CN102735664B - Potassium ion concentration detection method - Google Patents

Potassium ion concentration detection method Download PDF

Info

Publication number
CN102735664B
CN102735664B CN201210206227.2A CN201210206227A CN102735664B CN 102735664 B CN102735664 B CN 102735664B CN 201210206227 A CN201210206227 A CN 201210206227A CN 102735664 B CN102735664 B CN 102735664B
Authority
CN
China
Prior art keywords
solution
absorbance
sample
wavelength
concentration
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201210206227.2A
Other languages
Chinese (zh)
Other versions
CN102735664A (en
Inventor
唐亚林
孙红霞
杨千帆
尚倩
姜薇
盖伟
向俊锋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Chemistry of CAS
Original Assignee
Institute of Chemistry of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Chemistry of CAS filed Critical Institute of Chemistry of CAS
Priority to CN201210206227.2A priority Critical patent/CN102735664B/en
Publication of CN102735664A publication Critical patent/CN102735664A/en
Priority claimed from PCT/CN2013/077335 external-priority patent/WO2013189265A1/en
Application granted granted Critical
Publication of CN102735664B publication Critical patent/CN102735664B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C09DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09BORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
    • C09B23/00Methine or polymethine dyes, e.g. cyanine dyes
    • C09B23/0008Methine or polymethine dyes, e.g. cyanine dyes substituted on the polymethine chain
    • CCHEMISTRY; METALLURGY
    • C09DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09BORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
    • C09B23/00Methine or polymethine dyes, e.g. cyanine dyes
    • C09B23/02Methine or polymethine dyes, e.g. cyanine dyes the polymethine chain containing an odd number of >CH- or >C[alkyl]- groups
    • C09B23/06Methine or polymethine dyes, e.g. cyanine dyes the polymethine chain containing an odd number of >CH- or >C[alkyl]- groups three >CH- groups, e.g. carbocyanines
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/75Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
    • G01N21/77Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/75Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
    • G01N21/77Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
    • G01N21/78Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/84Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving inorganic compounds or pH
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/75Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
    • G01N21/77Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
    • G01N2021/7769Measurement method of reaction-produced change in sensor
    • G01N2021/7786Fluorescence

Abstract

The invention relates to a potassium ion concentration detection method. According to the method, characteristics comprising that potassium ion regulation allows G-quadruplex DNA structure transformation to be formed and cyanine dye supermolecular aggregates identify the G-quadruplex DNA structure transformation are utilized, a sample to be detected is added to a mixed solution of G-quadruplex DNA and the cyanine dye, the absorbance value at 560-590nm, 500-540nm or 610-670nm or the fluorescence intensity value at 580-640nm is determined, and the corresponding potassium ion concentration value can be obtained through finding the value corresponding to the absorbance value or the fluorescence intensity value on a standard curve. The method has a high specificity, so the method is not affected by sodium ions in the sample; and reagent components is simple, and the reaction process is simple, so errors generated by operations can be effectively reduced, and the test accuracy is high. The method can be rapidly realized through a common ultraviolet-visible absorption detector, a spectrophotometer or a fluorescent spectrometer without special or extra instruments, so the detection cost is low, thereby the popularization and the application of the method in industries are convenient.

