CN103063629B - Detect the method for sodium/potassium ion ratio and kit and system - Google Patents

Detect the method for sodium/potassium ion ratio and kit and system Download PDF

Info

Publication number
CN103063629B
CN103063629B CN201210553125.8A CN201210553125A CN103063629B CN 103063629 B CN103063629 B CN 103063629B CN 201210553125 A CN201210553125 A CN 201210553125A CN 103063629 B CN103063629 B CN 103063629B
Authority
CN
China
Prior art keywords
sodium
potassium ion
solution
potassium
sample
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201210553125.8A
Other languages
Chinese (zh)
Other versions
CN103063629A (en
Inventor
孙红霞
唐亚林
向俊锋
杨千帆
管爱娇
刘岩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Chemistry of CAS
Original Assignee
Institute of Chemistry of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Chemistry of CAS filed Critical Institute of Chemistry of CAS
Priority to CN201210553125.8A priority Critical patent/CN103063629B/en
Publication of CN103063629A publication Critical patent/CN103063629A/en
Application granted granted Critical
Publication of CN103063629B publication Critical patent/CN103063629B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C09DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09BORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
    • C09B23/00Methine or polymethine dyes, e.g. cyanine dyes
    • C09B23/02Methine or polymethine dyes, e.g. cyanine dyes the polymethine chain containing an odd number of >CH- or >C[alkyl]- groups
    • C09B23/06Methine or polymethine dyes, e.g. cyanine dyes the polymethine chain containing an odd number of >CH- or >C[alkyl]- groups three >CH- groups, e.g. carbocyanines
    • CCHEMISTRY; METALLURGY
    • C09DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09BORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
    • C09B23/00Methine or polymethine dyes, e.g. cyanine dyes
    • C09B23/0008Methine or polymethine dyes, e.g. cyanine dyes substituted on the polymethine chain
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64Fluorescence; Phosphorescence
    • G01N21/6428Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"

Abstract

The present invention relates to the method for detection sodium/potassium ion ratio and kit and system.The present invention relates to the method detecting sodium/potassium ion mol ratio in solution, comprise: (1) preparation sodium/potassium ion, than different multiple solution samples, wherein contains the cyanine dyes of same concentrations and can form the DNA molecular of different G-tetra-stranded structure at sodium, potassium ion under existing respectively in each described solution sample; (2) fluorescence intensity level gathering wavelength place is detected; (3) using the sodium of solution sample described in each/potassium ratio as horizontal ordinate or ordinate, be ordinate or horizontal ordinate mapping with the fluorescence intensity level at the collection wavelength place recorded in step (2), thus obtain the typical curve of sodium potassium ion ratio; (4) in testing liquid sample, described DNA molecular is added, and adjust ph, thus obtain test solution; (5) determined wavelength is at the fluorescence intensity level at described collection wavelength place; (6) in sodium/potassium ion is than typical curve, find the sodium/potassium ratio of corresponding test solution.

Description

Detect the method for sodium/potassium ion ratio and kit and system
Technical field
The invention belongs to biomedicine field, in particular to a kind of sodium/potassium ion than detection method and kit and system.
Background technology
Sodium in human body, potassium are the dominant cation maintaining cellular physiological events, are the normal osmotic pressure and the acid base equilibrium that keep body, involved in sugar and protein metabolism, and ensure that nervimuscular normal function institute is required, its content is the important indicator of human physiological activity.The contents level of urine, Sodium in Serum, potassium ion can be used for the disease diagnosing some aspects such as kidney, heart clinically.
Sodium Potassium Level in human body is in an equilibrium state, and the change of its ratio is to health important.For healthy, the absolute figure that the ratio of monitoring sodium/potassium may be more independent than the two is more important.Clinically, by detecting saliva sodium/potassium ratio, diagnosable aldosteronism.In addition, American scholar is recently studied and is confirmed that the predictive value of twenty-four-hour urine sodium/potassium comparison risk of cardiovascular diseases is significantly better than simple urine sodium or urine potassium detects.As can be seen here, the monitoring of sodium/potassium ratio is to angiocardiopathy preventing tool significance.
Measure sodium in prior art, the method for potassium concentration mainly contains: neutron activation method, isotope dilution mass spectrometry, chemical assay, flame photometry, ion selective electrode method, enzyme kinetics method, atom spectrophotometric method etc.At present, the method often used clinically is flame photometry and ion selective electrode method.
(1) flame photometry: flame photometry is a kind of emission spectrometry method, the spectral intensity utilizing excited atom in flame to return to launch when being down to ground state carries out content analysis, can detect the Na of serum, urine, cerebrospinal fluid and Pleural effusions +and K +, the method belongs to classical canonical reference method, advantage be result accurately and reliably, widely clinical employing.
The quantivative approach of usual employing has external standard method and internal reference method.External standard method general operation error is comparatively large, seldom adopts.Internal standard method is that sample and titer adopt the internal standard element adding same concentrations to measure, generally add mark in lithium, what measure is the ratio of lithium/sodium or potassium current, instead of the electric current of independent sodium or potassium, like this, the error that the factor such as combustion gas and flame temperature fluctuation causes can be reduced, thus have good accuracy.
(2) ion selective electrode method (ISE method): in potassium, the sodion mensuration of the cleer and peaceful urine of the enterprising promoting circulation of blood of instrumentation.Because of it, to have sample consumption few, and quick and precisely, the advantage such as easy and simple to handle, is the easiest method accurately in current all methods, almost has the trend replacing additive method.Its principle is: ion-selective electrode is a kind of electrochemical sensor, one is had to have the Sensitive membrane electrode of selective response to specific ion in its structure, convert ion activity to electric potential signal, within the specific limits, in its current potential and solution, the logarithm of specific ion activity is linear, by comparing with the solution of known ion concentration the ion activity can trying to achieve unknown solution, direct measuring method and Indirect Determination is divided into again by its mensuration process, current major part adopts Indirect Determination, because Indirect Determination measures after sample to be tested dilution, institute's measured ion activity is closer to ion concentration.
Type of electrodes main at present has: glass-membrane electrode, and inductive material is glass-film; Solid phase electrode, shaping by insoluble metal pressurize substance; Liquid film electrode, using epoxy resin or in-built Polyvinylchloride as sense film; The K+ electrode that valinomycins film is made.These electrodes all have certain life-span, and use after asking when one section, electrode can be aging, and expensive.
(3) chemical assay: Na at present +, K +chemical assay mainly utilize multiple ring crown compound as cave crown ether or spherical crown ether, also crown ether is called, be ionophore to measure, owing to having hole in macrocyclic structure, intramolecule oxygen atom has non-share electron pair can be combined with metallic ion, according to hole size, alternative in conjunction with the metallic ion of different-diameter, thus can reach the object measuring ion concentration.
(4) enzyme process: the principle of enzymatic assays potassium is the beta galactosidase catalysis artificial substrates ONPG(ortho-nitrophenol β-D-galactopyranoside utilizing sodium to rely on); Decompose and discharge color products ortho-nitrophenol, survey absorbance change at wavelength 420nm place.The principle that enzyme process surveys potassium utilizes the activation to pyruvate kinase, and the latter's catalytic phosphatase enol pyruvic acid becomes lactic acid simultaneously with the consumption of reduced coenzyme Ⅰ, and the absorbance surveying NADH at wavelength 340nm place declines.The advantage of enzyme process does not need specific apparatus, and shortcoming is that price is more expensive.
(5) atom spectrophotometric method also can be used for detecting potassium, sodion in serum, but complicated operation, error is comparatively large, easy not as good as flame photometry.
These methods existing are all measure sodium, potassium concentration respectively, then on the numerical value basis of measuring, calculate sodium/potassium ion ratio.Up to the present, the method for sodium/potassium ion ratio is not still directly measured.
Summary of the invention
Object of the present invention: provide one to utilize cyanine dyes supermolecule and G-quadruplex (the G-tetra-serobila) system that acts on to detect the new method of sodium/potassium ion ratio, and the sodium/potassium applying the method formulated compares detection kit.Utilize the reagent in this kit, can utilize sodium/potassium ion ratio in fluorescence spectrum instrument quantitative test liquid, measure process not by the impact of other elements, degree of accuracy is high.Meanwhile, because this reagent sensitivity is very high, to different sodium/potassium ion than the change shown in color, naked eyes are visible, can realize Visual retrieval.
General technical route of the present invention is: the formation or the conformation transition that regulate and control G-tetra-stranded structure by adding sodium/potassium ion, the thereupon change of cyanine dyes identification G-tetra-stranded structure, thus reflects sodium/potassium ratio level.Be specially: under the environment of low sodium/potassium ratio, DNA sequence dna forms antiparallel configuration G-tetra-serobila, with sodium/potassium than reducing the then occurred conformation transformation of antiparallel G-tetra-serobila, along with G-tetra-serobila conformation transition, the accumulation shape of cyanine dyes changes, thus changes in color, reach naked-eye observation, simultaneously on fluorescence spectrum, significantly change also occurs, the intensity of variation of fluorescence intensity is directly proportional to sodium/potassium ratio, thus realizes quantitative response sodium/potassium and compare level.
A first aspect of the present invention provides the method for sodium in a kind of tracer liquid sample/potassium ratio, said method comprising the steps of:
(1) use the buffer solution of pH6.2 ~ 8.2 and soluble sodium salt and sylvite to prepare sodium/potassium ion than different multiple solution samples, what wherein contain same concentrations in each described solution sample can form the different DNA molecular of G-tetra-stranded structure and the cyanine dyes of same concentrations at sodium, potassium ion under existing respectively;
(2) under described multiple solution sample being placed in fluorescence spectrophotometer, adopt the excitation wavelength of 540nm to 570nm, detect in the fluorescence intensity gathering wavelength place;
(3) using the sodium of solution sample described in each/potassium ratio as horizontal ordinate or ordinate, be ordinate or horizontal ordinate mapping with what record in step (2) at the fluorescence intensity level gathering wavelength place, thus obtain the typical curve of sodium/potassium ratio;
(4) in testing liquid sample, described DNA molecular and cyanine dyes is added, and adjust ph, to make the concentration of DNA molecular described in testing liquid sample, the concentration of cyanine dyes and pH value consistent with the solution sample in step (1), thus obtain test solution;
(5), under the test solution obtained in step (4) being placed in fluorescence spectrophotometer, adopt the excitation wavelength identical with step (2), determined wavelength is in the fluorescence intensity at described collection wavelength place;
(6) sodium/potassium utilizing the fluorescence intensity level recorded in step (5) to obtain in step (3) is than the sodium/potassium ratio finding corresponding test solution in typical curve;
Wherein said collection wavelength is in 570nm to 700nm scope.
Method of the present invention can be advantageously used in the sodium/potassium ratio detected in various solution example, such as, can detect the sodium/potassium ratio in human or animal's blood, urine, saliva, cell or other body fluid.
Method according to a first aspect of the present invention, wherein said damping fluid is selected from trishydroxymethylaminomethane-hydrochloric acid (Tris-HCl) damping fluid, boric acid-borate buffer solution, Triethanolamine buffer, imidazoles-hydrochloride buffer, glycylglycine buffer, 2-amino-2-methyl-1-propanol damping fluid.
Method according to a first aspect of the present invention, the wherein said DNA molecular that can form different G-tetra-stranded structure under sodium, potassium ion existence is respectively the DNA molecular of the structure containing following formula I in molecular sequences:
GGYGGZGGMGG
Formula I
Wherein: the G in formula I represents guanine, Y, Z, M represent one or more any base respectively, and G represents guanine base.
Method according to a first aspect of the present invention, wherein said cyanine dyes is the compound of Formula Il:
Formula II
Wherein: R 1for C 1-C 6alkyl, phenyl, alkyl replace phenyl; R 2, R 3, R 4and R 5independently selected from H or C 1-C 6alkyl, or R 2and R 3the ring structure of 5 yuan to 7 yuan is formed together with the carbon atom that they connect, or R 4and R 5the ring structure of 5 yuan to 7 yuan is formed together with the carbon atom that they connect; R 6and R 7for C 1-C 6the C that alkyl or sulfonic group replace 1-C 6alkyl; Y is gegenion, according to R 6and R 7institute's charged difference and different, if R 6and R 7for alkyl, then Y is halide anion; If R 6and R 7only have one with sulfonate radical, then without the need to Y as gegenion; If R 6and R 7all with sulfonate radical, then Y is triethylamine kation; X 1, X 2independently selected from carbon (C), oxygen (O), sulphur (S), selenium (Se) or tellurium (Te).
Method according to a first aspect of the present invention, wherein C 1-C 6the alkyl of alkyl to be carbon number the be straight or branched of 1-6, include but not limited to, methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl etc.
Method according to a first aspect of the present invention, wherein R 1be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl, isohesyl, phenyl, aminomethyl phenyl or 3,5-dimethylphenyl.
Method according to a first aspect of the present invention, wherein R 2, R 3, R 4and R 5independently selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
Method according to a first aspect of the present invention, wherein R 2and R 3the carbon atom be connected with them can form the saturated rings structure of 5 yuan to 7 yuan or unsaturated ring structure, and described ring structure can contain or not contain nitrogen (N) or sulphur (S) atom.
Method according to a first aspect of the present invention, wherein R 4and R 5the carbon atom be connected with them can form the saturated or unsaturated ring structure of 5 yuan to 7 yuan, and described ring structure can contain or not contain N or S atom.
Method according to a first aspect of the present invention, wherein Y is preferably fluorine, chlorine, bromine, iodine negative ion or triethylamine kation.
Method according to a first aspect of the present invention, wherein can by using soluble sodium, sylvite is as potassium chloride, sodium chloride, potassium sulfate, sodium sulphate, potassium nitrate, sodium nitrate etc. prepare described multiple solution sample, sodium in each solution sample/potassium ion is than the scope preferably 0 to 20, further preferred 0 to 10 scope, further preferred 1 to 8 scope, most preferably 2 to 6 scope, wherein said soluble sodium, the non-limiting example of sylvite comprises, potassium chloride, potassium bromide, potassium iodide, potassium sulfate, potassium nitrate, sodium chloride, sodium bromide, sodium iodide, sodium sulphate or sodium nitrate etc.
Method according to a first aspect of the present invention, the concentration of wherein said cyanine dyes in solution sample is in the scope of 1 to 30 μm of ol/L, preferably at 2 to 10 μm of ol/L, the concentration of the described DNA molecular that can form different G-tetra-stranded structure respectively under existing at sodium, potassium ion in solution sample is in the scope of 0.5 to 30 μm of ol/L, preferably at 1 to 20 μm of ol/L, preferred at 2 to 10mol/L further.
Method according to a first aspect of the present invention, the wherein said DNA molecular that can form different G-tetra-stranded structure under the existence of sodium, potassium ion is respectively the DNA molecular being rich in guanine in molecular sequences, and has the DNA molecular of " GG " structure in preferred molecular sequences.The non-limiting example of this kind of DNA molecular comprises, as DNA moleculars such as TTAGGGTTAGGGTTAGGGTTAGGG, AGGGTTAGGGTTAGGGTTAGGG, TTGGGTTAGGGTTAGGGTTAGGGA, TGAGGGTGGGGAGGGTGGGGAA, AGGGAGGGCGCTGGGAGGAGGG, GGGCGCGGGAGGAATTGGGCGGG, GGTTGGTGTGGTTGG, TTGGGGTTGGGGTTGGGGTTGGGG, GGGCGCGGGAGGAAGGGGGCGGG or GGGCGCGGGAGGAATTGGGCGGG, but the DNA sequence dna scope that can form G-tetra-serobila is not enumerated by these and limited.In addition, particular restriction is not had for the length that can form the DNA molecular of different G-tetra-stranded structure under sodium, potassium ion existence respectively used in the present invention, but the preferably length of 6 ~ 300 bases, the more preferably length of 10 ~ 100 bases, the most preferably length of 10 ~ 30 bases.The occurred conformation change for the sodium in solution/potassium ion ratio specifically due to these DNA sequence dnas, thus method of the present invention directly can obtain sodium in solution/potassium ion ratio.
In addition, in method of the present invention, when preparation standard curve, the number of obtain solution sample does not have special restriction, but the number of solution sample can not be less than 2, and solution sample is more, the degree of accuracy of typical curve is higher, prepare 3 to 20 solution samples under normal circumstances, also can prepare more solution sample, such as more than 50, those skilled in the art can carry out suitable selection as required.
A second aspect of the present invention provides a kind of kit and the system of implementing the inventive method, and described kit comprises: the damping fluid of pH6.2 ~ 8.2, soluble sodium salt, sylvite, can form DNA molecular and the cyanine dyes of different G-tetra-stranded structure under existing respectively at sodium, potassium ion; Described system comprises described kit and fluorescence spectrophotometer.
Kit described according to a second aspect of the present invention and system, wherein said damping fluid is selected from trishydroxymethylaminomethane-hydrochloric acid (Tris-HCl) damping fluid, boric acid-borate buffer solution, Triethanolamine buffer, imidazoles-hydrochloride buffer, glycylglycine buffer, 2-amino-2-methyl-1-propanol damping fluid.
Kit described according to a second aspect of the present invention and system, the non-limiting example of wherein said soluble potassium salt comprises potassium chloride, potassium bromide, potassium iodide, potassium sulfate and potassium nitrate.The non-limiting example of described soluble sodium salt comprises sodium chloride, sodium bromide, sodium iodide, sodium sulphate and sodium nitrate.
Kit described according to a second aspect of the present invention and system, the wherein said DNA molecular that can form different G-tetra-stranded structure under the existence of sodium, potassium ion is respectively the DNA molecular of the structure containing following formula I in molecular sequences:
GGYGGZGGMGG
Formula I
Wherein: the G in formula I represents guanine, Y, Z, M represent one or more any base respectively.
Kit described according to a second aspect of the present invention and system, the wherein said non-limiting example that can form the sequence of the DNA molecular of G tetra-serobila comprises TTAGGGTTAGGGTTAGGGTTAGGG, AGGGTTAGGGTTAGGGTTAGGG, TTGGGTTAGGGTTAGGGTTAGGGA, TGAGGGTGGGGAGGGTGGGGAA, AGGGAGGGCGCTGGGAGGAGGG, GGGCGCGGGAGGAATTGGGCGGG, GGTTGGTGTGGTTGG, TTGGGGTTGGGGTTGGGGTTGGGG, GGGCGCGGGAGGAAGGGGGCGGG and GGGCGCGGGAGGAATTGGGCGGG etc.But the DNA sequence dna scope that can form G-tetra-serobila is not enumerated by these and limited.In addition, particular restriction is not had for the length that can form the DNA molecular of different G-tetra-stranded structure under sodium, potassium ion existence respectively used in the present invention, but the preferably length of 6 ~ 300 bases, the more preferably length of 10 ~ 100 bases, the most preferably length of 10 ~ 30 bases.The occurred conformation change for the sodium in solution/potassium ion ratio specifically due to these DNA sequence dnas, thus use kit of the present invention and system directly can obtain sodium in solution/potassium ion ratio.
Kit described according to a second aspect of the present invention and system, wherein said cyanine dyes is the compound of Formula Il:
Formula II
Wherein: R 1for C 1-C 6alkyl, phenyl, alkyl replace phenyl; R 2, R 3, R 4and R 5independently selected from H or C 1-C 6alkyl, or R 2and R 3the ring structure of 5 yuan to 7 yuan is formed together with the carbon atom that they connect, or R 4and R 5the ring structure of 5 yuan to 7 yuan is formed together with the carbon atom that they connect; R 6and R 7for C 1-C 6the C that alkyl or sulfonic group replace 1-C 6alkyl; Y is gegenion, according to R 6and R 7institute's charged difference and different, if R 6and R 7for alkyl, then Y is halide anion; If R 6and R 7only have one with sulfonate radical, then without the need to Y as gegenion; If R 6and R 7all with sulfonate radical, then Y is triethylamine kation; X 1, X 2independently selected from carbon (C), oxygen (O), sulphur (S), selenium (Se) or tellurium (Te).
Kit according to a second aspect of the present invention and system, wherein C 1-C 6the alkyl of alkyl to be carbon number the be straight or branched of 1-6, include but not limited to, methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl etc.
Kit according to a second aspect of the present invention and system, wherein R 1be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl, isohesyl, phenyl, aminomethyl phenyl or 3,5-dimethylphenyl.
Kit according to a second aspect of the present invention and system, wherein R 2, R 3, R 4and R 5independently selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
Kit according to a second aspect of the present invention and system, wherein R 2and R 3the carbon atom be connected with them can form the saturated rings structure of 5 yuan to 7 yuan or unsaturated ring structure, and described ring structure can contain or not contain nitrogen (N) or sulphur (S) atom.
Kit according to a second aspect of the present invention and system, wherein R 4and R 5the carbon atom be connected with them can form the saturated or unsaturated ring structure of 5 yuan to 7 yuan, and described ring structure can contain or not contain N or S atom.
Kit according to a second aspect of the present invention and system, wherein Y is preferably fluorine, chlorine, bromine, iodine negative ion or triethylamine kation.
Sodium/potassium ion described is herein than the mol ratio referring to sodium ion in liquor and potassium ion.
The major advantage of method of the present invention and kit and system is:
1) the present invention utilizes G-tetra-stranded structure that cyanine dyes supramolecular aggregation specific recognition sodium potassium ion regulates and controls, and can operate and unaffected under physiological environment, high to sodium potassium ion specificity;
2) the present invention uses cyanine dyes supermolecular probe, very responsive to the G-tetra-stranded structure change of sodium potassium ion regulation and control, with the change of accumulation shape, in ultra-violet absorption spectrum, show the displacement of absorption band up to nearly hundred nanometers simultaneously, thus produce the change in color, can visual detection be realized;
3) cyanine dyes supermolecule used in the present invention, can produce marked change at fluorescence spectrum, and utilize common fluorescence spectrophotometer all can realize quantitative detection, do not need special or additional instruments, testing cost is cheap, is convenient to apply in industry;
4) agents useful for same composition of the present invention only has 3 ~ 4 kinds, only need mix in proportion, detects with regard to available instrumentation, simple to operate, quick and with low cost, and this system operates in buffered environment, does not pollute the environment.
5) agents useful for same composition of the present invention is simple, kind is few, can not have an impact each other, and good stability, can long-time storage, can ensure application testing effect very well;
6) reagent that detection method provided by the invention can make the various ways such as liquid reagent, powdered reagent, dry reagent is applied, can be used to measure sodium/potassium ion in human body and other animal body, than level, also can be used to the sodium/potassium ion detected in other samples such as water quality or soil and compare level.
7) apply detection method provided by the invention, according to the characteristic of cyanine dyes aggregation color change, the form of test paper can be developed to, make detection more simple, convenient.
Accompanying drawing explanation
Fig. 1 compares typical curve according to the sodium/potassium ion of the embodiment of the present invention 1;
Fig. 2 compares typical curve according to the sodium/potassium ion of the embodiment of the present invention 2;
Fig. 3 compares typical curve according to the sodium/potassium ion of the embodiment of the present invention 3;
Fig. 4 compares typical curve according to the sodium/potassium ion of the embodiment of the present invention 4;
Fig. 5 compares typical curve according to the sodium/potassium ion of the embodiment of the present invention 5;
Fig. 6 compares typical curve according to the sodium/potassium ion of the embodiment of the present invention 6;
Fig. 7 compares typical curve according to the sodium/potassium ion of the embodiment of the present invention 7;
Fig. 8 compares typical curve according to the sodium/potassium ion of the embodiment of the present invention 8.
Embodiment
In more detail the present invention is described in the mode of specific embodiment below with reference to accompanying drawings, but be to be understood that, the present invention can implement in a different manner, these embodiments are provided to be only to make this instructions fully with complete, to enable those skilled in the art implement the present invention, the specific embodiment listed by scope of the present invention should not be defined as herein.
Embodiment 1
The DNA that can form different G-tetra-stranded structure under sodium, potassium ion existence respectively used in the present embodiment is AGGGTTAGGGTTAGGGTTAGGG, the compound that the cyanine dyes used is following formula
1) preparation standard solution sample and test solution
Be dissolved in by a certain amount of DNA in the Tris-HCl damping fluid of pH value 7.2, preparation concentration is 100 μm of ol/LDNA mother liquors, for subsequent use.
Get the methanol solution 200 μ L that concentration is 200 μm of ol/L cyanine dyes, add 1.5mlTris-HCl damping fluid, and then add DNA mother liquor 250 μ L and mix, obtain the mixed solution of DNA and cyanine dyes.
Get each 150 μ L of mixed solution of 13 parts of above-mentioned DNA and cyanine dyes, sodium/potassium ion the ratio adding 350 μ L in 10 parts of DNA solutions wherein is respectively respectively 1(40mmol/40mmol), 2(50mmol/25mmol), 3(300mmol/100mmol), 4(40mmol/10mmol), 5(100mmol/20mmol), 6(90mmol/15mmol), 7(140mmol/20mmol), 8(400mmol/50mmol), 9(270mmol/30mmol), solution 10(400mmol/40mmol) obtains 10 standard solution samples, 350 μ L aqueous liquid sample to be measured is added in the mixed solution of other 3 parts of DNA and cyanine dyes, obtain test solution.
Above sample in shady place place, for subsequent use.
2) analysis is detected
Above-mentioned sample is utilized fluorescence spectrophotometer analysis respectively.Every operation all carries out under room temperature environment, does not need extra condition.Fluorescence spectrophotometer adopts the excitation wavelength of 540nm, collects the data of wavelength at 570 ~ 700nm place.
3) interpretation of result
With the sodium of standard solution sample/potassium ion than for horizontal ordinate, with the fluorescence intensity level at 598nm place of master sample for ordinate is figure, obtain the typical curve of sodium/potassium ion ratio, as shown in Figure 1.Sodium/potassium ion the ratio of corresponding test solution can be found on typical curve to the results are shown in following table 1 with the fluorescence intensity level at 598nm place of test solution.
Table 1
Embodiment 2
The DNA that can form different G-tetra-stranded structure under sodium, potassium ion existence respectively used in the present embodiment is TGAGGGTGGGGAGGGTGGGGAA, the compound that the cyanine dyes used is following formula
1) preparation standard solution sample and test solution
Be dissolved in by a certain amount of DNA in the boric acid-borate buffer solution of pH value 8.2, preparation concentration is 200 μm of ol/LDNA mother liquors, for subsequent use.
Get the methanol solution 300 μ L that concentration is 600 μm of ol/L cyanine dyes, add 9.1ml boric acid-borate buffer solution, and then add DNA solution 300 μ L and mix.Above-mentioned sample mean is divided into 10 parts, and every part of sample solution is 0.9mL.
Get 6 samples wherein, sodium/potassium ion the ratio adding 0.1mL is respectively respectively 1(100mmol/100mmol), 2(40mmol/20mmol), 4(160mmol/40mmol), 6(300mmol/50mmol), 8(80mmol/10mmol), 10(150mmol/15mmol) solution sample, obtain 6 standard solution samples.
Add saliva sample 0.1mL to be measured in other 4 samples, obtain 4 test solutions.
2) analysis is detected
Above-mentioned sample is utilized fluorescence spectrophotometer analysis respectively.Every operation all carries out under room temperature environment, does not need extra condition.Excitation wavelength is 570nm, the data of wavelength at 580 ~ 700nm place that fluorescence spectrum is collected.
3) interpretation of result
With master sample sodium/potassium ion than for horizontal ordinate, with the fluorescence intensity level at 600nm place of master sample for ordinate is figure, obtain the typical curve of sodium/potassium ion ratio, as shown in Figure 2.Sodium/potassium ion the ratio of corresponding test solution can be found on typical curve with the fluorescence intensity level at 600nm place of test solution.The results are shown in following table 2.
Table 2
Embodiment 3
The DNA that can form different G-tetra-stranded structure under sodium, potassium ion existence respectively used in the present embodiment is GGGCCAGGGAGCGGGGCGGAGGGGG, the compound that the cyanine dyes used is following formula
1) preparation standard solution sample and test solution
Be dissolved in by a certain amount of DNA in the Tris-HCl damping fluid of pH value 7.2, preparation concentration is 600 μm of ol/LDNA mother liquors, for subsequent use.
Get the methanol solution 300 μ L that concentration is 1.2mmol/L cyanine dyes, add 19.2mlTris-HCl damping fluid, and then add DNA solution 300 μ L and mix.Above-mentioned sample mean is divided into 10 parts, and every part of sample solution is 1.98mL.
Get 6 samples wherein, the sodium/potassium ion ratio adding 1mL is respectively respectively 1(50mmol/50mmol), 2(40mmol/20mmol), 4(40mmol/10mmol), 6(240mmol/40mmol), 8(400mmol/50mmol), 10(100mmol/10mmol) solution sample.
Add urine specimen 20 μ L to be measured in other 4 samples, obtain 4 test solutions.
Above sample in shady place place, for subsequent use.
2) analysis is detected
Above-mentioned sample is utilized fluorescence spectrophotometer analysis respectively.Every operation all carries out under room temperature environment, does not need extra condition.Excitation wavelength is 560nm, the data of wavelength at 580 ~ 700nm place that fluorescence spectrum is collected.
3) interpretation of result
With master sample sodium/potassium ion than for horizontal ordinate, with the fluorescence intensity level at 598nm place of master sample for ordinate is figure, obtain the typical curve of sodium/potassium ion ratio, as shown in Figure 3.Sodium/potassium ion the ratio of corresponding test solution can be found with the fluorescence intensity level at 598nm place of test solution on typical curve, the results are shown in following table 3.
Table 3
Embodiment 4
The DNA that can form different G-tetra-stranded structure under sodium, potassium ion existence respectively used in the present embodiment is AGGGTT, the compound that the cyanine dyes used is following formula
1) preparation standard solution sample and test solution
Be dissolved in by a certain amount of DNA in the Tris-HCl damping fluid of pH value 7.0, preparation concentration is 1.2mmol/LDNA mother liquor, for subsequent use.
Get the methanol solution 300 μ L that concentration is 200 μm of ol/L cyanine dyes, add 19.2mlTris-HCl damping fluid, and then add DNA solution 300 μ L and mix.Above-mentioned sample mean is divided into 10 parts, and every part of sample solution is 1.98mL.
Get 6 samples wherein, the sodium/potassium ion ratio adding 1mL is respectively respectively 1(40mmol/40mmol), 3(20mmol/10mmol), 5(400mmol/80mmol), 7(210mmol/30mmol), 9(450mmol/50mmol), 11(110mmol/10mmol) solution sample.
Add test serum sample 20 μ L in other 4 samples, obtain 4 test solutions.
Above sample in shady place place, for subsequent use.
2) analysis is detected
Above-mentioned fluorescent spectrometer is analyzed.Every operation all carries out under room temperature environment, does not need extra condition.Fluorescence spectrum excitation wavelength is 555nm, and wavelength capture range is 570 ~ 700nm.
3) interpretation of result
With master sample sodium/potassium ion than for horizontal ordinate, with the fluorescence intensity level at 598nm place of master sample for ordinate is figure, obtain the typical curve of sodium/potassium ion ratio, as shown in Figure 4.Sodium/potassium ion the ratio of corresponding test solution can be found with the fluorescence intensity level at 598nm place of test solution on typical curve, the results are shown in following table 4.
Table 4
Embodiment 5
Adopt the step identical with embodiment 1 to detect four urine samples, difference is that the DNA used is TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG, the compound that the cyanine dyes of use is following formula:
Adopt the excitation wavelength of 570nm, detection solution sample and test solution, at wavelength 650nm place fluorescence intensity level, are designated as F.
Result is as following table 5:
Table 5
Embodiment 6
Adopt the step identical with embodiment 1 to detect four urine samples, difference is that the DNA used is GGTTGGTGTGGTTGG, the compound that the cyanine dyes of use is following formula:
Adopt the excitation wavelength of 565nm, detection solution sample and test solution, at wavelength 585nm place fluorescence intensity level, are designated as F.
Result is as following table 6:
Table 6
Embodiment 7
Adopt the step identical with embodiment 1 to detect four urine samples, difference is that the DNA used is TTGGGTTAGGGTTAGGGTTAGGGA, the compound that the cyanine dyes of use is following formula:
Adopt the excitation wavelength of 540nm, detection solution sample and test solution, at wavelength 575nm place fluorescence intensity level, are designated as F.
Result is as following table 7:
Table 7
Embodiment 8
Adopt the step identical with embodiment 1 to detect four urine samples, difference is that the DNA used is TTAGGGTTAGGGTTAGGGTTAGGG, the compound that the cyanine dyes of use is following formula:
Adopt the excitation wavelength of 560nm, detection solution sample and test solution, at wavelength 600nm place fluorescence intensity level, are designated as F.
Result is as following table 8:
Table 8
One of striking features of the present invention is: the change based on sodium potassium ion regulating DNA conformation realizes detecting, sodium potassium ion causes DNA conformation to change, the change of DNA conformation causes again the change of cyanine dyes accumulation shape, thus makes solution colour or absorption, fluorescence spectrum change.System composition is simple, and reaction is also simple, and sodium potassium ion is whole reaction " initiating agent ", ensure that the degree of accuracy of detection.
Two of striking features of the present invention is: directly determine sodium/potassium ratio, does not need to measure the row calculating again of sodium potassium concn respectively.
Two of striking features of the present invention is: use cyanine dyes supermolecular probe, reaction sensitivity is high, has color to change, and can realize naked-eye observation.
In a word, experiment proves assay method of the present invention, and can pass through fluorescence spectrophotometer completely, determine the ratio size of sodium/potassium ion in sample, measurement sensitivity is high, and specificity is good, and degree of accuracy is good.Meanwhile, also by the change of solution colour, with the naked eye judge the height of sodium/potassium ion ratio.In addition, potassium ion detection kit provided by the invention, good stability, still accurately can detect the content of potassium ion in all kinds sample after long storage time.
Although describe the present invention in the mode of specific embodiment, but be apparent that to those skilled in the art, when not departing from the spirit and scope of the present invention that appended claims limits, can carry out variations and modifications to the present invention, these changes and amendment comprise within the scope of the invention equally.

Claims (20)

1. a method for sodium in tracer liquid sample/potassium ion ratio, said method comprising the steps of:
(1) use the buffer solution of pH6.2 ~ 8.2 and soluble sodium salt and sylvite to prepare sodium/potassium ion than different multiple solution samples, wherein contain the cyanine dyes of same concentrations in each described solution sample and the DNA molecular of different G-tetra-stranded structure under existing, can be formed at sodium, potassium ion respectively; And described soluble sodium salt and sylvite preparation sodium/potassium ion are changes than the concentration of sodion and potassium ion in different multiple solution samples;
(2) under described multiple solution sample being placed in fluorescence spectrophotometer, adopt the excitation wavelength of 540nm to 570nm, detect the fluorescence intensity level gathering wavelength place;
(3) using the sodium of solution sample described in each/potassium ratio as horizontal ordinate or ordinate, be ordinate or horizontal ordinate mapping with the fluorescence intensity level at the collection wavelength place recorded in step (2), thus obtain the typical curve of sodium potassium ion ratio;
(4) in testing liquid sample, described DNA molecular is added, and adjust ph, consistent with the solution sample in step (1) with the concentration and pH value that make the cyanine dyes in testing liquid sample and DNA molecular, thus obtain test solution;
(5), under the test solution obtained in step (4) being placed in fluorescence spectrophotometer, adopt the excitation wavelength identical with step (2), determined wavelength is at the fluorescence intensity level at described collection wavelength place;
(6) sodium/potassium ratio of corresponding test solution is found in utilizing the sodium/potassium ion of the fluorescence intensity level acquisition in step (3) recorded in test solution in step (5) than typical curve;
Wherein said collection wavelength is in the scope of 570nm to 700nm.
2. the method for claim 1, the wherein said DNA molecular that can form different G-tetra-stranded structure under sodium, potassium ion existence is respectively the DNA molecular of the structure containing following formula I in molecular sequences:
GGYGGZGGMGG
Formula I
Wherein: Y, Z and M represent one or more any base independently, and G represents guanine base.
3. method as claimed in claim 1 or 2, wherein said at sodium, there is the lower sequence that can form the DNA molecular of different G-tetra-stranded structure respectively and be selected from following sequence in potassium ion: TTAGGGTTAGGGTTAGGGTTAGGG, AGGGTTAGGGTTAGGGTTAGGG, TTGGGTTAGGGTTAGGGTTAGGGA, TGAGGGTGGGGAGGGTGGGGAA, AGGGAGGGCGCTGGGAGGAGGG, GGGCGCGGGAGGAATTGGGCGGG, GGTTGGTGTGGTTGG, TTGGGGTTGGGGTTGGGGTTGGGG, GGGCGCGGGAGGAAGGGGGCGGG or GGGCGCGGGAGGAATTGGGCGGG.
4. method as claimed in claim 1 or 2, wherein said cyanine dyes is the compound of formula II,
Wherein: R 1for C 1-C 6alkyl, phenyl, alkyl replace phenyl; R 2, R 3, R 4and R 5independently selected from H or C 1-C 6alkyl, or R 2and R 3the ring structure of 5 yuan to 7 yuan is formed together with the carbon atom that they connect, or R 4and R 5the ring structure of 5 yuan to 7 yuan is formed together with the carbon atom that they connect; R 6and R 7for C 1-C 6the C that alkyl or sulfonic group replace 1-C 6alkyl; Y is gegenion, according to R 6and R 7institute's charged difference and different, if R 6and R 7for alkyl, then Y is halide anion; If R 6and R 7only have one with sulfonate radical, then without the need to Y as gegenion; If R 6and R 7all with sulfonate radical, then Y is triethylamine kation; X 1, X 2independently selected from C, O, S, Se or Te.
5. method as claimed in claim 4, wherein said C 1-C 6alkyl be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
6. method, wherein R as claimed in claim 4 1be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl, isohesyl, phenyl, aminomethyl phenyl or 3,5-dimethylphenyl; R 2, R 3, R 4and R 5independently selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
7. method as claimed in claim 4, wherein said 5 yuan to 7 ring structures be containing or saturated or unsaturated ring structure not containing N or S atom.
8. method as claimed in claim 4, wherein Y is selected from fluorine, chlorine, bromine, iodine negative ion or triethylamine kation.
9. method as claimed in claim 1 or 2, wherein said buffer solution is selected from tris-HCI buffer, boric acid-borate buffer solution, Triethanolamine buffer, imidazoles-hydrochloride buffer, glycylglycine buffer, 2-amino-2-methyl-1-propanol damping fluid, sodium phosphate-phosphoric acid hydrogen sodium damping fluid, barbital sodium-hydrochloride buffer, citric acid-sodium citrate damping fluid, Glycine-NaOH damping fluid, borax-sodium hydrate buffer solution or sodium phosphate buffer.
10. method as claimed in claim 1 or 2, in wherein said solution sample the scope of sodium/potassium ion ratio preferably 0 to 10 scope; The concentration of the described DNA molecular that can form different G-tetra-stranded structure respectively under existing at sodium, potassium ion in solution sample is in the scope of 0.5 to 30 μm of ol/L; The concentration of described cyanine dyes in solution sample is in the scope of 1 to 30 μm of ol/L.
The kit of sodium in 11. 1 kinds of tracer liquid samples/potassium ion ratio, described kit comprises: the damping fluid of pH6.2 ~ 8.2, soluble sodium salt, sylvite, can form DNA molecular and the cyanine dyes of different G-tetra-stranded structure under existing respectively at sodium, potassium ion;
Wherein, the buffer solution of pH6.2 ~ 8.2 and soluble sodium salt and sylvite are mixed with sodium/potassium ion than different multiple solution samples, the cyanine dyes containing same concentrations in described multiple solution sample and can form the DNA molecular of different G-tetra-stranded structure at sodium, potassium ion under existing respectively; And described soluble sodium salt and sylvite preparation sodium/potassium ion are changes than the concentration of sodion and potassium ion in different multiple solution samples;
Under described multiple solution sample is placed in fluorescence spectrophotometer, adopt the excitation wavelength of 540nm to 570nm, detect the fluorescence intensity level gathering wavelength place;
Using the sodium of solution sample described in each/potassium ratio as horizontal ordinate or ordinate, the fluorescence intensity level that described detection gathers wavelength place is ordinate or horizontal ordinate mapping, thus obtains the typical curve of sodium potassium ion ratio;
Described DNA molecular is added, and adjust ph in testing liquid sample, consistent with solution sample with the concentration and pH value that make the cyanine dyes in testing liquid sample and DNA molecular, thus obtain test solution;
Under the test solution of acquisition is placed in fluorescence spectrophotometer, adopt the excitation wavelength identical with described excitation wavelength, determined wavelength is at the fluorescence intensity level at described collection wavelength place;
Utilize the fluorescence intensity level recorded in test solution in sodium/potassium ion is than typical curve, find the sodium/potassium ratio of corresponding test solution;
Wherein, described collection wavelength is in the scope of 570nm to 700nm.
12. kits as claimed in claim 11, the wherein said DNA molecular that can form different G-tetra-stranded structure under sodium, potassium ion existence is respectively the DNA molecular of the structure containing following formula I in molecular sequences:
GGYGGZGGMGG
Formula I
Wherein: Y, Z and M represent one or more any base independently, and G represents guanine base.
13. kits as claimed in claim 11, wherein said at sodium, there is the lower sequence that can form the DNA molecular of different G-tetra-stranded structure respectively and be selected from following sequence in potassium ion: TTAGGGTTAGGGTTAGGGTTAGGG, AGGGTTAGGGTTAGGGTTAGGG, TTGGGTTAGGGTTAGGGTTAGGGA, TGAGGGTGGGGAGGGTGGGGAA, AGGGAGGGCGCTGGGAGGAGGG, GGGCGCGGGAGGAATTGGGCGGG, GGTTGGTGTGGTTGG, TTGGGGTTGGGGTTGGGGTTGGGG, GGGCGCGGGAGGAAGGGGGCGGG or GGGCGCGGGAGGAATTGGGCGGG.
14. kits as claimed in claim 11, wherein said cyanine dyes is the compound of formula II,
Wherein: R 1for C 1-C 6alkyl, phenyl, alkyl replace phenyl; R 2, R 3, R 4and R 5independently selected from H or C 1-C 6alkyl, or R 2and R 3the ring structure of 5 yuan to 7 yuan is formed together with the carbon atom that they connect, or R 4and R 5the ring structure of 5 yuan to 7 yuan is formed together with the carbon atom that they connect; R 6and R 7for C 1-C 6the C that alkyl or sulfonic group replace 1-C 6alkyl; Y is gegenion, according to R 6and R 7institute's charged difference and different, if R 6and R 7for alkyl, then Y is halide anion; If R 6and R 7only have one with sulfonate radical, then without the need to Y as gegenion; If R 6and R 7all with sulfonate radical, then Y is triethylamine kation; X 1, X 2independently selected from C, O, S, Se or Te.
15. kits as claimed in claim 14, wherein said C 1-C 6alkyl be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
16. kit, wherein R as claimed in claim 14 1be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl, isohesyl, phenyl, aminomethyl phenyl or 3,5-dimethylphenyl; R 2, R 3, R 4and R 5independently selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
17. kits as claimed in claim 14, wherein said 5 yuan to 7 ring structures be containing or not containing the saturated or unsaturated ring structure of N or S atom.
18. kits as claimed in claim 14, wherein Y is selected from fluorine, chlorine, bromine, iodine negative ion or triethylamine kation.
19. kits as claimed in claim 11, wherein said damping fluid is selected from tris-HCI buffer, boric acid-borate buffer solution, Triethanolamine buffer, imidazoles-hydrochloride buffer, glycylglycine buffer, 2-amino-2-methyl-1-propanol damping fluid, sodium phosphate-phosphoric acid hydrogen sodium damping fluid, barbital sodium-hydrochloride buffer, citric acid-sodium citrate damping fluid, Glycine-NaOH damping fluid, borax-sodium hydrate buffer solution or sodium phosphate buffer.
The system of sodium in 20. 1 kinds of tracer liquid samples/potassium ion ratio, comprises the kit according to any one of claim 11 to 19 and fluorescence spectrophotometer.
CN201210553125.8A 2012-12-18 2012-12-18 Detect the method for sodium/potassium ion ratio and kit and system Active CN103063629B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210553125.8A CN103063629B (en) 2012-12-18 2012-12-18 Detect the method for sodium/potassium ion ratio and kit and system

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210553125.8A CN103063629B (en) 2012-12-18 2012-12-18 Detect the method for sodium/potassium ion ratio and kit and system

Publications (2)

Publication Number Publication Date
CN103063629A CN103063629A (en) 2013-04-24
CN103063629B true CN103063629B (en) 2016-03-16

Family

ID=48106342

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210553125.8A Active CN103063629B (en) 2012-12-18 2012-12-18 Detect the method for sodium/potassium ion ratio and kit and system

Country Status (1)

Country Link
CN (1) CN103063629B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107632158A (en) * 2016-07-18 2018-01-26 中国科学院化学研究所 The method and kit of cysteine in determination sample
CN107345906B (en) * 2017-07-31 2019-07-23 四川大学 A kind of construction method of encoder and decoder
CN110559445B (en) * 2018-06-04 2021-04-06 中国科学院化学研究所 Targeted drug loading system

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0207623D0 (en) * 2002-04-02 2002-05-15 Cancer Res Ventures Ltd Crystal structure of g-quadruplex
CN101587066B (en) * 2008-05-23 2011-03-30 中国科学院化学研究所 Novel use of cyanine dye in detection of G-quadruplex DNA
CN101602762B (en) * 2008-06-10 2013-10-16 深圳迈瑞生物医疗电子股份有限公司 Asymmetric cyanine compound, preparation method and application thereof
CN102417925A (en) * 2011-09-07 2012-04-18 天津希恩思生化科技有限公司 Reagent for detecting content of potassium ions in blood and preparation method thereof as well as kit containing same
CN102735623B (en) * 2012-06-18 2015-06-10 中国科学院化学研究所 Potassium ion concentration detection kit and system thereof
CN102735664B (en) * 2012-06-18 2014-12-10 中国科学院化学研究所 Potassium ion concentration detection method

Also Published As

Publication number Publication date
CN103063629A (en) 2013-04-24

Similar Documents

Publication Publication Date Title
CN102735623B (en) Potassium ion concentration detection kit and system thereof
CN102735664B (en) Potassium ion concentration detection method
CN102866148B (en) Potassium ion concentration detection method
Zhou et al. Design principles of spectroscopic probes for biological applications
CN103048301B (en) Sodium/potassium ion is than detection method, system and kit
CN103063629B (en) Detect the method for sodium/potassium ion ratio and kit and system
CN105131935A (en) Rapid high-selectivity fluorine ion colorimetric probe and preparation method therefor
CN102866149B (en) Detection kit for potassium ion concentration
CN103698324A (en) Air formaldehyde self testing kit
WO2013189265A1 (en) Method, system, and kit for detecting potassium ion concentration
CN101413878A (en) Method for determining homocysteine and homocysteine diagnosis / determination reagent kit
CN105784699A (en) Potassium ion reagent with better stability and higher sensitivity and detection method
CN104596959A (en) Method for detecting potassium ion concentration based on DNA enzymes
CN100554939C (en) Serum sodium ion by enzymatic method is measured reagent and method
CN105651746A (en) Method for detecting iodide ions by unmarked fluorescent probe based on thioflavin T dye design
CN103115904B (en) Urine microalbumin detection method, system and test kit
CN106404734B (en) The method that silver nanoclusters detect potassium concentration infering diing time in vitreous humor
CN101464299A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
Ioannou et al. Kinetic fluorometric determination of aluminum in serum.
CN105153217A (en) Efficient preparation method of colorimetric probe
CN105158181A (en) Kit for detecting fluoride ions
Shi et al. Determination of Total Calcium in Plasma by Flow Injection Analysis with Tris (2, 2′‐bipyridyl) ruthenium (II) Electrochemiluminescent Detection
CN104458728A (en) Method for detecting concentration of sodium ions
CN100451656C (en) Determination of inorganic phosphorus and its diagnostic kit
CN101464404A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method

Legal Events

Date Code Title Description
PB01 Publication
C06 Publication
SE01 Entry into force of request for substantive examination
C10 Entry into substantive examination
GR01 Patent grant
C14 Grant of patent or utility model