CN102703577B - Gene chip and detection method thereof - Google Patents
Gene chip and detection method thereof Download PDFInfo
- Publication number
- CN102703577B CN102703577B CN201110030868.2A CN201110030868A CN102703577B CN 102703577 B CN102703577 B CN 102703577B CN 201110030868 A CN201110030868 A CN 201110030868A CN 102703577 B CN102703577 B CN 102703577B
- Authority
- CN
- China
- Prior art keywords
- probe
- gene
- gene chip
- chip
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a gene chip and a detection method thereof. The invention discloses a method for establishing a gene chip capable of rapidly detecting six animal-origin zoonoses by using the molecular biology technology. The method is to fix specific probes on a chip solid-phase support matrix membrane. The probes can specifically detect six pathogens of avian influenza virus, rabies virus, streptococcus suis II, bacillus anthracis, salmonella and escherichia coli O157. Being applied in practical inspection and quarantine of ports, the gene chip method established by the invention can fast, accurately and specifically detect the six animal-origin zoonoses, and especially has particularly prominent significance for mass quarantine of entry-exit inspection and quarantine departments.
Description
Technical field
The present invention relates to detection technique field, in particular a kind of gene chip that can six kinds of animal derived Amphixenosises of rapid detection.
Background technology
Bird flu (Avian influenza, AI), rabies (Rabies), streptococcus suis 2-type (Streptococcus suis II, SS2), anthrax (Anthrax), Salmonellas (Salmonella), Escherichia coli O 157 (Escherichia coli O157) be occur in recent years comparatively general, with six kinds of animal derived Amphixenosis's transmissible diseases that people live closely bound up, brought very large harm once to people's Health and Living.There is the extensive popular public health event of SS2 respectively at 1998,2005 in Jiangsu and Sichuan wherein, and cause casualties, and has every year the case of distributing in recent years in southern each province; Once there is high pathogenic avian influenza (HPAI) popular event respectively at 1997,2004 in Hong Kong and Taiwan, causes millions of bird to be catched and killed and have people to infect the report of H5N1 death; Rabies are as a kind of ancient disease, certainly after report, are dispersed in every year case and occur, and it is reported that China is only second to India to belong to the country of second largest rabies morbidity in the world; Salmonellas and intestinal bacteria mainly drink water by pollution and the mode of food causes colony's morbidity; Bacillus anthracis is a kind of important diseases of herbivorous animal, and the mankind can be by the meat of contact infection animal and infection animal, hair leather goods infection morbidity.
Mostly be at present separation and Culture, biochemical identification, round pcr and the relevant Serologic test of pathogenic agent for above Amphixenosis's traditional diagnosis method, above diagnostic method process is loaded down with trivial details, take long and accuracy is not high, bacterium and virus for many serotype, many hypotypes more can accurately not determine its classification, are prone to false positive and once can only differentiate a few cause of disease but round pcr accuracy is relatively high.
Therefore, prior art has yet to be improved and developed.
Summary of the invention
The object of the present invention is to provide a kind of gene chip and detection method thereof, the procedure that is intended to solve existing diagnosis cause of disease is loaded down with trivial details, take long and the not high problem of accuracy.
Technical scheme of the present invention is as follows:
A kind of gene chip, wherein, is fixed with 6 species specificity probes on the matrix membrane of described gene chip; Described specific probe is respectively avian influenza virus probe, rabies virus probe, streptococcus suis 2-type probe, anthrax-bacilus probe, Salmonellas probe, Escherichia coli O 157 probe.
Described gene chip, wherein, described avian influenza virus probe sequence is as shown in SEQ NO.1; Described rabies virus probe sequence is as shown in SEQ NO.2; Streptococcus suis 2-type probe sequence is as shown in SEQ NO.3; Salmonellas probe sequence comprises 3, respectively as shown in SEQ NO.4～6; Bacillus anthracis probe is as shown in SEQ NO.7; Escherichia coli O 157 probe sequence comprises 3, respectively as shown in SEQ NO.8～10.
Described gene chip, wherein, 5 ' end mark 15-30Poly T of described specific probe.
Described gene chip, wherein, described matrix membrane is silicon wafer, glass or macromolecular material.
The preparation method of above-mentioned gene chip, wherein, comprises the following steps:
CapB gene, the invA gene of Salmonellas and the rfbE gene order of Escherichia coli O 157 of the NS gene of S1, the M1 gene of choosing respectively avian influenza virus on GenBank, rabies virus, the CPS gene of streptococcus suis 2-type, Bacillus anthracis, utilize bioinformatics software Primer Express 2.0 to design specific probe;
S2, synthetic specific probe;
S3, use DR.Fast Spot chip point sample instrument system by specific probe according to the matrix point sample of design in advance, drying at room temperature 10min; Every part of gene chip all at least comprises a positive control and a negative control;
S4, irradiate gene chip 7～10 minutes with UV-crosslinked instrument, irradiation energy is 1.2J, to fix specific probe, finally uses successively Milli-Q water and 95% washing with alcohol, dry.
The preparation method of described gene chip, wherein, described S2 step also comprises: at 5 ' end mark 15-30Poly T of specific probe, be fixed on matrix membrane so that specific probe is fine.
The preparation method of described gene chip, wherein, described positive control is poly PolyT, negative control is ddH2O.
The detection method that uses said gene chip, wherein, comprises the following steps:
S1, the design of detection cause of disease Auele Specific Primer: on GenBank, choose respectively the M1 gene of avian influenza virus, the NS gene of rabies virus, the CPS gene of streptococcus suis 2-type, CapB gene, the invA gene of Salmonellas and the rfbE gene order of Escherichia coli O 157 of Bacillus anthracis, utilize bioinformatics software Primer Express 2.0 to design cause of disease Auele Specific Primer; And at the right upstream primer mark vitamin H biotin of cause of disease Auele Specific Primer;
S2, nucleic acid extraction: use DNA/RNA magnetic bead to extract the nucleic acid of test kit extraction testing sample, obtain the template that next step nucleic acid amplification is used;
S3, carry out PCR or RT-PCR amplification: according to the individuality of testing sample and disease type, carry out different test items, and select amplification method and test kit;
S4, hybridization: each 10～20 μ L of product that get the PCR of S3 step or RT-PCR amplification fully mix with the DR. hybridization buffer of 200 μ L, and boiling water sex change 6min, is transferred to rapidly 10min on ice; Said mixture is transferred to gene chip indoor, tiling evenly, avoids producing in bottom bubble, in vibration incubator, hybridizes 45-60min, and hybridization temperature is 47 ℃; Discard hybridization solution, with DR. washings washing three times; The mixed solution that adds 0.2 μ L Strep-AP and 200 μ L confining liquids in hybridization chamber, room temperature reaction 30min, discards confining liquid, with DR. washings repeated washing three times, absorbs residual moisture on chip;
S5, colour developing: each gene chip chamber adds the mixed solution of 4 μ L NBT/BCIP and 196 μ L DR. detection liquid, chip is placed in to darkroom and reacts 5-10min, discards detection liquid, till water flushing is clear to hybridization point;
S6, reading result: utilize chip reaction instrument scanning reading result.
The detection method of described gene chip, wherein, in described S3 step, streptococcus suis 2-type, anthrax-bacilus, Escherichia coli O 157, Salmonellas, use TaKaRa PCR Amplification test kit, carry out pcr amplification according to the step on test kit, reaction conditions is 94 ℃ of 3min, 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 40s, 72 ℃ of 10min, 35 circulations; Avian influenza virus, rabies virus, use TaKaRa One Step RT-PCR test kit, carries out RT-PCR amplification according to the step on test kit, and reaction conditions is respectively 50 ℃ of 30min, 94 ℃ of 3min, 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 40s, 72 ℃ of 10min, 35 circulations.
Beneficial effect of the present invention: gene chip of the present invention can specific detection avian influenza virus, rabies virus, streptococcus suis 2-type, Bacillus anthracis, Salmonellas and six kinds of cause of diseases of Escherichia coli O 157.Put into practice port quarantine by being applied to, the method for gene chip that the present invention sets up can the above-mentioned six kinds of animal derived Amphixenosises of quick, accurate, specific detection, especially seem particularly outstanding for the inspection and quarantining for import/export department meaning of quarantine in enormous quantities.
Accompanying drawing explanation
Fig. 1 is the detected result figure that uses gene chip of the present invention in the embodiment of the present invention 1.
Fig. 2 is the detected result figure that uses gene chip of the present invention in the embodiment of the present invention 2.
Fig. 3 is the result figure that uses electrophoresis detection PCR product in embodiment 2.
Fig. 4 is the detected result figure that uses gene chip of the present invention in the embodiment of the present invention 3.
Embodiment
For making object of the present invention, technical scheme and advantage clearer, clear and definite, developing simultaneously referring to accompanying drawing, the present invention is described in more detail for embodiment.
Biochip technology is a kind of brand-new analysis and detection technology that the nineties is set up, and is progressively to grow up along with carrying out of the Human Genome Project.Protocols in Molecular Biology, ic manufacturing technology, computer technology, semiconductor technology, confocal laser scanning technique, fluorescent mark technology have been used in this technological synthesis, make that the detection of sample has that susceptibility is high, high specificity, large scale integration, automatization, easy and simple to handle, quick, the advantages such as high-level efficiency.The fields such as gene expression spectrum analysis, gene identification, transgenation and polymorphism analysis, medical diagnosis on disease and prediction, drug screening, gene sequencing are widely used at present.
The object of this invention is to provide a kind of gene chip and manufacture method and using method for detection of comprising six kinds of animal derived Amphixenosises such as bird flu, rabies, streptococcus suis 2-type, anthrax, Salmonellas, Escherichia coli O 157.The gene chip providing in the present invention and detection method are through Preliminary Applications in port quarantine, and discovery can the above-mentioned six kinds of pathogenic agent of quick, accurate, specific detection.
In the present invention, gene chip is chosen respectively the M1 gene of avian influenza virus, the NS gene of rabies virus, the CPS gene of streptococcus suis 2-type, CapB gene, the invA gene of Salmonellas and the rfbE gene order of Escherichia coli O 157 of Bacillus anthracis, utilize bioinformatics software Primer Express 2.0 to design specific probe, probe sequence is as shown in SEQ NO.1～10.
Avian influenza virus probe AIV P sequence is 27T-TCAAAGCCGAGATCGCGCA GAGA.
Rabies virus probe RV P sequence is 25T-TCAGCAATCAGAGTGGGCA CAGTTG.
Streptococcus suis 2-type probe SS2P sequence is 26T-CAATGTTGCCGTCAACAATAT CATCAGA.
Salmonellas probe sequence comprises 3: Sa P1 sequence is 15T-CTGTTTACCG GGCATACCAT; Sa P2 sequence is 15T-AATACCGGCCTTCAAATCGG; Sa P3 sequence is 15T-TTCCCTTTCCAGTACGCTTC.
Bacillus anthracis probe An P sequence is 28T-TCGGTGAGCAACGCAGGGT AGTTAA.
Escherichia coli O 157 probe sequence comprises 3: O15 P1 sequence is 15T-CAACCATTCCACCTTCACCT; O157 P2 sequence is 15T-GTGACAACCATTCCACCTTC; O157 P3 sequence is 15T-TGTACAGCTAATCCTTGGCC.
The preparation method's of gene chip of the present invention concrete steps are as follows:
S1, design detect the specific probe of cause of disease: on GenBank, choose respectively the M1 gene of avian influenza virus, the NS gene of rabies virus, the CPS gene of streptococcus suis 2-type, CapB gene, the invA gene of Salmonellas and the rfbE gene order of Escherichia coli O 157 of Bacillus anthracis, utilize bioinformatics software Primer Express 2.0 to design specific probe;
S2, specific probe synthesize: synthetic by Shanghai Chao Shi biotechnology company;
S3, specific probe processing: at 5 ' end mark 15-30Poly T of specific probe, be fixed on matrix membrane so that specific probe is fine; The material of matrix membrane can be silicon wafer, glass or polymer;
S4, point sample: gained specific probe is dissolved in respectively in 2x probe dilution liquid, after mixing, use DR.Fast Spot chip point sample instrument system by specific probe according to the matrix point sample of design in advance, drying at room temperature 10min; Every part of gene chip all at least comprises a positive control and a negative control; Wherein, positive control is poly PolyT, and negative control is ddH2O;
S5, fixing: UV-crosslinked instrument is fixed (254nm, 1.2J) 7～10 minutes, uses successively Milli-Q water (ultrapure water being obtained by the processing of Milli-Q ultrapure water system) and 95% washing with alcohol is dry.
The concrete steps of the detection method of gene chip of the present invention are as follows:
S1, pcr amplification:
(1) detect the design of cause of disease Auele Specific Primer: on GenBank, choose respectively the M1 gene of avian influenza virus, the NS gene of rabies virus, the CPS gene of streptococcus suis 2-type, CapB gene, the invA gene of Salmonellas and the rfbE gene order of Escherichia coli O 157 of Bacillus anthracis, utilize bioinformatics software Primer Express 2.0 to design Auele Specific Primer; The wherein upstream primer mark vitamin H biotin of every kind of corresponding primer pair of cause of disease;
(2) nucleic acid extraction: take DNA/RNA magnetic bead to extract test kit to the sample extraction nucleic acid of taking, obtain next step nucleic acid amplification template;
(3) PCR and RT-PCR amplification: according to the individuality of testing sample and disease type, carry out different test items, and select amplification method and test kit.Streptococcus suis 2-type, anthrax-bacilus, Escherichia coli O 157, Salmonellas, used TaKaRaPCR Amplification test kit, carries out pcr amplification according to the step on test kit, reaction conditions is 94 ℃ of 3min, 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 40s, 72 ℃ of 10min, 35 circulations; Avian influenza virus, rabies virus, use TaKaRa One Step RT-PCR test kit, carries out RT-PCR amplification according to the step on test kit, and reaction conditions is respectively 50 ℃ of 30min, 94 ℃ of 3min, 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 40s, 72 ℃ of 10min, 35 circulations.
S2, hybridization: each 10～20 μ L of PCR product of testing sample nucleic acid fully mix with the DR. hybridization buffer of 200 μ L (a kind of product line abbreviation of diagnostic biochip that DR. develops for Taiwan Jing Yu company), boiling water sex change 6min, is transferred to rapidly 10min on ice; Said mixture is transferred to chip indoor, tiling evenly, avoids producing in bottom bubble, in vibration incubator, hybridizes 45-60min, and hybridization temperature is 47 ℃; Discard hybridization solution, with DR. washings washing three times; The mixed solution that adds 0.2 μ L Strep-AP and 200 μ L confining liquids in hybridization chamber, room temperature reaction 30min, discards confining liquid, with DR. washings repeated washing three times, absorbs residual moisture on chip;
S3, colour developing: each chip chamber adds the mixed solution of 4 μ L NBT/BCIP and 196 μ L DR. detection liquid, chip is placed in to darkroom and reacts 5-10min, discards detection liquid, till water flushing is clear to hybridization point;
S4, reading result: utilize chip reaction instrument scanning reading result.
In following examples, the point sample matrix of the probe in gene chip of the present invention is as shown in table 1.Wherein, the positive contrast of some A, the negative contrast of some B.
Table 1
| Poly T | RV P1 | RV P1 | RV P2 | ||||
| RV P2 | AIV P | AIV P | SS2 P1 | ||||
| SS2 P1 | SS2 P2 | SS2 P2 | An P | ||||
| An P | Sa P1 | Sa P1 | Sa P2 | ||||
| Sa P2 | Sa P3 | Sa P3 | O157 P1 | ||||
| O157 P1 | O157 P2 | O157 P2 | O157 P3 | ||||
| O157 P3 | H2O | Poly T |
Embodiment 1
The present embodiment is the case of gene chip of the present invention and 6 kinds of positive hybridization of cause of disease.
S1, pcr amplification:
(1) detect the design of cause of disease Auele Specific Primer: on GenBank, choose respectively the M1 gene of avian influenza virus, the NS gene of rabies virus, the CPS gene of streptococcus suis 2-type, CapB gene, the invA gene of Salmonellas and the rfbE gene order of Escherichia coli O 157 of Bacillus anthracis, utilize bioinformatics software Primer Express 2.0 to design specific probe; The wherein upstream primer mark vitamin H biotin of every kind of corresponding primer pair of cause of disease;
(2) nucleic acid extraction: using CapB gene, the invA gene of Salmonellas and the rfbE gene order of Escherichia coli O 157 of the CPS gene of the NS gene of the M1 gene of avian influenza virus, rabies virus, streptococcus suis 2-type, Bacillus anthracis as next step nucleic acid amplification template;
(3) PCR and RT-PCR amplification: streptococcus suis 2-type, anthrax-bacilus, Escherichia coli O 157, Salmonellas, use TaKaRa PCR Amplification test kit, carry out pcr amplification according to the step on test kit, reaction conditions is 94 ℃ of 3min, 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 40s, 72 ℃ of 10min, 35 circulations; Bird flu, rabies virus, use TaKaRa One Step RT-PCR test kit, carries out RT-PCR amplification according to the step on test kit, and reaction conditions is respectively 50 ℃ of 30min, 94 ℃ of 3min, 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 40s, 72 ℃ of 10min, 35 circulations.
S2, hybridization: the each 10 μ L of PCR product that get six kinds of cause of diseases fully mix with the DR. hybridization buffer of 200 μ L, and boiling water sex change 6min, is transferred to rapidly 10min on ice; Said mixture is transferred to chip indoor, tiling evenly, avoids producing in bottom bubble, in vibration incubator, hybridizes 45-60min, and hybridization temperature is 47 ℃; Discard hybridization solution, with DR. washings washing three times; The mixed solution that adds 0.2 μ L Strep-AP and 200 μ L confining liquids in hybridization chamber, room temperature reaction 30min, discards confining liquid, with DR. washings repeated washing three times, absorbs residual moisture on chip;
S3, colour developing: each chip chamber adds the mixed solution of 4 μ L NBT/BCIP and 196 μ L DR. detection liquid, chip is placed in to darkroom and reacts 5-10min, discards detection liquid, till water flushing is clear to hybridization point;
S4, reading result: utilize chip reaction instrument scanning reading result.
As shown in Figure 1, hybridization spot is corresponding one by one with point sample matrix for gene chip of the present invention and six kinds of positive results of hybridization of cause of disease, represent 6 kinds of cause of disease nucleic acid to have been detected, wherein, the positive contrast of some A, the negative contrast of some B.
Embodiment 2
The pharynx anus swab of Zhuhai City's chicken house wish for Australia chicken received in Dong Jian laboratory, Zhuhai Entry-Exit Inspection and Quarantine Bureau technique center, and totally 23 batches, preliminary examination project is avian influenza virus.10 batches that choose is wherein the gene chip diagnosis method of object to set up in check the present invention, uses conventional PCR detection and method for gene chip comparison simultaneously.Concrete implementation step is as follows:
1, sample pretreatment: will fowl pharynx anus swab only put into the clean centrifuge tube of 10ml after autoclaving after shearing, add the dual anti-solution of penicillin and streptomycin of 6-8ml4000-6000 units per ml, 4 ℃ of soaked overnight (or several hours, depend on the circumstances).
2, the extraction of nucleic acid: get the above-mentioned pharynx anus of 200 μ L swab soak solution and add in 1.5ml EP pipe, add lysate TRizol 600 μ L and the chloroform 200 μ L of 4 ℃ of precoolings, after fully mixing, the centrifugal 15min of 12000rpm; The supernatant liquor of getting 300 μ L after centrifugal moves in another new 1.5ml EP pipe, adds the Virahol of 300 μ L precoolings, fully mixes the centrifugal 15min of rear 12000rpm; After centrifugal, discard liquid in pipe, add 75% ethanol of 600 μ L precoolings, fully mix the centrifugal 10min of rear 12000rpm; After centrifugal, discard liquid in pipe, EP pipe is upside down on paper handkerchief, dry, add 20 μ L DEPC water dissolution.Above step is all carried out except centrifugal in stink cupboard.
3, pcr amplification: use TaKaRa One Step RT-PCR test kit, reaction system 50 μ L:2 × 1 step Buffer get 25 μ L, the each 2.5 μ L of upstream and downstream primer of 10 μ mol/L, Prime Script 1Step Enzyme Mix 1.0 μ L, RNA template 5 μ L, RNase Free H
2o up to 50 μ L(primer sequence: F:Biotin-CGTTCTCTCTATCGTCCCRTCAG; R:TCTTGTCTTT AGCCATTCCATGAG).Reaction conditions: 50 ℃ of 30min, 94 ℃ of 3min, 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 40s, 72 ℃ of 10min, 35 circulations.
4, hybridization: get above-mentioned PCR product 20 μ L and fully mix with the DR. hybridization buffer of 200 μ L, boiling water sex change 6min, is transferred to rapidly 10min on ice; Said mixture is transferred to chip indoor, tiling evenly, avoids producing in bottom bubble, in vibration incubator, hybridizes 45-60min, and hybridization temperature is 47 ℃; Discard hybridization solution, with DR. washings washing three times; The mixed solution that adds 0.2 μ L Strep-AP and 200 μ L confining liquids in hybridization chamber, room temperature reaction 30min, discards confining liquid, with DR. washings repeated washing three times, absorbs residual moisture on chip; Add the mixed solution that 4 μ L NBT/BCIP and 196 μ LDR. detect liquid, chip is placed in to darkroom and reacts 5-10min, discard detection liquid, till water flushing is clear to hybridization point, utilize chip reaction instrument to scan reading result.
5, result is judged: hybridization spot as shown in Figure 2, is confirmed as bird flu after comparing with gene chip sample applying matrix, has 3 batches and occurs the positive, by confirming as H9 after other diagnostic techniquess evaluation hypotypes in 10 batch samples.
Simultaneously, above-mentioned PCR product is detected at 1.5% agarose gel electrophoresis, electrophoresis detection result as shown in Figure 3, only can there are two bands, wherein M representation DNA Marker DL2000,1-10 represents respectively 10 batches of swab samples, 1,2 there is object band 118bp, be that conventional PCR method can only detect two positives, illustrate that the remolding sensitivity method for gene chip provided by the present invention of conventional PCR detection method is low.
Embodiment 3
It is a collection of to the Chinese pig rear foot that certain country's wish import is received in Dong Jian laboratory, Zhuhai Entry-Exit Inspection and Quarantine Bureau technique center, and preliminary examination project is: streptococcus suis 2-type, Escherichia coli O 157, Salmonellas, novel Influenza A H1N1.Detection method is as follows: 1, sample pretreatment: fetch and deliver 10-15 in the inspection pig rear foot (case, 15kg), sampling time-division box surface, centre, three of the bottoms each 3-5 of level.A small amount of meat sample is taked in aseptic technique, and homogenate after mixing, gets supernatant and be divided into four parts, and portion adds the dual anti-solution of penicillin and streptomycin of 4000-6000 units per ml, 4 ℃ of soaked overnight (or several hours, depend on the circumstances).[0045] 2, nucleic acid extraction: adopt the DNA/RNA magnetic bead that Shenzhen City Yirui Bioisystech Co., Ltd produces to extract test kit extraction, concrete steps are carried out according to test kit.
3, pcr amplification: novel Influenza A H1N1 project PCR reacts with embodiment 2.Streptococcus suis 2-type, Escherichia coli O 157, salmonella PCR reaction are used TaKaRa PCR Amplification test kit, reaction system is 50 μ L:10 × Buffer 5.0 μ L, dNTP 4.0 μ L, the each 2 μ L of 10 μ mol/L upstream and downstream primer, Taq archaeal dna polymerase 0.25 μ L, DNA profiling 2 μ L, ddH
2o 35 μ L(primer sequences: streptococcus suis 2-type: F:Biotin-GGTGGTGTTTC AAACGCAAG, R:ACCCTCCCGACAAATCACTA; Escherichia coli O 157: F:Biotin-ATTGCGCTG AAGCCTTTG, R:CGAGTACATTGGCATCGTG; Salmonellas: F:Biotin-GTGA AATTATCGCCACGTTCGGGCAA, R:TCATCGCACCGTCAAAGGAACC); Reaction conditions: 95 ℃ of 5min, 95 ℃ of 15s, 55 ℃ of 30s, 72 ℃ of 1min, 72 ℃ of 10min, 35 circulations.
4, hybridization: get the each 20 μ L of above-mentioned PCR product and fully mix with the DR. hybridization buffer of 200 μ L, boiling water sex change 6min, is transferred to rapidly 10min on ice, below crossover process with embodiment 2.
5, result is judged: hybridization spot as shown in Figure 4, after comparing, is confirmed to contain Escherichia coli O 157 in the pig rear foot with gene chip sample applying matrix.
In embodiment 3, utilize the high-throughout feature of gene chip, can in same reactive tank, detect several even hundreds and thousands of kinds (prerequisite is that solid phase carrier area is enough simultaneously, the probe sequence that mark is corresponding), in shortening detection time, increase test item, especially seemed particularly great for the unit position meaning that requires entry to detect simultaneously.
Should be understood that, application of the present invention is not limited to above-mentioned giving an example, and for those of ordinary skills, can be improved according to the above description or convert, and all these improvement and conversion all should belong to the protection domain of claims of the present invention.
Claims (6)
1. a gene chip, is characterized in that, is fixed with 6 species specificity probes on the matrix membrane of described gene chip; Described specific probe is respectively avian influenza virus probe, rabies virus probe, streptococcus suis 2-type probe, anthrax-bacilus probe, Salmonellas probe, Escherichia coli O 157 probe; Described avian influenza virus probe sequence is as shown in SEQ ID NO.1; Described rabies virus probe sequence is as shown in SEQ ID NO.2; Streptococcus suis 2-type probe sequence is as shown in SEQ ID NO.3; Salmonellas probe sequence is the arbitrary sequence shown in SEQ ID NO.4～6; Bacillus anthracis probe is as shown in SEQ ID NO.7; Escherichia coli O 157 probe sequence is the arbitrary sequence shown in SEQ ID NO.8～10.
2. gene chip according to claim 1, is characterized in that, 5 ' end mark 15-30Poly T of described specific probe.
3. according to the gene chip shown in claim 1, it is characterized in that, described matrix membrane is silicon wafer, glass or polymer.
4. a preparation method for gene chip as claimed in claim 1, is characterized in that, comprises the following steps:
CapB gene, the invA gene of Salmonellas and the rfbE gene order of Escherichia coli O 157 of the NS gene of S1, the M1 gene of choosing respectively avian influenza virus on GenBank, rabies virus, the CPS gene of streptococcus suis 2-type, Bacillus anthracis, utilize bioinformatics software Primer Express2.0 design specific probe, obtain the probe shown in SEQ ID NO.1-10;
S2, synthetic specific probe;
S3, use DR.Fast Spot chip point sample instrument system by specific probe according to the matrix point sample of design in advance, drying at room temperature 10min; Every part of gene chip all at least comprises a positive control and a negative control;
S4, irradiate gene chip 7～10 minutes with UV-crosslinked instrument, irradiation energy is 1.2J, to fix specific probe, finally uses successively Milli-Q water and 95% washing with alcohol, dry.
5. the preparation method of gene chip according to claim 4, is characterized in that, described S2 step also comprises: at 5 ' end mark 15-30Poly T of specific probe, be fixed on matrix membrane so that specific probe is fine.
6. the preparation method of gene chip according to claim 4, is characterized in that, described positive control is poly PolyT, and negative control is ddH2O.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110030868.2A CN102703577B (en) | 2011-01-28 | 2011-01-28 | Gene chip and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110030868.2A CN102703577B (en) | 2011-01-28 | 2011-01-28 | Gene chip and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102703577A CN102703577A (en) | 2012-10-03 |
| CN102703577B true CN102703577B (en) | 2014-05-28 |
Family
ID=46896623
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110030868.2A Expired - Fee Related CN102703577B (en) | 2011-01-28 | 2011-01-28 | Gene chip and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102703577B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3339451B1 (en) * | 2015-08-21 | 2020-05-20 | Mmonitor Inc. | Primers for detecting influenza by using lamp, and use thereof |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103937892B (en) * | 2014-04-21 | 2015-07-29 | 华南农业大学 | The multiple PCR detection primer group of duck source various pathogens and test kit thereof |
| CN105063760A (en) * | 2015-08-07 | 2015-11-18 | 重庆出入境检验检疫局检验检疫技术中心 | Gene chip for identification of seven swine disease pathogens and detection method thereof |
| CN105063204A (en) * | 2015-08-07 | 2015-11-18 | 重庆出入境检验检疫局检验检疫技术中心 | Salmonella sandwich DNA hybridization rapid detection probe, kit, and detection method |
| CN107034313A (en) * | 2017-05-10 | 2017-08-11 | 广东温氏食品集团股份有限公司 | The RT PCR detection primers and RT PCR detection methods of a pair of Sai Nika paddy virus |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101407837A (en) * | 2007-10-12 | 2009-04-15 | 天津生物芯片技术有限责任公司 | Gene chip for detecting blood pathogen and reagent kit for detecting |
| CN101497925A (en) * | 2008-12-17 | 2009-08-05 | 安徽医科大学 | Leber's hereditary optic neuroretinopathy related mtDNA mutant site integrated detection gene chip, as well as preparation and use thereof |
-
2011
- 2011-01-28 CN CN201110030868.2A patent/CN102703577B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101407837A (en) * | 2007-10-12 | 2009-04-15 | 天津生物芯片技术有限责任公司 | Gene chip for detecting blood pathogen and reagent kit for detecting |
| CN101497925A (en) * | 2008-12-17 | 2009-08-05 | 安徽医科大学 | Leber's hereditary optic neuroretinopathy related mtDNA mutant site integrated detection gene chip, as well as preparation and use thereof |
Non-Patent Citations (1)
| Title |
|---|
| 周宗安等.目录.《人畜共患病》.1985,目录第1-2页. * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3339451B1 (en) * | 2015-08-21 | 2020-05-20 | Mmonitor Inc. | Primers for detecting influenza by using lamp, and use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102703577A (en) | 2012-10-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102703577B (en) | Gene chip and detection method thereof | |
| Toohey-Kurth et al. | Metagenomic assessment of adventitious viruses in commercial bovine sera | |
| CN111534635B (en) | Integrated molecular diagnosis system and application thereof in tracing of animal sources of beta coronaviruses | |
| WO2005121367A1 (en) | Diagnostic primers and method for detecting avian influenza virus subtype h5 and h5n1 | |
| Narayanan et al. | Molecular detection of Newcastle disease virus using Flinders Tehnology Associates-PCR | |
| CN102191339B (en) | Preparation method and detection method for gene chip | |
| CN113278735A (en) | Human respiratory virus nucleic acid multiplex detection primer, probe and kit | |
| CN103820558B (en) | Gene chip for detecting nine pathogenicity vibrios in marine products | |
| US20090088331A1 (en) | Influenza virus nucleic acid microarray and method of use | |
| KR102231338B1 (en) | Primers and probes for detection of avian influenza, newcastle disease and avian infectious bronchitis viruses, and detecting method of avian influenza, newcastle disease and avian infectious bronchitis viruses using the same | |
| CN105063760A (en) | Gene chip for identification of seven swine disease pathogens and detection method thereof | |
| Jack et al. | Microarray-based detection of viruses causing vesicular or vesicular-like lesions in livestock animals | |
| CN110499394A (en) | Detect LAMP primer group, kit and the detection method of African swine fever virus | |
| CN110317864A (en) | A method of it is sequenced by macro transcript profile to detect pathogen | |
| CN102337359A (en) | Primers and probe for detecting mouse leukemia virus and method thereof | |
| Singanallur et al. | Probe capture enrichment next-generation sequencing of complete foot-and-mouth disease virus genomes in clinical samples | |
| CN105063237A (en) | Gene chip for identification of six swine disease pathogens and detection method thereof | |
| Xiang et al. | Development and application of a visual microarray for synchronously detecting H5N1, H7N9 and H9N2 avian influenza virus RNA | |
| CN103667538B (en) | Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens | |
| CN111518954A (en) | Primer group, kit and method for double nano PCR detection of H5 and N8 subtype avian influenza virus | |
| WO2006132601A1 (en) | Diagnostic primers and method for detecting avian influenza virus subtype h5 and h5n1 | |
| CN109468416A (en) | The RT-LAMP detection primer of specific detection swine influenza virus and its application, detection reagent and method | |
| CN102329889B (en) | Primer and probe and method for detecting poxvirus muris | |
| Can-Can et al. | Multiplex Nested Solid Phase PCR-Array Chip for Simultaneous Detection of Highly Pathogenic Microorganisms | |
| CN102676691A (en) | H1N1, PRRSV and O-FMDV quadruple detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140528 Termination date: 20150128 |
|
| EXPY | Termination of patent right or utility model |