Description

Potassium concentration detection method
Technical field
The invention belongs to biomedicine field, in particular to a kind of potassium concentration detection method.
Background technology
Potassium in human body is the main kation that maintains cell physiological activity, is to keep normal osmotic pressure and the acid base equilibrium of body, and involved in sugar and protein metabolism, ensure that nervimuscular normal function institute is essential, and its content is human physiological activity's important indicator.In urine, serum, the contents level of potassium ion can have been used the disease of aspects such as diagnosing some kidneys, heart clinically.
Under normal circumstances, the potassium concentration of human body has a rational term of reference, in serum: 3.5~5.5mmol/L; 25~125mmol/24h in urine.When potassium ion is higher than reference value, show high potassium disease, its reason mainly contains: acute renal failure, significant hemolysis or tissue damage, acute acid poison or histanoxia, hypoadrenocorticism, aldosterone deficiency, prolonged application diuretics, familial hyperkalemia etc.Serum potassium height also can cause that the inhibition of serious muscle, cardiac muscle and respiratory function stress be disorderly, and special ECG change.Serum potassium during higher than 7mmol/L, just has these phenomenons to occur, while exceeding 10mmol/L, ventricular fibrillation can occur, cardiac arrest and cause death.Otherwise when intake deficiency, the potassium loss of potassium is serious, kidney trouble there will be low potassium disease while proceeding to the situations such as diuresis stage.
The method of measuring potassium concentration in prior art mainly contains: neutron activation method, isotope dilution mass spectrometry, chemical assay, flame photometry, ion selective electrode method, enzyme kinetics method, atom spectrophotometric method etc.At present, the method often using is clinically flame photometry and ion selective electrode method.
(1) flame photometry: flame photometry is a kind of emission spectrometry method, utilize in flame excited atom to return the spectral intensity of launching while being down to ground state and carry out content analysis, can detect Na+ and the K+ of serum, urine, cerebrospinal fluid and chest ascites, the method belongs to classical canonical reference method, advantage be result accurately and reliably, widely clinical employing.
Conventionally the quantivative approach adopting has outer standard law and internal reference method.Outer standard law general operation error is larger, seldom adopts.Internal standard method is that sample and titer adopt the internal standard element of adding same concentrations to measure, generally to add mark in lithium, what measure is the ratio of lithium/potassium current, instead of the electric current of independent potassium, like this, can reduce the error that the factor such as combustion gas and flame temperature fluctuation causes, thereby have good accuracy.
(2) ion selective electrode method (ISE method): potassium, sodion in the cleer and peaceful urine of the enterprising promoting circulation of blood of instrumentation are measured.Because of it, to have sample consumption few, and quick and precisely, the advantage such as easy and simple to handle, is the easiest method accurately in current all methods, almost has the trend that replaces additive method.Its principle is: ion-selective electrode is a kind of electrochemical sensor, in its structure, there is Sensitive membrane electrode specific ion to selective response, convert ion activity to electric potential signal, within the specific limits, in its current potential and solution, the logarithm of specific ion activity is linear, by trying to achieve the ion activity of unknown solution with the solution comparison of known ion concentration, be divided into again direct measuring method and Indirect Determination by its mensuration process, most of Indirect Determination that adopts at present, because Indirect Determination will be measured after sample to be tested dilution, institute's measured ion activity more approaches ion concentration.
Main type of electrodes has at present: glass-membrane electrode, and inductive material is glass-film; Solid phase electrode, by the extrusion forming of insoluble metal material; Liquid film electrode, using epoxy resin or in-built Polyvinylchloride as sense film; The K+ electrode that valinomycins film is made.These electrodes all have certain life-span, and after asking while using one section, electrode can be aging, and expensive.
(3) chemical assay: the chemical assay of K+ at present mainly utilizes multiple ring crown compound as cave crown ether or spherical crown ether, also be called crown ether, being ionophore measures, owing to there being hole in macrocyclic structure, intramolecule oxygen atom has not share electron pair to be combined with metallic ion, according to hole size, the alternative metallic ion in conjunction with different-diameter, thus can reach the object of measuring ion concentration.
(4) enzyme process: the principle of enzymatic assays potassium is the activation of utilizing pyruvate kinase, the latter's catalysis phosphoenolpyruvic acid becomes lactic acid simultaneously with the consumption of reduced coenzyme Ⅰ, and the absorbance of surveying NADH at wavelength 340nm place declines.
(5) atom spectrophotometric method also can be used for detecting potassium in serum, sodion, but complicated operation, error is larger, easy not as good as flame photometry.
Summary of the invention
Object of the present invention: provide one to utilize cyanine dyes supermolecule and G-quadruplex (G-tetra-serobilas) effect system to detect the new method of potassium concentration, and apply the formulated potassium concentration detection kit of the method.Utilize the reagent in this kit, can utilize the concentration of potassium ion in ultra-violet absorption spectrum or fluorescence spectrum instrument quantitative test serum or urine, mensuration process is not subject to the impact of sodion or other trace elements, and degree of accuracy is high.Meanwhile, because this reagent sensitivity is very high, different potassium concentrations are shown to the variation in color, naked eyes are visible, can realize visual detection.
General technical route of the present invention is: by adding potassium ion to regulate and control formation or the conformation transition of G-tetra-chain body structures, cyanine dyes is identified the variation of G-tetra-chain body structures thereupon, thereby reflects the concentration level of potassium ion.Be specially: do not having under the environment of sodion and other metal cations, potassium ion impels the DNA sequence dna of strand to change G-tetra-chain body structures into, along with the generation of G-tetra-chain body structures, the accumulation shape of cyanine dyes changes, thereby in color, change, reach naked-eye observation, on ultra-violet absorption spectrum and fluorescence spectrum, also occur significantly to change simultaneously, the intensity of variation of absorbance and fluorescence intensity is directly proportional to potassium concentration, thereby realizes quantitative response Potassium Level; Or under the environment existing at sodion, DNA sequence dna forms antiparallel structure G-tetra-serobilas, add the occurred conformation transformation of potassium ion antiparallel G-tetra-serobilas, along with G-tetra-serobila conformation transitions, the accumulation shape of cyanine dyes changes, thereby in color and on ultra-violet absorption spectrum and fluorescence spectrum, also occur significantly to change, the intensity of variation of absorbance and fluorescence intensity is directly proportional to potassium concentration, can quantitative response Potassium Level.
A first aspect of the present invention provides the method for potassium concentration in a kind of tracer liquid sample, said method comprising the steps of:
(1) with the different multiple solution samples of buffer preparation potassium concentration of pH6.2~8.2, wherein in each described solution sample, contain the DNA molecular that can form G-tetra-serobilas of same concentrations and the cyanine dyes of same concentrations;
(2) described multiple solution samples are placed under ultraviolet-visible absorption spectrometer or spectrophotometer, detect the absorbance of first wave strong point and the absorbance of Second Wave strong point, or described multiple solution samples are placed under fluorescence spectrophotometer, adopt the excitation wavelength of 560nm, detect the fluorescence intensity level of wavelength at three-wavelength place, wherein said the first wavelength is in 560nm to 590nm scope, and described second wave length is in 500nm to 540nm scope, and described three-wavelength is in 580nm to 640nm scope;
(3) using the potassium concentration of solution sample described in each as horizontal ordinate or ordinate, taking the absorbance of first wave strong point that records in step (2) or the absorbance of the absorbance of Second Wave strong point or first wave strong point and the ratio of absorbance of Second Wave strong point or the fluorescence intensity level at three-wavelength place as ordinate or horizontal ordinate mapping, thereby obtain the typical curve of potassium concentration;
(4) in testing liquid sample, add and can form the DNA molecular of G-tetra-serobilas, compound and the damping fluid of formula I, so that the concentration of the compound of the concentration of the DNA molecular that can form G-tetra-serobilas in testing liquid sample, formula I and pH value are consistent with the solution sample in step (1), thereby obtain test solution;
(5) test solution obtaining in step (4) is placed under ultraviolet-visible absorption spectrometer or spectrophotometer, detect test solution at the first wavelength and Second Wave strong point absorbance, or described test solution is placed under fluorescence spectrophotometer, adopt the excitation wavelength of 560nm, detect the fluorescence intensity level at three-wavelength place;
(6) in the potassium concentration typical curve that utilizes the absorbance of the absorbance of the first wave strong point recording in step (5) or the absorbance of Second Wave strong point or first wave strong point to obtain in step (3) with the ratio of the absorbance of Second Wave strong point or the fluorescence intensity level at three-wavelength place, find the potassium concentration value of corresponding test solution, then calculate the potassium concentration of testing sample by the extension rate of testing sample quilt.
Method of the present invention can be advantageously used in detecting the potassium concentration in various solution examples, for example, can detect the potassium concentration in human or animal's blood, urine or other body fluid.
Due in human body or animal body, except potassium ion, also exist the existence of many other metallic ions, particularly sodion can produce certain impact to the accuracy of method of the present invention.
Therefore, a second aspect of the present invention provide a kind of under sodion background the method for potassium concentration in tracer liquid sample, said method comprising the steps of:
(1) the different multiple solution samples of buffer preparation potassium concentration of use pH6.2~8.2, the DNA molecular that can form G-tetra-serobilas, the sodion of same concentrations and the cyanine dyes of same concentrations that wherein in each described solution sample, contain same concentrations;
(2) described multiple solution samples are placed under ultraviolet-visible absorption spectrometer or spectrophotometer, detect the absorbance of described solution sample at the first wavelength and the 4th wavelength place, or described multiple solution samples are placed under fluorescence spectrophotometer, adopt the excitation wavelength of 560nm, detect the fluorescence intensity level of wavelength at three-wavelength place, wherein said the first wavelength is in 560nm to 590nm scope, described the 4th wavelength is in 610nm to 670nm scope, and described three-wavelength is in 580nm to 640nm scope;
(3) using the potassium concentration of solution sample described in each as horizontal ordinate or ordinate, taking each solution sample of recording in step (2) at the absorbance of first wave strong point or the absorbance of the absorbance at the 4th wavelength place or first wave strong point and the ratio of absorbance at the 4th wavelength place or the fluorescence intensity level at three-wavelength place as ordinate or horizontal ordinate mapping, thereby obtain the typical curve of potassium concentration;
(4) in testing liquid sample, add and can form the DNA molecular of G-tetra-serobilas, compound and the damping fluid of formula I, so that the concentration of the compound of the concentration of the DNA molecular that can form G-tetra-serobilas in testing liquid sample, formula I and pH value are consistent with the solution sample in step (1), thereby obtain test solution;
(5) test solution obtaining in step (4) is placed under ultraviolet-visible absorption spectrometer or spectrophotometer, detect the absorbance of described test solution at described the first wavelength and described the 4th wavelength place, or described test solution is placed under fluorescence spectrophotometer, adopt the excitation wavelength of 560nm, detect the fluorescence intensity level of wavelength at described three-wavelength place;
(6) in the potassium concentration typical curve that utilizes the absorbance of the absorbance of the first wave strong point recording in step (5) or the absorbance at the 4th wavelength place or first wave strong point to obtain in step (3) with the ratio of the absorbance at the 4th wavelength place or the fluorescence intensity level at three-wavelength place, find the potassium concentration value of corresponding test solution, then calculate the potassium concentration of testing sample by the extension rate of testing sample quilt.
According to the method for first aspect present invention, wherein said damping fluid is selected from tris-HCI buffer, boric acid-borate buffer solution, triethanolamine damping fluid, imidazoles-hydrochloride buffer, glycylglycine damping fluid or 2-amino-2-methyl-1-propanol damping fluid.
According to the method for second aspect present invention, wherein said damping fluid is selected from trishydroxymethylaminomethane-hydrochloric acid (Tris-HCl) damping fluid, boric acid-borate buffer solution, triethanolamine damping fluid, imidazoles-hydrochloride buffer, glycylglycine damping fluid, 2-amino-2-methyl-1-propanol damping fluid, sodium phosphate-dibastic sodium phosphate damping fluid, barbital sodium-hydrochloride buffer, citric acid-sodium citrate damping fluid, glycocoll-sodium hydrate buffer solution, borax-sodium hydrate buffer solution or sodium phosphate buffer.
In embodiments of the invention, the concentration of buffering agent in damping fluid is not done to special restriction, but preferred concentration range is 10~50mmol/L.
According to the method for first aspect present invention or second aspect, the compound that wherein said cyanine dyes is following formula I
Wherein: R 1for C 1-C 6the phenyl that replaces of alkyl, phenyl, alkyl; R 2, R 3, R 4and R 5independently selected from H or C 1-C 6alkyl, or R 2and R 3together with the carbon atom connecting with them, form the ring structure of 5 yuan to 7 yuan, or R 4and R 5together with the carbon atom connecting with them, form the ring structure of 5 yuan to 7 yuan; R 6and R 7for C 1-C 6the C that alkyl or sulfonic group replace 1-C 6alkyl; Y is gegenion, according to R 6and R 7institute charged difference and difference, if R 6and R 7for alkyl, Y is halide anion; If R 6and R 7only have one with sulfonate radical, without Y as gegenion; If R 6and R 7all, with sulfonate radical, Y is triethylamine kation; X 1, X 2independently selected from carbon (C), oxygen (O), sulphur (S), selenium (Se) or tellurium (Te).
According to the method for first aspect present invention or second aspect, wherein C 1-C 6alkyl be that carbon number is the alkyl of the straight or branched of 1-6, include but not limited to methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl etc.
According to the method for first aspect present invention or second aspect, wherein R 1be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl, isohesyl, phenyl, aminomethyl phenyl or 3,5-dimethylphenyl.
According to the method for first aspect present invention or second aspect, wherein R 2, R 3, R 4and R 5independently selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
According to the method for first aspect present invention or second aspect, wherein R 2and R 3the carbon atom being connected with them can form saturated rings structure or the unsaturated ring structure of 5 yuan to 7 yuan, and described ring structure can contain or not contain nitrogen (N) or sulphur (S) atom.
According to the method for first aspect present invention or second aspect, wherein R 4and R 5the carbon atom being connected with them can form the saturated or unsaturated ring structure of 5 yuan to 7 yuan, and described ring structure can contain or not contain N or S atom.
According to the method for first aspect present invention or second aspect, wherein Y is preferably fluorine, chlorine, bromine, iodine negative ion or triethylamine kation.
According to the method described in first aspect present invention or second aspect, wherein can by with soluble potassium salt as potassium chloride, potassium sulfate, potassium nitrate etc. prepare as described in multiple solution samples, in each solution sample, the scope of potassium concentration is preferably in 0 to 200mmol/L scope, further preferably in 0 to 100mmol/L scope, further preferably in 0 to 10mmol/L scope, most preferably in 0 to 2mmol/L scope, the non-limiting example of wherein said soluble potassium salt comprises, potassium chloride, potassium bromide, potassium iodide, potassium sulfate or potassium nitrate etc.
According to the method described in second aspect present invention, in wherein said multiple solution sample, Na ion concentration is preferably controlled in human body or animal body within the scope of physiological concentration, for example 10 to 200mmol/L scope, preferably in 40 to 160mmol/L scope, the concentration of sodion can be led to and added soluble sodium salt or regulate with the damping fluid that contains sodion, the non-limiting example of described soluble sodium salt comprises, sodium chloride, sodium bromide, sodium iodide, sodium sulphate or sodium nitrate etc.
According to the method for first aspect present invention or second aspect, the concentration of wherein said cyanine dyes in solution sample is in the scope of 3 to 20 μ mol/L, preferably at 5 to 10 μ mol/L, the concentration of the described DNA molecular that can form G-tetra-serobilas in solution sample is in the scope of 3 to 30 μ mol/L, preferably at 5 to 20 μ mol/L, further preferably at 10 to 20 μ mol/L.
According to the method described in first aspect present invention or second aspect, the wherein said DNA molecular that can form G-tetra-serobilas is the DNA molecular that is rich in guanine in molecular sequences, and in preferred molecular sequences, has the DNA molecular of " GG " structure.In this type of DNA molecular, four guanines are connected and can be formed plane quartet by hydrogen bond, and plural plane quartet can three-dimensional four chain structures of mutual stacking formation, i.e. G-quadruplex (G-tetra-serobilas).The non-limiting example of this class DNA molecular comprises, as can be purchased from the TTAGGGTTAGGG of Ying Jun Bioisystech Co., Ltd, TTAGGG TTAGGGTTAGGGTTAGGGTTAGGG, AGGGTTAGGGTTAGGGTTAGGG, TGAGGGTGGGGAGGGTGGGGAA, AGGGAGGGCGCTGGGAGGAGGG, GGGCGCGGGAGGAATTGGGCGGG, GGTTGGTGTGGTTGG, TTGGGGTTGGGGTTGGGGTTGGGG, TTGGGGTTGGGG, GGGGTTGGGG, the DNA molecular such as GGGCGCGGGAGGAAGGGGGCGGG or GGGCGCGGGAGGAATTGGGCGGG, but the DNA sequence dna scope that can form G-tetra-serobilas be not subject to these enumerate limit.In addition, do not have particular restriction for the length of the DNA molecular that can form G-tetra-serobilas using in the present invention, but the preferred length of 6 ~ 300 bases, the more preferably length of 10 ~ 100 bases, the most preferably length of 10 ~ 30 bases.
A third aspect of the present invention provides a kind of kit and system of implementing the inventive method, and described kit comprises: damping fluid, the soluble potassium salt of pH6.2 ~ 8.2, can form DNA molecular and the cyanine dyes of G-tetra-serobilas; Described system comprises: damping fluid, soluble potassium salt, the DNA molecular that can form G-tetra-serobilas, cyanine dyes and ultraviolet-visible absorption spectrometer or spectrophotometer or the fluorescence spectrophotometer of pH6.2 ~ 8.2.
According to the kit described in third aspect present invention and system, also comprise soluble sodium salt.
According to the kit described in third aspect present invention and system, wherein said damping fluid, soluble potassium salt, soluble sodium salt, the DNA molecular that can form G tetra-serobilas and cyanine dyes are as defined above.
The major advantage of method of the present invention and kit is:
1) the present invention utilizes the G-tetra-chain body structures of cyanine dyes supramolecular aggregation specific recognition potassium ion regulation and control, can under physiological sodium ion concentration, operate and unaffected, high to potassium ion specificity;
2) the present invention uses cyanine dyes supermolecular probe, G-tetra-serobila structural changes to potassium ion regulation and control are very responsive, with the change of accumulation shape, show the displacement of absorption band up to nearly hundred nanometers simultaneously in ultra-violet absorption spectrum, thereby variation in generation color, can realize visual detection;
3) cyanine dyes supermolecule used in the present invention, can produce marked change at ultra-violet absorption spectrum and fluorescence spectrum, utilize common ultra-violet absorption spectrum instrument or spectrophotometer or fluorescence spectrophotometer all can realize quantitative detection, do not need special or additional instruments, testing cost is cheap, is convenient to apply in industry;
4) agents useful for same composition of the present invention only has 3~4 kinds, only need mix in proportion, detects with regard to available instrument, and simple to operate, quick and with low cost, this system operates in buffered environment, does not pollute the environment.
5) agents useful for same composition of the present invention is simple, kind is few, can not exert an influence each other, and good stability, can store for a long time the fine guarantee application testing effect of energy;
6) apply detection method provided by the invention and can make the reagent of the various ways such as liquid reagent, powdered reagent, dry reagent, the content that can be used to measure potassium ion in human body and other animal body, also can be used to detect the Potassium Level in other samples such as water quality or soil.
7) apply detection method provided by the invention, according to the characteristic of cyanine dyes aggregation change color, can be developed to the form of test paper, make to detect more simple, convenient.
8) use method of the present invention, by different extension rates, can realize the potassium concentration in the sample of various concentration ranges is analyzed.
Brief description of the drawings
Fig. 1 is the potassium concentration typical curve according to the embodiment of the present invention 1;
Fig. 2 is the potassium concentration typical curve according to the embodiment of the present invention 2;
Fig. 3 is the potassium concentration typical curve according to the embodiment of the present invention 3;
Fig. 4 is the potassium concentration typical curve according to the embodiment of the present invention 4;
Fig. 5 is the potassium concentration typical curve according to the embodiment of the present invention 9;
Fig. 6 is the potassium concentration typical curve according to the embodiment of the present invention 10;
Fig. 7 is the potassium concentration typical curve according to the embodiment of the present invention 11;
Fig. 8 is the potassium concentration typical curve according to the embodiment of the present invention 12.
Embodiment
In the mode of specific embodiment, the present invention is described in more detail below with reference to accompanying drawings, but be to be understood that, the present invention can implement in a different manner, it is only in order to make this instructions fully with complete that these embodiment are provided, so that those skilled in the art can implement the present invention, scope of the present invention should not be defined as listed specific embodiment herein.The instrument that used in an embodiment of the present invention has: ultraviolet-visible absorption spectrometer, and model is Agilent 8453UV-visible spectrophotometer; Fluorescence spectrophotometer, model Hitachi F4500spectrofluorometer (Japan).
Embodiment 1
The DNA that can form G tetra-serobilas using is in the present embodiment AGGGTTAGGGTTAGGGTTAGGG, the compound that the cyanine dyes using is following formula
1) preparation standard solution sample and test solution
A certain amount of DNA is dissolved in the Tris-HCl damping fluid of pH value 6.2, preparation concentration is 200 μ mol/LDNA mother liquors, for subsequent use.
Getting concentration is the methanol solution 300 μ L of 200 μ mol/L cyanine dyes, adds 19.2ml Tris-HCl damping fluid, and then adds DNA solution 300 μ L to mix.Above-mentioned sample mean is divided into 10 parts, and every part of sample solution is 1.98mL.
Get 6 samples wherein, adding respectively a certain amount of concentration is the KCl solution of 200mmol/L, is then settled to 2mL with Tris-HCl damping fluid, and the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.25,0.5, the standard solution sample of 0.8mmol/L.
In other 4 samples, add urine specimen 20 μ L to be measured, obtain 4 test solutions, urine specimen accounts for 1% of test solution.
Above sample is in shady place placement, for subsequent use.
2) detect and analyze
Utilize respectively ultra-violet absorption spectrum instrument to analyze in above-mentioned sample.Every operation all carries out under room temperature environment, does not need extra condition.The wavelength that ultra-violet absorption spectrum is collected is in the data at 400~800nm place.
3) interpretation of result
Absorbance (A with master sample at 580nm place 1) be horizontal ordinate, taking the potassium concentration of master sample as ordinate is figure, obtain the typical curve of potassium concentration, as shown in Figure 1.Can on typical curve, find the potassium concentration value of corresponding test solution by the absorbance at the 580nm place of test solution, it,, divided by the 1% potassium concentration value that obtains urine sample to be measured, be the results are shown in to following table 1.
Table 1
Embodiment 2
The DNA that can form G tetra-serobilas using is in the present embodiment TGAGGGTGGGGAGGGTGGGGAA DNA, the compound that the cyanine dyes using is following formula
1) preparation standard solution sample and test solution
A certain amount of DNA is dissolved in the boric acid-borate buffer solution of pH value 8.2, preparation concentration is 200 μ mol/LDNA mother liquors, for subsequent use.
Getting concentration is the methanol solution 300 μ L of 600 μ mol/L cyanine dyes, adds 19.2ml boric acid-borate buffer solution, and then adds DNA solution 300 μ L to mix.Above-mentioned sample mean is divided into 10 parts, and every part of sample solution is 1.98mL.
Get 6 samples wherein, adding respectively a certain amount of concentration is the KCl solution of 200mmol/L, then be settled to 2mL with boric acid-borate buffer solution, the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.25,0.5, the standard solution sample of 0.8mmol/L.
In other 4 samples, add urine specimen 20 μ L to be measured, obtain 4 test solutions, urine specimen accounts for 1% of test solution.
2) detect and analyze
Utilize respectively ultra-violet absorption spectrum instrument to analyze in above-mentioned sample.Every operation all carries out under room temperature environment, does not need extra condition.The wavelength that ultra-violet absorption spectrum is collected is in the data at 400~800nm place.
3) interpretation of result
Ratio (A with master sample in absorbance and the 530nm place absorbance at 580nm place 1/ A 2) be ordinate, taking the potassium concentration of master sample as horizontal ordinate is figure, obtain the typical curve of potassium concentration, as shown in Figure 2.Can on typical curve, find the potassium concentration value of corresponding test solution with the absorbance at the 580nm place of test solution and the ratio of 530nm place absorbance, it,, divided by the 1% potassium concentration value that obtains urine sample to be measured, be the results are shown in to following table 2.
Table 2
Embodiment 3
The DNA that can form G tetra-serobilas using is in the present embodiment GGGCCAGGGAGCGGGGCGGAGGGGG, the compound that the cyanine dyes using is following formula
1) preparation standard solution sample and test solution
A certain amount of DNA is dissolved in the Tris-HCl damping fluid of pH value 7.2, preparation concentration is 600 μ mol/LDNA mother liquors, for subsequent use.
Getting concentration is the methanol solution 300 μ L of 1.2mmol/L cyanine dyes, adds 19.2ml Tris-HCl damping fluid, and then adds DNA solution 300 μ L to mix.Above-mentioned sample mean is divided into 10 parts, and every part of sample solution is 1.98mL.
Get 6 samples wherein, adding respectively a certain amount of concentration is the KCl solution of 200mmol/L, is then settled to 2mL with Tris-HCl damping fluid, and the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.25,0.5, the standard solution sample of 0.8mmol/L.
In other 4 samples, add urine specimen 20 μ L to be measured, obtain 4 test solutions, urine specimen accounts for 1% of test solution.
Above sample is in shady place placement, for subsequent use.
2) detect and analyze
Utilize respectively ultra-violet absorption spectrum instrument to analyze in above-mentioned sample.Every operation all carries out under room temperature environment, does not need extra condition.The wavelength that ultra-violet absorption spectrum is collected is in the data at 400~800nm place.
3) interpretation of result
Absorbance (A with master sample at 530nm place 2) be ordinate, taking the potassium concentration of master sample as horizontal ordinate is figure, obtain the typical curve of potassium concentration, as shown in Figure 3.On typical curve, find the potassium concentration value of corresponding test solution by the absorbance at the 530nm place of test solution, it,, divided by the 1% potassium concentration value that obtains urine sample to be measured, be the results are shown in to following table 3.
Table 3
Embodiment 4
The DNA that can form G tetra-serobilas using is in the present embodiment AGGGTT, the compound that the cyanine dyes using is following formula
1) preparation standard solution sample and test solution
A certain amount of DNA is dissolved in the Tris-HCl damping fluid of pH value 7.0, preparation concentration is 1.2mmol/L DNA mother liquor, for subsequent use.
Getting concentration is the methanol solution 300 μ L of 200 μ mol/L cyanine dyes, adds 19.2ml Tris-HCl damping fluid, and then adds DNA solution 300 μ L to mix.Above-mentioned sample mean is divided into 10 parts, and every part of sample solution is 1.98mL.
Get 6 samples wherein, adding respectively a certain amount of concentration is the KCl solution of 200mmol/L, is then settled to 2mL with Tris-HCl damping fluid, and the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.25,0.5, the standard solution sample of 0.8mmol/L.
In other 4 samples, add urine specimen 20 μ L to be measured, obtain 4 test solutions, urine specimen accounts for 1% of test solution.
Above sample is in shady place placement, for subsequent use.
2) detect and analyze
Above-mentioned fluorescent spectrometer is analyzed.Every operation all carries out under room temperature environment, does not need extra condition.Fluorescence spectrum excitation wavelength is 560nm, and wavelength capture range is 570~720nm.
3) interpretation of result
Taking the fluorescence intensity at wavelength 580nm place (FI) of master sample as horizontal ordinate, taking the potassium concentration of master sample as ordinate is figure, obtain the typical curve of potassium concentration, as shown in Figure 4.On typical curve, find the potassium concentration value of corresponding test solution by the fluorescence intensity of test solution, it,, divided by the 1% potassium concentration value that obtains urine sample to be measured, be the results are shown in to following table 4.
Table 4
Embodiment 5
Adopt the step identical with embodiment 1 to detect four blood serum samples, difference is that the DNA using is TTAGGG TTAGGGTTAGGGTTAGGGTTAGGG, the compound that the cyanine dyes of use is following formula:
Detect solution sample and test solution in the absorbance at wavelength 590nm place, be designated as A 1.
Result is as following table 5:
Table 5
Embodiment 6
Adopt the step identical with embodiment 2 to detect four blood serum samples, difference is that the DNA using is AGGGTTAGGGTTAGGGTTAGGG, the compound that the cyanine dyes of use is following formula:
Detect solution sample and test solution in the absorbance at wavelength 590nm place and 540nm place, be designated as respectively A 1and A 2.
Result is as following table 6:
Table 6
Embodiment 7
Adopt the step identical with embodiment 3 to detect four blood serum samples, difference is to use the compound of following formula:
Detect solution sample and test solution in the absorbance at wavelength 500nm place, be designated as A 2.
Result is as following table 7:
Table 7
Embodiment 8
Adopt the step identical with embodiment 4 to detect four blood serum samples, difference is to use the compound of following formula:
Detect solution sample and test solution in the fluorescence intensity at wavelength 640nm place, be designated as FI.
Result is as following table 8:
Table 8
Embodiment 9-16 carries out under sodion background
Embodiment 9
The DNA that can form G-tetra-serobilas using is in the present embodiment AGGGTTAGGGTTAGGGTTAGGG, the compound that the cyanine dyes using is following formula
1) preparing standard solution sample and test solution
By a certain amount of DNA sample dissolution in the Tris-HCl(Tris-Na that contains 20mmol/L NaCl) in damping fluid (pH6.2), preparation concentration is the DNA mother liquor of 500 μ mol/L, for subsequent use.
Getting concentration is the methanol solution 300 μ L of 200 μ mol/L cyanine dyes, adds 19.38ml Tris-Na damping fluid, and then adds DNA solution 120 μ L to mix.Above-mentioned sample mean is divided into 10 parts, and every part of sample solution is 1.98mL.
Get 7 samples wherein, adding respectively a certain amount of concentration is the Tris-Na solution of 200mmol/L KCl, then be settled to 2mL with Tris-Na damping fluid, the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.2,0.5,1, the master sample solution of 1.5mmol/L.
In other 3 samples, add urine specimen 20 μ L to be measured, urine specimen accounts for 1% of total solution sample.
Above sample is in shady place placement, for subsequent use.
2) detect and analyze
Utilize ultra-violet absorption spectrum instrument to analyze in above-mentioned sample.Every operation all carries out under room temperature environment, does not need extra condition.The wavelength that ultra-violet absorption spectrum is collected is in the data at 400~800nm place.
3) interpretation of result
(be designated as A with standard solution sample in the absorbance at 560nm place 1) be horizontal ordinate, map as ordinate taking the potassium concentration of standard solution sample, obtain the typical curve of potassium concentration, as shown in Figure 5.Can on typical curve, find the potassium concentration value of corresponding test solution by the absorbance at the 580nm place of test solution, it,, divided by the 1% potassium concentration value that obtains urine sample to be measured, be the results are shown in to following table 9.
Table 9
Embodiment 10
The DNA that can form G-tetra-serobilas using is in the present embodiment AGGGTTAGGGTTAGGGTTAGGG, the compound that the cyanine dyes using is following formula
1) preparing standard solution sample and test solution
A certain amount of DNA is dissolved in to the Tris-HCl(Tris-Na that contains 200mmol/L NaCl) in damping fluid (pH8.2), the DNA mother liquor that preparation concentration is 1.5mmol/L, for subsequent use.
Getting concentration is the methanol solution 300 μ L of 600 μ mol/L cyanine dyes, adds 19.38ml Tris-Na damping fluid, and then adds DNA solution 120 μ L to mix.Above-mentioned sample mean is divided into 10 parts, and every part of sample solution is 1.98mL.
Get 7 samples wherein, adding respectively a certain amount of concentration is the Tris-Na solution of 200mmol/L KCl, then be settled to 2mL with Tris-Na damping fluid, the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.2,0.5,1, the master sample solution of 1.5mmol/L.
In other 3 samples, add urine specimen 20 μ L to be measured, urine specimen accounts for 1% of total solution sample.
Above sample is in shady place placement, for subsequent use.
2) detect and analyze
Utilize respectively ultra-violet absorption spectrum instrument to analyze in above-mentioned sample.Every operation all carries out under room temperature environment, does not need extra condition.The wavelength that ultra-violet absorption spectrum is collected is in the data at 400~800nm place.
3) interpretation of result
(be designated as A with master sample in the absorbance at 650nm place 3) be horizontal ordinate, map as ordinate taking the potassium concentration of standard solution sample, obtain the typical curve of potassium concentration, as shown in Figure 6.Can on typical curve, find the potassium concentration value of corresponding test solution by the absorbance at the 650nm place of test solution, it,, divided by the 1% potassium concentration value that obtains urine sample to be measured, be the results are shown in to following table 10.
Table 10
Embodiment 11
The DNA that can form G tetra-serobilas using is in the present embodiment GGGCCAGGGAGCGGGGCGGAGGGGG, the compound that the cyanine dyes using is following formula
1) preparing standard solution sample and test solution
A certain amount of DNA being dissolved in to the Tris-HCl(Tris-Na that contains 160mmol/L NaCl) in damping fluid (pH7.0), preparation concentration is the DNA mother liquor of 500 μ mol/L, for subsequent use.
Getting concentration is the methanol solution 300 μ L of 200 μ mol/L cyanine dyes, adds 19.38ml Tris-Na damping fluid, and then adds DNA solution 120 μ L to mix.Above-mentioned sample mean is divided into 10 parts, and every part of sample solution is 1.98mL.
Get 7 samples wherein, adding respectively a certain amount of concentration is the Tris-Na solution of 200mmol/L KCl, then be settled to 2mL with Tris-Na damping fluid, the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.2,0.5,1, the master sample solution of 1.5mmol/L.
In other 3 samples, add urine specimen 20 μ L to be measured, urine specimen accounts for 1% of total solution sample.
Above sample is in shady place placement, for subsequent use.
2) detect and analyze
Utilize ultra-violet absorption spectrum instrument to analyze in above-mentioned sample.Every operation all carries out under room temperature environment, does not need extra condition.The wavelength that ultra-violet absorption spectrum is collected is in the data at 400~800nm place.
3) interpretation of result
Absorbance (A with master sample at 560nm place 1) with the absorbance (A at 670nm place 3) ratio (A 1/ A 3) be horizontal ordinate, map as ordinate taking the potassium concentration of standard solution sample, obtain the typical curve of potassium concentration, as shown in Figure 7.With the ratio (A of the absorbance at 560nm place and the absorbance at 670nm place of test solution 1/ A 3) can on typical curve, find the potassium concentration value of corresponding test solution, it,, divided by the 1% potassium concentration value that obtains urine sample to be measured, be the results are shown in to following table 11.
Table 11
Embodiment 12
The DNA that can form G-tetra-serobilas using is in the present embodiment GGGCGCGGGAGGAATTGGGCGGG, the compound that the cyanine dyes using is following formula
1) preparing standard solution sample and test solution
A certain amount of DNA is dissolved in to the Tris-HCl(Tris-Na that contains 40mmol/L NaCl) in damping fluid, the DNA mother liquor that preparation concentration is 3mmol/L, for subsequent use.
Getting concentration is the methanol solution 300 μ L of 1.2mmol/L cyanine dyes, adds 19.38ml Tris-Na damping fluid, and then adds DNA solution 120 μ L to mix.Above-mentioned sample mean is divided into 10 parts, and every part of sample solution is 1.98mL.
Get 7 samples wherein, adding respectively a certain amount of concentration is the Tris-Na solution of 200mmol/L KCl, then be settled to 2mL with Tris-Na damping fluid, the concentration that obtains potassium ion is respectively 0,0.05,0.1,0.2,0.5,1, the master sample solution of 1.5mmol/L.
In other 3 samples, add urine specimen 20 μ L to be measured, urine specimen accounts for 1% of total solution sample.
Above sample is in shady place placement, for subsequent use.
2) detect and analyze
Above-mentioned sample is analyzed by fluorescence spectrophotometer.Every operation all carries out under room temperature environment, does not need extra condition.Fluorescence spectrum excitation wavelength is 560nm, and wavelength capture range is 570~720nm.
3) interpretation of result
Taking master sample in the fluorescence intensity (being designated as FI) at 640nm place as horizontal ordinate, taking the potassium concentration of standard solution sample as ordinate mapping, obtain the typical curve of potassium concentration, as shown in Figure 8.Can on typical curve, find the potassium concentration value of corresponding test solution by the fluorescence intensity at the 640nm place of test solution, it,, divided by the 1% potassium concentration value that obtains urine sample to be measured, be the results are shown in to following table 12.
Table 12
Embodiment 13
Adopt the step identical with embodiment 9 to detect three blood serum samples, difference is that the DNA using is GGGCGCGGGAGGAATTGGGCGGG, the compound that the cyanine dyes of use is following formula:
Detect solution sample and test solution in the absorbance at wavelength 590nm place, be designated as A 1.
Result is as following table 13:
Table 13
Embodiment 14
Adopt the step identical with embodiment 10 to detect three blood serum samples, difference is that the DNA using is GGGCGCGGGAGGAAGGGGGCGGG, the compound that the cyanine dyes of use is following formula:
Detect solution sample and test solution in the absorbance at wavelength 670nm place, be designated as A 3.
Result is as following table 14:
Table 14
Embodiment 15
Adopt the step identical with embodiment 11 to detect three blood serum samples, difference is that the DNA using is GGGGTTGGGG, the compound that the cyanine dyes of use is following formula:
Detect solution sample and test solution in the absorbance at wavelength 580nm and 610nm place, be designated as respectively A 1and A 3.
Result is as following table 15:
Table 15
Embodiment 16
Adopt the step identical with embodiment 12 to detect three blood serum samples, difference is that the DNA using is TTGGGGTTGGGG, the compound that the cyanine dyes of use is following formula:
Detect solution sample and test solution in the fluorescence intensity at wavelength 600nm place, be designated as FI.
Result is as following table 16:
Table 16
One of striking features of the present invention is: the variation based on potassium ion regulating DNA conformation realizes and detecting, potassium ion causes that DNA conformation changes, DNA conformation changes and causes again the change of cyanine dyes accumulation shape, thereby makes to change on solution colour or absorption, fluorescence spectrum.System composition is simple, reacts also simple, and potassium ion is whole reaction " initiating agent ", has ensured the degree of accuracy detecting.
Two of striking features of the present invention is: system itself can be with a large amount of sodions, and this situation can ensure that the variation of the environment that in sample, sodion can cause ignores.
Three of striking features of the present invention is: use cyanine dyes supermolecular probe, reaction sensitivity is high, has change color, can realize naked-eye observation.
In a word, experimental results show that assay method of the present invention, can pass through ultra-violet absorption spectrum instrument or fluorescence spectrophotometer completely, determine the concentration level of potassium ion in sample, measurement sensitivity is high, and specificity is good, and degree of accuracy is good.Meanwhile, also can, by the variation of solution colour, with the naked eye judge the height of potassium concentration level.In addition, potassium ion detection kit provided by the invention, good stability, long storage time still can accurately detect the content of potassium ion in all kinds sample afterwards.
Although described the present invention in the mode of specific embodiment, but be apparent that to those skilled in the art, in the case of not departing from the spirit and scope of the present invention that appended claims limits, can carry out variations and modifications to the present invention, these variations and amendment comprise within the scope of the invention equally.

Claims (9)

1. a method for potassium concentration in tracer liquid sample, said method comprising the steps of:
(1) with the different multiple solution samples of buffer preparation potassium concentration of pH6.2~8.2, wherein in each described solution sample, contain the DNA molecular that can form G-tetra-serobilas of same concentrations and the cyanine dyes of same concentrations;
(2) described multiple solution samples are placed under ultraviolet-visible absorption spectrometer or spectrophotometer, detect the absorbance of first wave strong point and the absorbance of Second Wave strong point, or described multiple solution samples are placed under fluorescence spectrophotometer, adopt the excitation wavelength of 560nm, detect the fluorescence intensity level of wavelength at three-wavelength place, wherein said the first wavelength is in 560nm to 590nm scope, described second wave length is in 500nm to 540nm scope, and described three-wavelength is in 580nm to 640nm scope;
(3) using the potassium concentration of solution sample described in each as horizontal ordinate or ordinate, taking the absorbance of first wave strong point that records in step (2) or the absorbance of the absorbance of Second Wave strong point or first wave strong point and the ratio of absorbance of Second Wave strong point or the fluorescence intensity level at three-wavelength place as ordinate or horizontal ordinate mapping, thereby obtain the typical curve of potassium concentration;
(4) in testing liquid sample, add and can form the DNA molecular of G-tetra-serobilas, compound and the damping fluid of formula I, so that the concentration of the compound of the concentration of the DNA molecular that can form G-tetra-serobilas in testing liquid sample, formula I and pH value are consistent with the solution sample in step (1), thereby obtain test solution;
(5) test solution obtaining in step (4) is placed under ultraviolet-visible absorption spectrometer or spectrophotometer, detect test solution at the first wavelength and Second Wave strong point absorbance, or described test solution is placed under fluorescence spectrophotometer, adopt the excitation wavelength of 560nm, detect the fluorescence intensity level at three-wavelength place;
(6) in the potassium concentration typical curve that utilizes the absorbance of the absorbance of the first wave strong point recording in step (5) or the absorbance of Second Wave strong point or first wave strong point to obtain in step (3) with the ratio of the absorbance of Second Wave strong point or the fluorescence intensity level at three-wavelength place, find the potassium concentration value of corresponding test solution, then calculate the potassium concentration of testing sample by the extension rate of testing sample quilt
Wherein said cyanine dyes is the compound of formula I,
Wherein: R 1for C 1-C 6the phenyl that replaces of alkyl, phenyl, alkyl; R 2and R 3independently selected from H or C 1-C 6alkyl, or R 2and R 3together with the carbon atom connecting with them, form the ring structure of 5 yuan to 7 yuan; R 4and R 5independently selected from H or C 1-C 6alkyl, or R 4and R 5together with the carbon atom connecting with them, form the ring structure of 5 yuan to 7 yuan; R 6and R 7for C 1-C 6the C that alkyl or sulfonic group replace 1-C 6alkyl; If R 6and R 7for alkyl, Y is halide anion; If R 6and R 7only have one with sulfonate radical, Y does not exist; If R 6and R 7all, with sulfonate radical, Y is triethylamine kation; X 1, X 2independently selected from C, O, S, Se or Te.
2. a method for potassium concentration in tracer liquid sample under sodion background, said method comprising the steps of:
(1) the different multiple solution samples of buffer preparation potassium concentration of use pH6.2~8.2, the DNA molecular that can form G-tetra-serobilas, the sodion of same concentrations and the cyanine dyes of same concentrations that wherein in each described solution sample, contain same concentrations, the Na ion concentration in wherein said solution sample is in 10 to 200mmol/L scope;
(2) described multiple solution samples are placed under ultraviolet-visible absorption spectrometer or spectrophotometer, detect the absorbance of described solution sample at the first wavelength and the 4th wavelength place, or described multiple solution samples are placed under fluorescence spectrophotometer, adopt the excitation wavelength of 560nm, detect the fluorescence intensity level of wavelength at three-wavelength place, wherein said the first wavelength is in 560nm to 590nm scope, described the 4th wavelength is in 610nm to 670nm scope, and described three-wavelength is in 580nm to 640nm scope;
(3) using the potassium concentration of solution sample described in each as horizontal ordinate or ordinate, taking each solution sample of recording in step (2) at the absorbance of first wave strong point or the absorbance of the absorbance at the 4th wavelength place or first wave strong point and the ratio of absorbance at the 4th wavelength place or the fluorescence intensity level at three-wavelength place as ordinate or horizontal ordinate mapping, thereby obtain the typical curve of potassium concentration;
(4) in testing liquid sample, add and can form the DNA molecular of G-tetra-serobilas, compound and the damping fluid of formula I, so that the concentration of the compound of the concentration of the DNA molecular that can form G-tetra-serobilas in testing liquid sample, formula I and pH value are consistent with the solution sample in step (1), thereby obtain test solution;
(5) test solution obtaining in step (4) is placed under ultraviolet-visible absorption spectrometer or spectrophotometer, detect the absorbance of described test solution at described the first wavelength and described the 4th wavelength place, or described test solution is placed under fluorescence spectrophotometer, adopt the excitation wavelength of 560nm, detect the fluorescence intensity level of wavelength at described three-wavelength place;
(6) in the potassium concentration typical curve that utilizes the absorbance of the absorbance of the first wave strong point recording in step (5) or the absorbance at the 4th wavelength place or first wave strong point to obtain in step (3) with the ratio of the absorbance at the 4th wavelength place or the fluorescence intensity level at three-wavelength place, find the potassium concentration value of corresponding test solution, then calculate the potassium concentration of testing sample by the extension rate of testing sample quilt
Wherein said cyanine dyes is the compound of formula I,
Wherein: R 1for C 1-C 6the phenyl that replaces of alkyl, phenyl, alkyl; R 2and R 3independently selected from H or C 1-C 6alkyl, or R 2and R 3together with the carbon atom connecting with them, form the ring structure of 5 yuan to 7 yuan; R 4and R 5independently selected from H or C 1-C 6alkyl, or R 4and R 5together with the carbon atom connecting with them, form the ring structure of 5 yuan to 7 yuan; R 6and R 7for C 1-C 6the C that alkyl or sulfonic group replace 1-C 6alkyl; If R 6and R 7for alkyl, Y is halide anion; If R 6and R 7only have one with sulfonate radical, Y does not exist; If R 6and R 7all, with sulfonate radical, Y is triethylamine kation; X 1, X 2independently selected from C, O, S, Se or Te.
3. method as claimed in claim 1 or 2, wherein said C 1-C 6alkyl be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
4. method as claimed in claim 1 or 2, wherein R 1be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl, isohesyl, phenyl, aminomethyl phenyl or 3,5-dimethylphenyl; R 2, R 3, R 4and R 5independently selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
5. method as claimed in claim 1 or 2, wherein said 5 yuan is the saturated or unsaturated ring structure that contains or do not contain N or S atom to 7 ring structures.
6. method as claimed in claim 1 or 2, wherein Y is selected from fluorine, chlorine, bromine, iodine negative ion or triethylamine kation.
7. the method for claim 1, wherein said damping fluid is selected from tris-HCI buffer, boric acid-borate buffer solution, triethanolamine damping fluid, imidazoles-hydrochloride buffer, glycylglycine damping fluid or 2-amino-2-methyl-1-propanol damping fluid.
8. method as claimed in claim 2, wherein said damping fluid is selected from tris-HCI buffer, boric acid-borate buffer solution, triethanolamine damping fluid, imidazoles-hydrochloride buffer, glycylglycine damping fluid, 2-amino-2-methyl-1-propanol damping fluid, sodium phosphate-dibastic sodium phosphate damping fluid, barbital sodium-hydrochloride buffer, citric acid-sodium citrate damping fluid, glycocoll-sodium hydrate buffer solution, borax-sodium hydrate buffer solution or sodium phosphate buffer.
9. method as claimed in claim 1 or 2, in wherein said solution sample, the scope of potassium concentration is preferably in 0 to 200mmol/L scope; The concentration of described cyanine dyes in solution sample is in the scope of 3 to 20 μ mol/L; The concentration of the described DNA molecular that can form G-tetra-serobilas in solution sample is in the scope of 3 to 30 μ mol/L.
CN201210206227.2A 2012-06-18 2012-06-18 Potassium ion concentration detection method Active CN102735664B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210206227.2A CN102735664B (en) 2012-06-18 2012-06-18 Potassium ion concentration detection method

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201210206227.2A CN102735664B (en) 2012-06-18 2012-06-18 Potassium ion concentration detection method
PCT/CN2013/077335 WO2013189265A1 (en) 2012-06-18 2013-06-17 Method, system, and kit for detecting potassium ion concentration

Publications (2)

Publication Number Publication Date
CN102735664A CN102735664A (en) 2012-10-17
CN102735664B true CN102735664B (en) 2014-12-10

Family

ID=46991548

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210206227.2A Active CN102735664B (en) 2012-06-18 2012-06-18 Potassium ion concentration detection method

Country Status (1)

Country Link
CN (1) CN102735664B (en)

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013189265A1 (en) * 2012-06-18 2013-12-27 中国科学院化学研究所 Method, system, and kit for detecting potassium ion concentration
CN103048301B (en) * 2012-12-18 2015-12-23 中国科学院化学研究所 Sodium/potassium ion is than detection method, system and kit
CN103063629B (en) * 2012-12-18 2016-03-16 中国科学院化学研究所 Detect the method for sodium/potassium ion ratio and kit and system
CN103115904B (en) * 2013-01-24 2016-12-28 中国科学院化学研究所 Urine microalbumin detection method, system and test kit
CN103645148A (en) * 2013-11-28 2014-03-19 中山鼎晟生物科技有限公司 Method and reagent for detecting nutrition ingredient in food
CN104458728A (en) * 2014-12-08 2015-03-25 中国科学院化学研究所 Method for detecting concentration of sodium ions
CN104596959A (en) * 2015-01-22 2015-05-06 中国科学院化学研究所 Method for detecting potassium ion concentration based on DNA enzymes
CN105651751A (en) * 2016-01-29 2016-06-08 南京大学 Method for detecting physiologically-active small molecules in organisms based on nucleic acid technology
CN107632158A (en) * 2016-07-18 2018-01-26 中国科学院化学研究所 The method and kit of cysteine in determination sample
CN107314976A (en) * 2017-05-26 2017-11-03 中国科学院化学研究所 Purposes and application of the composition in detection potassium concentration
CN107229975B (en) * 2017-05-31 2020-04-07 四川大学 Molecular logic gate construction method based on interaction of cyanine dye and metal ions
CN110186892B (en) * 2019-06-26 2021-09-28 苏州健雄职业技术学院 Glutamine detection method based on double-enzyme coupling

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6001657A (en) * 1995-10-12 1999-12-14 North Carolina State University Antibodies that selectively bind quadruplex nucleic acids
CN101587066A (en) * 2008-05-23 2009-11-25 中国科学院化学研究所 The new purposes of cyanine dyes in detecting G-four serobila structural DNAs
CN102253017A (en) * 2011-04-07 2011-11-23 鲁东大学 Fluorescence detection method for potassium ions
CN102417925A (en) * 2011-09-07 2012-04-18 天津希恩思生化科技有限公司 Reagent for detecting content of potassium ions in blood and preparation method thereof as well as kit containing same

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8129111B2 (en) * 2005-04-22 2012-03-06 The Hong Kong University Of Science And Technology Fluorescent water-soluable conjugated polyene compounds that exhibit aggregation induced emission and methods of making and using same

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6001657A (en) * 1995-10-12 1999-12-14 North Carolina State University Antibodies that selectively bind quadruplex nucleic acids
CN101587066A (en) * 2008-05-23 2009-11-25 中国科学院化学研究所 The new purposes of cyanine dyes in detecting G-four serobila structural DNAs
CN102253017A (en) * 2011-04-07 2011-11-23 鲁东大学 Fluorescence detection method for potassium ions
CN102417925A (en) * 2011-09-07 2012-04-18 天津希恩思生化科技有限公司 Reagent for detecting content of potassium ions in blood and preparation method thereof as well as kit containing same

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
G-Quadruplex-Modulated Fluorescence Detection of Potassium in the Presence of a 3500-Fold Excess of Sodium Ions;Haixia Qin etal;《Anal. Chem.》;20101001;第82卷(第19期);第8357页第4-7段、第8358页、第8360页第2段和图2-3、图6、表2 *
Haixia Qin etal.G-Quadruplex-Modulated Fluorescence Detection of Potassium in the Presence of a 3500-Fold Excess of Sodium Ions.《Anal. Chem.》.2010,第82卷(第19期), *
杨千帆 等.识别人体端粒DNA G-四链体的染料结构设计及光谱研究.《光谱学与光谱分析》.2008,第28卷(第10期), *
识别人体端粒DNA G-四链体的染料结构设计及光谱研究;杨千帆 等;《光谱学与光谱分析》;20081031;第28卷(第10期);第291页第1段和图1 *

Also Published As

Publication number Publication date
CN102735664A (en) 2012-10-17

Similar Documents

Publication Publication Date Title
CN102735664B (en) Potassium ion concentration detection method
CN102735623B (en) Potassium ion concentration detection kit and system thereof
CN102866148B (en) Potassium ion concentration detection method
Zhou et al. Design principles of spectroscopic probes for biological applications
CN102866149B (en) Detection kit for potassium ion concentration
CN103698324A (en) Air formaldehyde self testing kit
CN103048301B (en) Sodium/potassium ion is than detection method, system and kit
CN103063629B (en) Detect the method for sodium/potassium ion ratio and kit and system
WO2013189265A1 (en) Method, system, and kit for detecting potassium ion concentration
CN105784699A (en) Potassium ion reagent with better stability and higher sensitivity and detection method
CN104596959A (en) Method for detecting potassium ion concentration based on DNA enzymes
CN103091316A (en) Urine microalbumin detection method and kit
CN103115904B (en) Urine microalbumin detection method, system and test kit
CN101464299A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101169431A (en) Potassium diagnosis/determination reagent kit and potassium concentration determination method
CN104458728A (en) Method for detecting concentration of sodium ions
CN109374618A (en) A kind of detection method of nitrite anions
CN101464393A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101464407A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101464397A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101464405A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101464404A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101464396A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method
CN101169434A (en) Potassium diagnosis/determination reagent kit and potassium concentration determination method
CN101464403A (en) Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant