects such as some kidneys, heart.
Under the normal condition, the potassium concentration of human body has a reasonable reference scope, in serum: 3.5～5.5mmol/L; 25～125mmol/24h in the urine.When potassium ion is higher than reference value; Show high potassium disease, its reason mainly contains: acute renal failure, significant hemolysis or tissue damage, acute acid poison or histanoxia, hypoadrenocorticism, aldosterone deficiency, prolonged application diuretics, familial hyperkalemia etc.The serum potassium height can cause that also the inhibition of serious muscle, cardiac muscle and respiratory function stress be disorderly, and special ECG change.When serum potassium is higher than 7mmol/L, just there are these phenomenons to occur, when surpassing 10mmol/L, ventricular fibrillation can take place, cardiac arrest and cause death.Otherwise low potassium disease then can appear when situation such as the intake of potassium is not enough, potassium loss is serious, kidney trouble changes diuresis stage over to.
The method of measuring potassium concentration in the prior art mainly contains: neutron activation method, isotope dilution mass spectrometry, chemical assay, flame photometry, ion selective electrode method, enzyme kinetics method, atom AAS etc.At present, the method for often using clinically is flame photometry and ion selective electrode method.
(1) flame photometry: flame photometry is a kind of emission spectrometry method; Utilize in the flame excited atom to return the spectral intensity of launching when reducing to ground state and carry out content analysis; Can detect the Na+ and the K+ of serum, urine, cerebrospinal fluid and ascites pleural fluid; This method belongs to classical canonical reference method, advantage be the result accurately and reliably, widely clinical employing.
Usually the quantivative approach that adopts has outer standard law and internal reference method.Outer standard law general operation error is bigger, seldom adopts.Internal standard method is that sample and titer adopt the internal standard element of adding same concentrations to measure; Generally be to add mark in the lithium; What measure is the ratio of lithium/potassium current, rather than the electric current of independent potassium, like this; Can reduce the error that factors such as combustion gas and flame temperature fluctuation cause, thereby accuracy is preferably arranged.
(2) ion selective electrode method (ISE method): potassium, sodion in the cleer and peaceful urine of the enterprising promoting circulation of blood of instrumentation are measured.To have a sample consumption few because of it, and quick and precisely, advantage such as easy and simple to handle is the easiest method accurately in all methods at present, and the trend that replaces additive method is almost arranged.Its principle is: ion-selective electrode is a kind of electrochemical sensor; There is one specific ion had the sensitive membrane electrode of selective response in its structure, converts ion activity to electric potential signal, within the specific limits; The logarithm of specific ion activity is linear in its current potential and the solution; Through trying to achieve the ion activity of unknown solution, be divided into direct determination method and indirect determination method again by its mensuration process, most of at present indirect determination method that adopts with the solution comparison of known ion concentration; Because the indirect determination method is measured sample to be tested dilution back, institute's measured ion activity is more near ion concentration.
Main type of electrodes has at present: glass-membrane electrode, inductive material are glass-film; The solid phase electrode is by the extrusion forming of insoluble metal material; The liquid film electrode, with epoxy resin or interior dress PVC as sense film; The K+ electrode that the valinomycins film is processed.These electrodes all have certain life-span, and after asking when using one section, electrode can wear out, and costs an arm and a leg.
(3) chemical assay: the chemical assay of K+ at present mainly utilizes multiple ring crown compound such as cave crown ether or spherical crown ether; Also be called crown ether, be ionophore and measure, owing in the macrocyclic structure hole is arranged; The intramolecule oxygen atom has not, and share electron pair can combine with metallic ion; According to the hole size, the alternative metallic ion that combines different-diameter, thus can reach the purpose of measuring ion concentration.
(4) enzyme process: the principle of enzymatic assays potassium is the activation of utilizing pyruvate kinase, and latter's catalysis PEP becomes lactic acid simultaneously with the consumption of reduced coenzyme I, and the absorbance of surveying NADH at wavelength 340nm place descends.
(5) the atom AAS also can be used for detecting potassium in the serum, sodion, but complicated operation, error is bigger, and is easy not as good as flame photometry.
Summary of the invention
The object of the invention: provide a kind of cyanine dyes supermolecule and guanine four serobilas (G-four serobilas) effect system utilized to detect the new method of potassium concentration, and use the formulated potassium concentration detection kit of this method.Utilize the reagent in this kit, the concentration of potassium ion in ultra-violet absorption spectrum capable of using or fluorescence spectrum instrument quantitative test serum or the urine, the mensuration process does not receive sodion or other micro-influences, and degree of accuracy is high.Simultaneously, because this reagent sensitivity is very high, different potassium concentrations are shown the variation on the color, naked eyes are visible, can realize visual detection.
General technical route of the present invention is: regulate and control the formation or the conformation transition of G-four chain body structures through adding potassium ion, cyanine dyes is discerned the variation of G-four chain body structures thereupon, thereby reflects the concentration level of potassium ion.Be specially: under the environment that does not have sodion and other metal cations to exist, potassium ion impels the dna sequence dna of strand to change G-four chain body structures into, along with the generation of G-four chain body structures; The accumulation shape of cyanine dyes changes; Thereby on color, change, reach naked-eye observation, obvious variation also takes place on ultra-violet absorption spectrum and fluorescence spectrum simultaneously; The intensity of variation of absorbance and fluorescence intensity is directly proportional with potassium concentration, thereby realizes quantitative response potassium ion level; Perhaps under the environment that sodion exists; Dna sequence dna forms antiparallel structure G-four serobilas, adds the then occurred conformation transformation of potassium ion antiparallel G-four serobilas, along with G-four serobila conformation transitions; The accumulation shape of cyanine dyes changes; Thereby on the color and on ultra-violet absorption spectrum and the fluorescence spectrum obvious variation is taking place also, the intensity of variation of absorbance and fluorescence intensity is directly proportional with potassium concentration, but quantitative response potassium ion level.
First aspect of the present invention provides the method for potassium concentration in a kind of tracer liquid sample, said method comprising the steps of:
(1) with the different a plurality of solution samples of the buffer preparation potassium concentration of pH6.2～8.2, wherein contains the dna molecular that can form G-four serobilas of same concentrations and the cyanine dyes of same concentrations in each said solution sample;
(2) said a plurality of solution samples are placed under ultraviolet-visible absorption spectrometer or the spectrophotometer; Detect the absorbance of first wavelength and the absorbance of second wavelength, perhaps said a plurality of solution samples are placed under the XRF, adopt the excitation wavelength of 560nm; Detect the fluorescence intensity level of wavelength at the three-wavelength place; Wherein said first wavelength is in 560nm to 590nm scope, and said second wavelength is in 500nm to 540nm scope, and said three-wavelength is in 580nm to 640nm scope;
(3) with the potassium concentration of each said solution sample as horizontal ordinate or ordinate; Is ordinate or horizontal ordinate mapping with the absorbance of first wavelength that records in the step (2) or the absorbance of second wavelength or the absorbance of first wavelength with the ratio of the absorbance of second wavelength or the fluorescence intensity level at three-wavelength place, thus the typical curve of acquisition potassium concentration;
(4) adding can form the dna molecular of G-four serobilas, compound and the damping fluid of formula I in the testing liquid sample; So that the compound concentrations of the concentration of the dna molecular that can form G-four serobilas in the testing liquid sample, formula I and pH value are consistent with the solution sample in the step (1), thereby obtain test solution;
(5) test solution that obtains in the step (4) is placed under ultraviolet-visible absorption spectrometer or the spectrophotometer; Detect test solution at first wavelength and the second wavelength absorbance; Perhaps said test solution is placed under the XRF; Adopt the excitation wavelength of 560nm, detect the fluorescence intensity level at three-wavelength place;
(6) utilize the potassium concentration value that finds corresponding test solution in step (3) in the ratio potassium concentration typical curve that perhaps fluorescence intensity level at three-wavelength place obtains of absorbance and the absorbance of second wavelength of absorbance or first wavelength of absorbance or second wavelength of first wavelength that records in the step (5), calculate the potassium concentration of testing sample then through the extension rate of testing sample quilt.
Method of the present invention can be advantageously used in detecting the potassium concentration in the various solution examples, for example, can detect the potassium concentration in human or animal's blood, urine or other body fluid.
Because in human body or animal body, the existence that except potassium ion, also has many other metallic ions, particularly sodion can produce certain influence to the accuracy of method of the present invention.
Therefore, second aspect of the present invention provide a kind of under the sodion background method of potassium concentration in the tracer liquid sample, said method comprising the steps of:
(1), wherein contains the dna molecular that can form G-four serobilas of same concentrations, the sodion of same concentrations and the cyanine dyes of same concentrations in each said solution sample with the different a plurality of solution samples of the buffer preparation potassium concentration of pH6.2～8.2;
(2) said a plurality of solution samples are placed under ultraviolet-visible absorption spectrometer or the spectrophotometer; Detect the absorbance of said solution sample in first wavelength and the 4th wavelength; Perhaps said a plurality of solution samples are placed under the XRF; Adopt the excitation wavelength of 560nm, detect the fluorescence intensity level of wavelength at the three-wavelength place, wherein said first wavelength is in 560nm to 590nm scope; Said the 4th wavelength is in 610nm to 670nm scope, and said three-wavelength is in 580nm to 640nm scope;
(3) with the potassium concentration of each said solution sample as horizontal ordinate or ordinate; Is ordinate or horizontal ordinate mapping at the absorbance of first wavelength or the absorbance of the 4th wavelength or the absorbance of first wavelength with the ratio of the absorbance of the 4th wavelength or the fluorescence intensity level at three-wavelength place with each solution sample of recording in the step (2), thus the typical curve of acquisition potassium concentration;
(4) adding can form the dna molecular of G-four serobilas, compound and the damping fluid of formula I in the testing liquid sample; So that the compound concentrations of the concentration of the dna molecular that can form G-four serobilas in the testing liquid sample, formula I and pH value are consistent with the solution sample in the step (1), thereby obtain test solution;
(5) test solution that obtains in the step (4) is placed under ultraviolet-visible absorption spectrometer or the spectrophotometer; Detect the absorbance of said test solution in said first wavelength and said the 4th wavelength; Perhaps said test solution is placed under the XRF; Adopt the excitation wavelength of 560nm, detect the fluorescence intensity level of wavelength at said three-wavelength place;
(6) utilize the potassium concentration value that finds corresponding test solution in step (3) in the ratio potassium concentration typical curve that perhaps fluorescence intensity level at three-wavelength place obtains of absorbance and the absorbance of the 4th wavelength of absorbance or first wavelength of absorbance or the 4th wavelength of first wavelength that records in the step (5), calculate the potassium concentration of testing sample then through the extension rate of testing sample quilt.
According to the method for first aspect present invention, wherein said damping fluid is selected from tris-HCI buffer, boric acid-borate buffer solution, triethanolamine damping fluid, imidazoles-hydrochloride buffer, glycylglycine damping fluid or 2-amino-2-methyl-1-propanol damping fluid.
According to the method for second aspect present invention, wherein said damping fluid is selected from trishydroxymethylaminomethane-hydrochloric acid (Tris-HCl) damping fluid, boric acid-borate buffer solution, triethanolamine damping fluid, imidazoles-hydrochloride buffer, glycylglycine damping fluid, 2-amino-2-methyl-1-propanol damping fluid, sodium phosphate-dibastic sodium phosphate damping fluid, barbital sodium-hydrochloride buffer, citric acid-sodium citrate damping fluid, glycocoll-sodium hydrate buffer solution, borax-sodium hydrate buffer solution or sodium phosphate buffer.
In embodiments of the invention, the concentration of buffering agent in the damping fluid is not done special qualification, but preferred concentration range is 10～50mmol/L.
According to the method for first aspect present invention or second aspect, wherein said cyanine dyes is the compound of following formula I
Figure BDA00001780268700051
Wherein: R 1Be C 1-C 6The substituted phenyl of alkyl, phenyl, alkyl; R 2, R 3, R 4And R 5Be independently selected from H or C 1-C 6Alkyl, perhaps R 2And R 3Form 5 yuan to 7 yuan ring structure with the carbon atom that they connected, perhaps R 4And R 5Form 5 yuan to 7 yuan ring structure with the carbon atom that they connected; R 6And R 7Be C 1-C 6The substituted C of alkyl or sulfonic group 1-C 6Alkyl; Y is a gegenion, according to R 6And R 7Institute charged difference and difference are as if R 6And R 7Be alkyl, then Y is a halide anion; If R 6And R 7Have only one to have sulfonate radical, then need not Y as gegenion; If R 6And R 7All have sulfonate radical, then Y is the triethylamine kation; X 1, X 2Be independently selected from carbon (C), oxygen (O), sulphur (S), selenium (Se) or tellurium (Te).
According to the method for first aspect present invention or second aspect, wherein C 1-C 6Alkyl be that carbon number is the alkyl of the straight or branched of 1-6, include but not limited to methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl etc.
According to the method for first aspect present invention or second aspect, wherein R 1Be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl, isohesyl, phenyl, aminomethyl phenyl or 3,5-dimethylphenyl.
According to the method for first aspect present invention or second aspect, wherein R 2, R 3, R 4And R 5Be independently selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
According to the method for first aspect present invention or second aspect, wherein R 2And R 3The carbon atom that is connected with them can form 5 yuan to 7 yuan saturated rings structure or unsaturated ring structure, and said ring structure can contain or not contain nitrogen (N) or sulphur (S) atom.
According to the method for first aspect present invention or second aspect, wherein R 4And R 5The carbon atom that is connected with them can form 5 yuan to 7 yuan saturated or unsaturated ring structure, and said ring structure can contain or not contain N or S atom.
According to the method for first aspect present invention or second aspect, wherein Y is preferably fluorine, chlorine, bromine, iodine negative ion or triethylamine kation.
According to first aspect present invention or the described method of second aspect; Wherein can wait and prepare said a plurality of solution sample through using soluble potassium salt such as potassium chloride, glazier's salt, potassium nitrate; The scope of potassium concentration is preferably in 0 to 200mmol/L scope in each solution sample; Further preferably in 0 to 100mmol/L scope, further preferably in 0 to 10mmol/L scope, most preferably in 0 to 2mmol/L scope; The non-limiting example of wherein said soluble potassium salt comprises, potassium chloride, potassium bromide, potassium iodide, glazier's salt or potassium nitrate etc.
According to the described method of second aspect present invention; Na ion concentration preferably is controlled in human body or the animal body in the physiological concentration scope in wherein said a plurality of solution sample; 10 to 200mmol/L scope for example, preferably in 40 to 160mmol/L scope, the concentration of sodion can be led to and added soluble sodium salt or use the damping fluid that contains sodion to regulate; The non-limiting example of said soluble sodium salt comprises, sodium chloride, sodium bromide, sodium iodide, sodium sulphate or sodium nitrate etc.
Method according to first aspect present invention or second aspect; The concentration of wherein said cyanine dyes in the solution sample is in the scope of 3 to 20 μ mol/L; Preferably at 5 to 10 μ mol/L; The said scope that can form the concentration of dna molecular in the solution sample of G-four serobilas at 3 to 30 μ mol/L is preferably at 5 to 20 μ mol/L, further preferably at 10 to 20 μ mol/L.
According to first aspect present invention or the described method of second aspect, the wherein said dna molecular that can form G-four serobilas is the dna molecular that is rich in guanine in the molecular sequences, and the dna molecular that has " GG " structure in the preferred molecular sequences.In this type of dna molecular, four guanines connect through hydrogen bond can form the plane quartet, and plural plane quartet can be piled up each other and formed three-dimensional four chain structures, i.e. guanine four serobilas (G-four serobilas).The non-limiting example of this type dna molecular comprises; As can be available from the dna moleculars such as TTAGGGTTAGGG, TTAGGG TTAGGGTTAGGGTTAGGGTTAGGG, AGGGTTAGGGTTAGGGTTAGGG, TGAGGGTGGGGAGGGTGGGGAA, AGGGAGGGCGCTGGGAGGAGGG, GGGCGCGGGAGGAATTGGGCGGG, GGTTGGTGTGGTTGG, TTGGGGTTGGGGTTGGGGTTGGGG, TTGGGGTTGGGG, GGGGTTGGGG, GGGCGCGGGAGGAAGGGGGCGGG or GGGCGCGGGAGGAATTGGGCGGG of Ying Jun Bioisystech Co., Ltd, but the dna sequence dna scope that can form G-four serobilas do not receive these enumerate limit.In addition, do not have particular restriction for the employed length that can form the dna molecular of G-four serobilas among the present invention, but the length of preferred 6 ~ 300 bases, the more preferably length of 10 ~ 100 bases, the most preferably length of 10 ~ 30 bases.
The third aspect of the invention provides a kind of kit and system of embodiment of the present invention method, and said kit comprises: the damping fluid of pH6.2 ~ 8.2, soluble potassium salt, can form the dna molecular and the cyanine dyes of G-four serobilas; Said system comprises: the damping fluid of pH6.2 ~ 8.2, soluble potassium salt, the dna molecular that can form G-four serobilas, cyanine dyes and ultraviolet-visible absorption spectrometer or spectrophotometer or XRF.
According to described kit of third aspect present invention and system, also comprise soluble sodium salt.
According to described kit of third aspect present invention and system, wherein said damping fluid, soluble potassium salt, soluble sodium salt, the dna molecular that can form G four serobilas and cyanine dyes such as preamble definition.
The major advantage of method of the present invention and kit is:
1) the present invention utilizes the G-four chain body structures of cyanine dyes supramolecular aggregation specific recognition potassium ion regulation and control, can under the physiological sodium ion concentration, operate and unaffected, to potassium ion specificity height;
2) the present invention uses cyanine dyes supermolecule probe; G-four serobila structural changes to the potassium ion regulation and control are very responsive, with the change of accumulation shape, in ultra-violet absorption spectrum, show the displacement of absorption band up to nearly hundred nanometers simultaneously; Thereby the variation on the generation color, can realize visual detection;
3) cyanine dyes supermolecule used in the present invention; Can both produce marked change at ultra-violet absorption spectrum and fluorescence spectrum; Utilize common ultra-violet absorption spectrum appearance or spectrophotometer or XRF all can realize detection by quantitative; Do not need special or additional instruments, testing cost is cheap, is convenient to apply in the industry;
4) agents useful for same composition of the present invention has only 3～4 kinds, only needs to mix in proportion, and simple to operate, quick and with low cost with regard to available instrument detecting, this system is operated in buffered environment, does not pollute the environment.
5) agents useful for same composition of the present invention is simple, kind is few, can not exert an influence each other, and good stability, can store the fine assurance application testing effect of ability for a long time;
6) use the reagent that detection method provided by the invention can be processed various ways such as liquid reagent, powdered reagent, dried reagent; Can be used to measure the content of human body and the interior potassium ion of other animal body, also can be used to detect the potassium ion level in other samples such as water quality or soil.
7) use detection method provided by the invention,, can be developed to the form of test paper, make detection more simple, convenient according to the characteristic of cyanine dyes aggregation change color.
8) use method of the present invention,, can realize the potassium concentration in the sample of various concentration ranges is analyzed through different extension rates.
Description of drawings
Fig. 1 is the potassium concentration typical curve according to the embodiment of the invention 1;
Fig. 2 is the potassium concentration typical curve according to the embodiment of the invention 2;
Fig. 3 is the potassium concentration typical curve according to the embodiment of the invention 3;
Fig. 4 is the potassium concentration typical curve according to the embodiment of the invention 4;
Fig. 5 is the potassium concentration typical curve according to the embodiment of the invention 9;
Fig. 6 is the potassium concentration typical curve according to the embodiment of the invention 10;
Fig. 7 is the potassium concentration typical curve according to the embodiment of the invention 11;
Fig. 8 is the potassium concentration typical curve according to the embodiment of the invention 12.
Embodiment
Come to describe in more detail the present invention with the mode of specific embodiment below with reference to accompanying drawings; But be to be understood that; The present invention can implement in a different manner; It only is in order to make this instructions fully with complete that these embodiment are provided, so that those skilled in the art can embodiment of the present invention, scope of the present invention should not be defined as the listed specific embodiment of this paper.Employed in an embodiment of the present invention instrument has: ultraviolet-visible absorption spectrometer, model are Agilent 8453UV-visible spectrophotometer; XRF, model Hitachi F4500spectrofluorometer (Japan).
Embodiment 1
The DNA that can form G four serobilas that uses in the present embodiment is AGGGTTAGGGTTAGGGTTAGGG, and employed cyanine dyes is the compound of following formula
Figure BDA00001780268700091
1) preparation standard solution sample and test solution
A certain amount of DNA is dissolved in the Tris-HCl damping fluid of pH value 6.2, preparation concentration is 200 μ mol/LDNA mother liquors, and is subsequent use.
Getting concentration is the methanol solution 300 μ L of 200 μ mol/L cyanine dyes, adds 19.2ml Tris-HCl damping fluid, and then adds dna solution 300 μ L mixings.Be divided into 10 parts to above-mentioned sample mean, every this solution of increment is 1.98mL.
Get 6 samples wherein, adding a certain amount of concentration respectively is the KCl solution of 200mmol/L, is settled to 2mL with the Tris-HCl damping fluid then, and the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.25,0.5, the standard solution sample of 0.8mmol/L.
Add urine specimen 20 μ L to be measured in other 4 samples, obtain 4 test solutions, urine specimen accounts for 1% of test solution.
Above sample is in shady place placement, subsequent use.
2) check and analysis
Utilize the ultra-violet absorption spectrum appearance to analyze respectively in above-mentioned sample.Every operation all carries out under room temperature environment, does not need extra condition.The wavelength that ultra-violet absorption spectrum is collected is in the data at 400～800nm place.
3) interpretation of result
With the absorbance (A of master sample at the 580nm place 1) be horizontal ordinate, be that ordinate is figure with the potassium concentration of master sample, obtain the typical curve of potassium concentration, as shown in Figure 1.Can on typical curve, find the potassium concentration value of corresponding test solution with the absorbance at the 580nm place of test solution, with its divided by 1% obtain urine sample to be measured the potassium concentration value, the result sees the following form 1.
Table 1
Figure BDA00001780268700101
Embodiment 2
The DNA that can form G four serobilas that uses in the present embodiment is TGAGGGTGGGGAGGGTGGGGAA DNA, and employed cyanine dyes is the compound of following formula
Figure BDA00001780268700102
1) preparation standard solution sample and test solution
A certain amount of DNA is dissolved in the boric acid-borate buffer solution of pH value 8.2, preparation concentration is 200 μ mol/LDNA mother liquors, and is subsequent use.
Getting concentration is the methanol solution 300 μ L of 600 μ mol/L cyanine dyes, adds 19.2ml boric acid-borate buffer solution, and then adds dna solution 300 μ L mixings.Be divided into 10 parts to above-mentioned sample mean, every this solution of increment is 1.98mL.
Get 6 samples wherein; Adding a certain amount of concentration respectively is the KCl solution of 200mmol/L; Be settled to 2mL with boric acid-borate buffer solution then, the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.25,0.5, the standard solution sample of 0.8mmol/L.
Add urine specimen 20 μ L to be measured in other 4 samples, obtain 4 test solutions, urine specimen accounts for 1% of test solution.
2) check and analysis
Utilize the ultra-violet absorption spectrum appearance to analyze respectively in above-mentioned sample.Every operation all carries out under room temperature environment, does not need extra condition.The wavelength that ultra-violet absorption spectrum is collected is in the data at 400～800nm place.
3) interpretation of result
With the ratio (A of master sample in the absorbance and the 530nm place absorbance at 580nm place 1/ A 2) be ordinate, be that horizontal ordinate is figure with the potassium concentration of master sample, obtain the typical curve of potassium concentration, as shown in Figure 2.Can on typical curve, find the potassium concentration value of corresponding test solution with the absorbance at the 580nm place of test solution and the ratio of 530nm place absorbance, with its divided by 1% obtain urine sample to be measured the potassium concentration value, the result sees the following form 2.
Table 2
Figure BDA00001780268700111
Embodiment 3
The DNA that can form G four serobilas that uses in the present embodiment is GGGCCAGGGAGCGGGGCGGAGGGGG, and employed cyanine dyes is the compound of following formula
Figure BDA00001780268700112
1) preparation standard solution sample and test solution
A certain amount of DNA is dissolved in the Tris-HCl damping fluid of pH value 7.2, preparation concentration is 600 μ mol/LDNA mother liquors, and is subsequent use.
Getting concentration is the methanol solution 300 μ L of 1.2mmol/L cyanine dyes, adds 19.2ml Tris-HCl damping fluid, and then adds dna solution 300 μ L mixings.Be divided into 10 parts to above-mentioned sample mean, every this solution of increment is 1.98mL.
Get 6 samples wherein, adding a certain amount of concentration respectively is the KCl solution of 200mmol/L, is settled to 2mL with the Tris-HCl damping fluid then, and the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.25,0.5, the standard solution sample of 0.8mmol/L.
Add urine specimen 20 μ L to be measured in other 4 samples, obtain 4 test solutions, urine specimen accounts for 1% of test solution.
Above sample is in shady place placement, subsequent use.
2) check and analysis
Utilize the ultra-violet absorption spectrum appearance to analyze respectively in above-mentioned sample.Every operation all carries out under room temperature environment, does not need extra condition.The wavelength that ultra-violet absorption spectrum is collected is in the data at 400～800nm place.
3) interpretation of result
With the absorbance (A of master sample at the 530nm place 2) be ordinate, be that horizontal ordinate is figure with the potassium concentration of master sample, obtain the typical curve of potassium concentration, as shown in Figure 3.On typical curve, find the potassium concentration value of corresponding test solution with the absorbance at the 530nm place of test solution, with its divided by 1% obtain urine sample to be measured the potassium concentration value, the result sees the following form 3.
Table 3
Figure BDA00001780268700121
Embodiment 4
The DNA that can form G four serobilas that uses in the present embodiment is AGGGTT, and employed cyanine dyes is the compound of following formula
Figure BDA00001780268700122
1) preparation standard solution sample and test solution
A certain amount of DNA is dissolved in the Tris-HCl damping fluid of pH value 7.0, preparation concentration is 1.2mmol/L DNA mother liquor, and is subsequent use.
Getting concentration is the methanol solution 300 μ L of 200 μ mol/L cyanine dyes, adds 19.2ml Tris-HCl damping fluid, and then adds dna solution 300 μ L mixings.Be divided into 10 parts to above-mentioned sample mean, every this solution of increment is 1.98mL.
Get 6 samples wherein, adding a certain amount of concentration respectively is the KCl solution of 200mmol/L, is settled to 2mL with the Tris-HCl damping fluid then, and the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.25,0.5, the standard solution sample of 0.8mmol/L.
Add urine specimen 20 μ L to be measured in other 4 samples, obtain 4 test solutions, urine specimen accounts for 1% of test solution.
Above sample is in shady place placement, subsequent use.
2) check and analysis
Above-mentioned fluorescent spectrometer is analyzed.Every operation all carries out under room temperature environment, does not need extra condition.The fluorescence spectrum excitation wavelength is 560nm, and the wavelength capture range is 570～720nm.
3) interpretation of result
The fluorescence intensity at wavelength 580nm place (FI) with master sample is a horizontal ordinate, is that ordinate is figure with the potassium concentration of master sample, obtains the typical curve of potassium concentration, and is as shown in Figure 4.On typical curve, find the potassium concentration value of corresponding test solution with the fluorescence intensity of test solution, with its divided by 1% obtain urine sample to be measured the potassium concentration value, the result sees the following form 4.
Table 4
Figure BDA00001780268700131
Embodiment 5
Adopt and with embodiment 1 identical step four blood serum samples are detected, difference is that the DNA that uses is TTAGGG TTAGGGTTAGGGTTAGGGTTAGGG, and the cyanine dyes that uses is the compound of following formula:
Figure BDA00001780268700141
Detect solution sample and test solution in the absorbance at wavelength 590nm place, be designated as A 1
Result such as following table 5:
Table 5
Figure BDA00001780268700142
Embodiment 6
Adopt and with embodiment 2 identical steps four blood serum samples are detected, difference is that the DNA that uses is AGGGTTAGGGTTAGGGTTAGGG, and the cyanine dyes that uses is the compound of following formula:
Figure BDA00001780268700143
Detect solution sample and test solution in the absorbance at wavelength 590nm place and 540nm place, be designated as A respectively 1And A 2
Result such as following table 6:
Table 6
Figure BDA00001780268700151
Embodiment 7
Adopt and with embodiment 3 identical steps four blood serum samples are detected, difference is to use the compound of following formula:
Figure BDA00001780268700152
Detect solution sample and test solution in the absorbance at wavelength 500nm place, be designated as A 2
Result such as following table 7:
Table 7
Embodiment 8
Adopt and with embodiment 4 identical steps four blood serum samples are detected, difference is to use the compound of following formula:
Detect solution sample and test solution in the fluorescence intensity at wavelength 640nm place, be designated as FI.
Result such as following table 8:
Table 8
Figure BDA00001780268700161
Embodiment 9-16 carries out under the sodion background
Embodiment 9
The DNA that can form G-four serobilas that uses in the present embodiment is AGGGTTAGGGTTAGGGTTAGGG, and employed cyanine dyes is the compound of following formula
Figure BDA00001780268700162
1) preparing standard solution sample and test solution
In the Tris-HCl that contains 20mmol/L NaCl (Tris-Na) damping fluid (pH6.2), preparation concentration is the DNA mother liquor of 500 μ mol/L, and is subsequent use with a certain amount of DNA sample dissolution.
Getting concentration is the methanol solution 300 μ L of 200 μ mol/L cyanine dyes, adds 19.38ml Tris-Na damping fluid, and then adds dna solution 120 μ L mixings.Be divided into 10 parts to above-mentioned sample mean, every this solution of increment is 1.98mL.
Get 7 samples wherein; Adding a certain amount of concentration respectively is the Tris-Na solution of 200mmol/L KCl; Be settled to 2mL with the Tris-Na damping fluid then, the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.2,0.5,1, the master sample solution of 1.5mmol/L.
Add urine specimen 20 μ L to be measured in other 3 samples, urine specimen accounts for 1% of total solution sample.
Above sample is in shady place placement, subsequent use.
2) check and analysis
Utilize the ultra-violet absorption spectrum appearance to analyze in above-mentioned sample.Every operation all carries out under room temperature environment, does not need extra condition.The wavelength that ultra-violet absorption spectrum is collected is in the data at 400～800nm place.
3) interpretation of result
(be designated as A with the absorbance of standard solution sample at the 560nm place 1) be horizontal ordinate, be the ordinate mapping with the potassium concentration of standard solution sample, obtain the typical curve of potassium concentration, as shown in Figure 5.Can on typical curve, find the potassium concentration value of corresponding test solution with the absorbance at the 580nm place of test solution, with its divided by 1% obtain urine sample to be measured the potassium concentration value, the result sees the following form 9.
Table 9
Figure BDA00001780268700171
Embodiment 10
The DNA that can form G-four serobilas that uses in the present embodiment is AGGGTTAGGGTTAGGGTTAGGG, and employed cyanine dyes is the compound of following formula
Figure BDA00001780268700172
1) preparing standard solution sample and test solution
A certain amount of DNA is dissolved in Tris-HCl (Tris-Na) damping fluid (pH8.2) that contains 200mmol/L NaCl, and preparation concentration is the DNA mother liquor of 1.5mmol/L, and is subsequent use.
Getting concentration is the methanol solution 300 μ L of 600 μ mol/L cyanine dyes, adds 19.38ml Tris-Na damping fluid, and then adds dna solution 120 μ L mixings.Be divided into 10 parts to above-mentioned sample mean, every this solution of increment is 1.98mL.
Get 7 samples wherein; Adding a certain amount of concentration respectively is the Tris-Na solution of 200mmol/L KCl; Be settled to 2mL with the Tris-Na damping fluid then, the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.2,0.5,1, the master sample solution of 1.5mmol/L.
Add urine specimen 20 μ L to be measured in other 3 samples, urine specimen accounts for 1% of total solution sample.
Above sample is in shady place placement, subsequent use.
2) check and analysis
Utilize the ultra-violet absorption spectrum appearance to analyze respectively in above-mentioned sample.Every operation all carries out under room temperature environment, does not need extra condition.The wavelength that ultra-violet absorption spectrum is collected is in the data at 400～800nm place.
3) interpretation of result
(be designated as A with the absorbance of master sample at the 650nm place 3) be horizontal ordinate, be the ordinate mapping with the potassium concentration of standard solution sample, obtain the typical curve of potassium concentration, as shown in Figure 6.Can on typical curve, find the potassium concentration value of corresponding test solution with the absorbance at the 650nm place of test solution, with its divided by 1% obtain urine sample to be measured the potassium concentration value, the result sees the following form 10.
Table 10
Figure BDA00001780268700181
Embodiment 11
The DNA that can form G four serobilas that uses in the present embodiment is GGGCCAGGGAGCGGGGCGGAGGGGG, and employed cyanine dyes is the compound of following formula
1) preparing standard solution sample and test solution
A certain amount of DNA is dissolved in Tris-HCl (Tris-Na) damping fluid (pH7.0) that contains 160mmol/L NaCl, and preparation concentration is the DNA mother liquor of 500 μ mol/L, and is subsequent use.
Getting concentration is the methanol solution 300 μ L of 200 μ mol/L cyanine dyes, adds 19.38ml Tris-Na damping fluid, and then adds dna solution 120 μ L mixings.Be divided into 10 parts to above-mentioned sample mean, every this solution of increment is 1.98mL.
Get 7 samples wherein; Adding a certain amount of concentration respectively is the Tris-Na solution of 200mmol/L KCl; Be settled to 2mL with the Tris-Na damping fluid then, the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.2,0.5,1, the master sample solution of 1.5mmol/L.
Add urine specimen 20 μ L to be measured in other 3 samples, urine specimen accounts for 1% of total solution sample.
Above sample is in shady place placement, subsequent use.
2) check and analysis
Utilize the ultra-violet absorption spectrum appearance to analyze in above-mentioned sample.Every operation all carries out under room temperature environment, does not need extra condition.The wavelength that ultra-violet absorption spectrum is collected is in the data at 400～800nm place.
3) interpretation of result
With the absorbance (A of master sample at the 560nm place 1) with the absorbance (A at 670nm place 3) ratio (A 1/ A 3) be horizontal ordinate, be the ordinate mapping with the potassium concentration of standard solution sample, obtain the typical curve of potassium concentration, as shown in Figure 7.Ratio (A with the absorbance at the absorbance at the 560nm place of test solution and 670nm place 1/ A 3) can on typical curve, find the potassium concentration value of corresponding test solution, with its divided by 1% obtain urine sample to be measured the potassium concentration value, the result sees the following form 11.
Table 11
Embodiment 12
The DNA that can form G-four serobilas that uses in the present embodiment is GGGCGCGGGAGGAATTGGGCGGG, and employed cyanine dyes is the compound of following formula
1) preparing standard solution sample and test solution
A certain amount of DNA is dissolved in Tris-HCl (Tris-Na) damping fluid that contains 40mmol/L NaCl, and preparation concentration is the DNA mother liquor of 3mmol/L, and is subsequent use.
Getting concentration is the methanol solution 300 μ L of 1.2mmol/L cyanine dyes, adds 19.38ml Tris-Na damping fluid, and then adds dna solution 120 μ L mixings.Be divided into 10 parts to above-mentioned sample mean, every this solution of increment is 1.98mL.
Get 7 samples wherein; Adding a certain amount of concentration respectively is the Tris-Na solution of 200mmol/L KCl; Be settled to 2mL with the Tris-Na damping fluid then, the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.2,0.5,1, the master sample solution of 1.5mmol/L.
Add urine specimen 20 μ L to be measured in other 3 samples, urine specimen accounts for 1% of total solution sample.
Above sample is in shady place placement, subsequent use.
2) check and analysis
Above-mentioned sample is analyzed with XRF.Every operation all carries out under room temperature environment, does not need extra condition.The fluorescence spectrum excitation wavelength is 560nm, and the wavelength capture range is 570～720nm.
3) interpretation of result
With the fluorescence intensity (be designated as FI) of master sample at the 640nm place is horizontal ordinate, is the ordinate mapping with the potassium concentration of standard solution sample, obtains the typical curve of potassium concentration, as shown in Figure 8.Can on typical curve, find the potassium concentration value of corresponding test solution with the fluorescence intensity at the 640nm place of test solution, with its divided by 1% obtain urine sample to be measured the potassium concentration value, the result sees the following form 12.
Table 12
Figure BDA00001780268700211
Embodiment 13
Adopt and with embodiment 9 identical steps three blood serum samples are detected, difference is that the DNA that uses is GGGCGCGGGAGGAATTGGGCGGG, and the cyanine dyes that uses is the compound of following formula:
Figure BDA00001780268700212
Detect solution sample and test solution in the absorbance at wavelength 590nm place, be designated as A 1
Result such as following table 13:
Table 13
Figure BDA00001780268700213
Embodiment 14
Adopt and with embodiment 10 identical steps three blood serum samples are detected, difference is that the DNA that uses is GGGCGCGGGAGGAAGGGGGCGGG, and the cyanine dyes that uses is the compound of following formula:
Figure BDA00001780268700221
Detect solution sample and test solution in the absorbance at wavelength 670nm place, be designated as A 3
Result such as following table 14:
Table 14
Figure BDA00001780268700222
Embodiment 15
Adopt and with embodiment 11 identical steps three blood serum samples are detected, difference is that the DNA that uses is GGGGTTGGGG, and the cyanine dyes that uses is the compound of following formula:
Detect solution sample and test solution in the absorbance at wavelength 580nm and 610nm place, be designated as A respectively 1And A 3
Result such as following table 15:
Table 15
Figure BDA00001780268700224
Embodiment 16
Adopt and with embodiment 12 identical steps three blood serum samples are detected, difference is that the DNA that uses is TTGGGGTTGGGG, and the cyanine dyes that uses is the compound of following formula:
Figure BDA00001780268700231
Detect solution sample and test solution in the fluorescence intensity at wavelength 600nm place, be designated as FI.
Result such as following table 16:
Table 16
One of striking features of the present invention is: the variation based on potassium ion regulating DNA structure picture realizes detecting; Potassium ion causes that DNA structure picture changes; DNA structure picture changes and to cause the change of cyanine dyes accumulation shape again, thereby makes and change on solution colour or absorption, the fluorescence spectrum.The system composition is simple, reacts also simple, and potassium ion is entire reaction " initiating agent ", has guaranteed the degree of accuracy that detects.
Two of striking features of the present invention is: system itself can have a large amount of sodions, and this situation can guarantee that the variation of the environment that sodion can cause in the sample ignores.
Three of striking features of the present invention is: use cyanine dyes supermolecule probe, reaction sensitivity is high, and change color is arranged, and can realize naked-eye observation.
In a word, experiment proof assay method of the present invention can pass through ultra-violet absorption spectrum appearance or XRF fully, determines the concentration level of potassium ion in the sample, and measurement sensitivity is high, and specificity is good, and degree of accuracy is good.Simultaneously, also can with the naked eye judge the height of potassium concentration level through the variation of solution colour.In addition, potassium ion detection kit provided by the invention, good stability, long storage time still can accurately detect the content of potassium ion in all kinds sample afterwards.
Though described the present invention with the mode of specific embodiment; But be apparent that to those skilled in the art; Under the situation of the spirit and scope of the present invention that do not break away from appended claims and limited; Can carry out variations and modifications to the present invention, these variations and modification comprise within the scope of the invention equally.
Figure IDA00001780269600011
Figure IDA00001780269600021
Figure IDA00001780269600031

Claims (10)

1. the method for potassium concentration in the tracer liquid sample said method comprising the steps of:
(1) with the different a plurality of solution samples of the buffer preparation potassium concentration of pH6.2～8.2, wherein contains the dna molecular that can form G-four serobilas of same concentrations and the cyanine dyes of same concentrations in each said solution sample;
(2) said a plurality of solution samples are placed under ultraviolet-visible absorption spectrometer or the spectrophotometer; Detect the absorbance of first wavelength and the absorbance of second wavelength, perhaps said a plurality of solution samples are placed under the XRF, adopt the excitation wavelength of 560nm; Detect the fluorescence intensity level of wavelength at the three-wavelength place; Wherein said first wavelength is in 560nm to 590nm scope, and said second wavelength is in 500nm to 540nm scope, and said three-wavelength is in 580nm to 640nm scope;
(3) with the potassium concentration of each said solution sample as horizontal ordinate or ordinate; Is ordinate or horizontal ordinate mapping with the absorbance of first wavelength that records in the step (2) or the absorbance of second wavelength or the absorbance of first wavelength with the ratio of the absorbance of second wavelength or the fluorescence intensity level at three-wavelength place, thus the typical curve of acquisition potassium concentration;
(4) adding can form the dna molecular of G-four serobilas, compound and the damping fluid of formula I in the testing liquid sample; So that the compound concentrations of the concentration of the dna molecular that can form G-four serobilas in the testing liquid sample, formula I and pH value are consistent with the solution sample in the step (1), thereby obtain test solution;
(5) test solution that obtains in the step (4) is placed under ultraviolet-visible absorption spectrometer or the spectrophotometer; Detect test solution at first wavelength and the second wavelength absorbance; Perhaps said test solution is placed under the XRF; Adopt the excitation wavelength of 560nm, detect the fluorescence intensity level at three-wavelength place;
(6) utilize the potassium concentration value that finds corresponding test solution in step (3) in the ratio potassium concentration typical curve that perhaps fluorescence intensity level at three-wavelength place obtains of absorbance and the absorbance of second wavelength of absorbance or first wavelength of absorbance or second wavelength of first wavelength that records in the step (5), calculate the potassium concentration of testing sample then through the extension rate of testing sample quilt.
2. method of potassium concentration in the tracer liquid sample under the sodion background said method comprising the steps of:
(1) with the different a plurality of solution sample of the buffer preparation potassium concentration of pH6.2～8.2; Wherein contain the dna molecular that can form G-four serobilas of same concentrations, the sodion of same concentrations and the cyanine dyes of same concentrations in each said solution sample, the Na ion concentration in the wherein said solution sample is in 10 to 200mmol/L scope;
(2) said a plurality of solution samples are placed under ultraviolet-visible absorption spectrometer or the spectrophotometer; Detect the absorbance of said solution sample in first wavelength and the 4th wavelength; Perhaps said a plurality of solution samples are placed under the XRF; Adopt the excitation wavelength of 560nm, detect the fluorescence intensity level of wavelength at the three-wavelength place, wherein said first wavelength is in 560nm to 590nm scope; Said the 4th wavelength is in 610nm to 670nm scope, and said three-wavelength is in 580nm to 640nm scope;
(3) with the potassium concentration of each said solution sample as horizontal ordinate or ordinate; Is ordinate or horizontal ordinate mapping at the absorbance of first wavelength or the absorbance of the 4th wavelength or the absorbance of first wavelength with the ratio of the absorbance of the 4th wavelength or the fluorescence intensity level at three-wavelength place with each solution sample of recording in the step (2), thus the typical curve of acquisition potassium concentration;
(4) adding can form the dna molecular of G-four serobilas, compound and the damping fluid of formula I in the testing liquid sample; So that the compound concentrations of the concentration of the dna molecular that can form G-four serobilas in the testing liquid sample, formula I and pH value are consistent with the solution sample in the step (1), thereby obtain test solution;
(5) test solution that obtains in the step (4) is placed under ultraviolet-visible absorption spectrometer or the spectrophotometer; Detect the absorbance of said test solution in said first wavelength and said the 4th wavelength; Perhaps said test solution is placed under the XRF; Adopt the excitation wavelength of 560nm, detect the fluorescence intensity level of wavelength at said three-wavelength place;
(6) utilize the potassium concentration value that finds corresponding test solution in step (3) in the ratio potassium concentration typical curve that perhaps fluorescence intensity level at three-wavelength place obtains of absorbance and the absorbance of the 4th wavelength of absorbance or first wavelength of absorbance or the 4th wavelength of first wavelength that records in the step (5), calculate the potassium concentration of testing sample then through the extension rate of testing sample quilt.
3. according to claim 1 or claim 2 method, wherein said cyanine dyes is the compound of formula I,
Figure FDA00001780268600021
Wherein: R 1Be C 1-C 6The substituted phenyl of alkyl, phenyl, alkyl; R 2, R 3, R 4And R 5Be independently selected from H or C 1-C 6Alkyl, perhaps R 2And R 3Form 5 yuan to 7 yuan ring structure with the carbon atom that they connected, perhaps R 4And R 5Form 5 yuan to 7 yuan ring structure with the carbon atom that they connected; R 6And R 7Be C 1-C 6The substituted C of alkyl or sulfonic group 1-C 6Alkyl; Y is a gegenion, according to R 6And R 7Institute charged difference and difference are as if R 6And R 7Be alkyl, then Y is a halide anion; If R 6And R 7Have only one to have sulfonate radical, then need not Y as gegenion; If R 6And R 7All have sulfonate radical, then Y is the triethylamine kation; X 1, X 2Be independently selected from C, O, S, Se or Te.
4. method as claimed in claim 3, wherein said C 1-C 6Alkyl be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
5. method as claimed in claim 3, wherein R 1Be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl, isohesyl, phenyl, aminomethyl phenyl or 3,5-dimethylphenyl; R 2, R 3, R 4And R 5Be independently selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
6. method as claimed in claim 3, wherein said 5 yuan is the saturated or unsaturated ring structure that contains or do not contain N or S atom to 7 ring structures.
7. method as claimed in claim 3, wherein Y is selected from fluorine, chlorine, bromine, iodine negative ion or triethylamine kation.
8. the method for claim 1, wherein said damping fluid is selected from tris-HCI buffer, boric acid-borate buffer solution, triethanolamine damping fluid, imidazoles-hydrochloride buffer, glycylglycine damping fluid or 2-amino-2-methyl-1-propanol damping fluid.
9. method as claimed in claim 2, wherein said damping fluid are selected from tris-HCI buffer, boric acid-borate buffer solution, triethanolamine damping fluid, imidazoles-hydrochloride buffer, glycylglycine damping fluid, 2-amino-2-methyl-1-propanol damping fluid, sodium phosphate-dibastic sodium phosphate damping fluid, barbital sodium-hydrochloride buffer, citric acid-sodium citrate damping fluid, glycocoll-sodium hydrate buffer solution, borax-sodium hydrate buffer solution or sodium phosphate buffer.
10. according to claim 1 or claim 2 method, the scope of potassium concentration is preferably in 0 to 200mmol/L scope in the wherein said solution sample; The concentration of said cyanine dyes in the solution sample is in the scope of 3 to 20 μ mol/L; The said scope that can form the concentration of dna molecular in the solution sample of G-four serobilas at 3 to 30 μ mol/L.
CN201210206227.2A 2012-06-18 2012-06-18 Potassium ion concentration detection method Active CN102735664B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201210206227.2A CN102735664B (en) 2012-06-18 2012-06-18 Potassium ion concentration detection method
PCT/CN2013/077335 WO2013189265A1 (en) 2012-06-18 2013-06-17 Method, system, and kit for detecting potassium ion concentration

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210206227.2A CN102735664B (en) 2012-06-18 2012-06-18 Potassium ion concentration detection method

Publications (2)

Publication Number Publication Date
CN102735664A true CN102735664A (en) 2012-10-17
CN102735664B CN102735664B (en) 2014-12-10

Family

ID=46991548

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210206227.2A Active CN102735664B (en) 2012-06-18 2012-06-18 Potassium ion concentration detection method

Country Status (1)

Country Link
CN (1) CN102735664B (en)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103048301A (en) * 2012-12-18 2013-04-17 中国科学院化学研究所 Sodium/ potassium ion ratio detecting method, system and kit
CN103063629A (en) * 2012-12-18 2013-04-24 中国科学院化学研究所 Method for detecting ratio of sodium ions to potassium ions, kit and system
CN103115904A (en) * 2013-01-24 2013-05-22 中国科学院化学研究所 Detection method, system and kit of microalbuminuria
WO2013189265A1 (en) * 2012-06-18 2013-12-27 中国科学院化学研究所 Method, system, and kit for detecting potassium ion concentration
CN103645148A (en) * 2013-11-28 2014-03-19 中山鼎晟生物科技有限公司 Method and reagent for detecting nutrition ingredient in food
CN104458728A (en) * 2014-12-08 2015-03-25 中国科学院化学研究所 Method for detecting concentration of sodium ions
CN104596959A (en) * 2015-01-22 2015-05-06 中国科学院化学研究所 Method for detecting potassium ion concentration based on DNA enzymes
CN105651751A (en) * 2016-01-29 2016-06-08 南京大学 Method for detecting physiologically-active small molecules in organisms based on nucleic acid technology
CN107229975A (en) * 2017-05-31 2017-10-03 四川大学 The Molecular Logic Gates construction method interacted based on cyanine dyes and metal ion
CN107314976A (en) * 2017-05-26 2017-11-03 中国科学院化学研究所 Purposes and application of the composition in detection potassium concentration
CN107632158A (en) * 2016-07-18 2018-01-26 中国科学院化学研究所 The method and kit of cysteine in determination sample
CN109799126A (en) * 2014-07-25 2019-05-24 立佳有限公司 Dilute the analysis method of biological specimen ingredient
CN110186892A (en) * 2019-06-26 2019-08-30 苏州健雄职业技术学院 A kind of glutamine detection method based on dual-enzyme coupling

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6001657A (en) * 1995-10-12 1999-12-14 North Carolina State University Antibodies that selectively bind quadruplex nucleic acids
CN101587066A (en) * 2008-05-23 2009-11-25 中国科学院化学研究所 The new purposes of cyanine dyes in detecting G-four serobila structural DNAs
US20100009362A1 (en) * 2005-04-22 2010-01-14 The Hong Kong University Of Science And Technology Fluorescent water-soluable conjugated polyene compounds that exhibit aggregation induced emission and methods of making and using same
CN102253017A (en) * 2011-04-07 2011-11-23 鲁东大学 Fluorescence detection method for potassium ions
CN102417925A (en) * 2011-09-07 2012-04-18 天津希恩思生化科技有限公司 Reagent for detecting content of potassium ions in blood and preparation method thereof as well as kit containing same

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6001657A (en) * 1995-10-12 1999-12-14 North Carolina State University Antibodies that selectively bind quadruplex nucleic acids
US20100009362A1 (en) * 2005-04-22 2010-01-14 The Hong Kong University Of Science And Technology Fluorescent water-soluable conjugated polyene compounds that exhibit aggregation induced emission and methods of making and using same
CN101587066A (en) * 2008-05-23 2009-11-25 中国科学院化学研究所 The new purposes of cyanine dyes in detecting G-four serobila structural DNAs
CN102253017A (en) * 2011-04-07 2011-11-23 鲁东大学 Fluorescence detection method for potassium ions
CN102417925A (en) * 2011-09-07 2012-04-18 天津希恩思生化科技有限公司 Reagent for detecting content of potassium ions in blood and preparation method thereof as well as kit containing same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HAIXIA QIN ETAL: "G-Quadruplex-Modulated Fluorescence Detection of Potassium in the Presence of a 3500-Fold Excess of Sodium Ions", 《ANAL. CHEM.》 *
杨千帆 等: "识别人体端粒DNA G-四链体的染料结构设计及光谱研究", 《光谱学与光谱分析》 *

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013189265A1 (en) * 2012-06-18 2013-12-27 中国科学院化学研究所 Method, system, and kit for detecting potassium ion concentration
CN103063629A (en) * 2012-12-18 2013-04-24 中国科学院化学研究所 Method for detecting ratio of sodium ions to potassium ions, kit and system
CN103048301B (en) * 2012-12-18 2015-12-23 中国科学院化学研究所 Sodium/potassium ion is than detection method, system and kit
CN103048301A (en) * 2012-12-18 2013-04-17 中国科学院化学研究所 Sodium/ potassium ion ratio detecting method, system and kit
CN103115904A (en) * 2013-01-24 2013-05-22 中国科学院化学研究所 Detection method, system and kit of microalbuminuria
CN103115904B (en) * 2013-01-24 2016-12-28 中国科学院化学研究所 Urine microalbumin detection method, system and test kit
CN103645148A (en) * 2013-11-28 2014-03-19 中山鼎晟生物科技有限公司 Method and reagent for detecting nutrition ingredient in food
CN109799126A (en) * 2014-07-25 2019-05-24 立佳有限公司 Dilute the analysis method of biological specimen ingredient
CN104458728A (en) * 2014-12-08 2015-03-25 中国科学院化学研究所 Method for detecting concentration of sodium ions
CN104596959A (en) * 2015-01-22 2015-05-06 中国科学院化学研究所 Method for detecting potassium ion concentration based on DNA enzymes
CN105651751A (en) * 2016-01-29 2016-06-08 南京大学 Method for detecting physiologically-active small molecules in organisms based on nucleic acid technology
CN107632158A (en) * 2016-07-18 2018-01-26 中国科学院化学研究所 The method and kit of cysteine in determination sample
CN107314976A (en) * 2017-05-26 2017-11-03 中国科学院化学研究所 Purposes and application of the composition in detection potassium concentration
CN107229975A (en) * 2017-05-31 2017-10-03 四川大学 The Molecular Logic Gates construction method interacted based on cyanine dyes and metal ion
CN107229975B (en) * 2017-05-31 2020-04-07 四川大学 Molecular logic gate construction method based on interaction of cyanine dye and metal ions
CN110186892A (en) * 2019-06-26 2019-08-30 苏州健雄职业技术学院 A kind of glutamine detection method based on dual-enzyme coupling

Also Published As

Publication number Publication date
CN102735664B (en) 2014-12-10

Similar Documents

Publication Publication Date Title
CN102735664B (en) Potassium ion concentration detection method
CN102735623B (en) Potassium ion concentration detection kit and system thereof
CN102866148B (en) Potassium ion concentration detection method
Zhou et al. Design principles of spectroscopic probes for biological applications
CN104596959A (en) Method for detecting potassium ion concentration based on DNA enzymes
CN103048301B (en) Sodium/potassium ion is than detection method, system and kit
CN102866149B (en) Detection kit for potassium ion concentration
CN103063629B (en) Detect the method for sodium/potassium ion ratio and kit and system
WO2013189265A1 (en) Method, system, and kit for detecting potassium ion concentration
CN104865232A (en) Method for selectively detecting ascorbic acid by utilizing metal-organic framework material
CN105784699A (en) Potassium ion reagent with better stability and higher sensitivity and detection method
CN103091316A (en) Urine microalbumin detection method and kit
CN110398586B (en) Fructosamine assay kit
CN103115904B (en) Urine microalbumin detection method, system and test kit
CN104458728A (en) Method for detecting concentration of sodium ions
CN101169431A (en) Potassium diagnosis/determination reagent kit and potassium concentration determination method
CN109374618A (en) A kind of detection method of nitrite anions
CN101169427A (en) Potassium diagnosis/determination reagent kit and potassium concentration determination method
CN101464407A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101464405A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101464404A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101464397A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101464403A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101464301A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101464302A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant