CN102702311A

CN102702311A - Agent with kokumi

Info

Publication number: CN102702311A
Application number: CN2012101843621A
Authority: CN
Inventors: 大洲竹晃; 竹下亘; 江藤让; 网野裕右; 宫村直宏; 山中智彦; 长崎浩明
Original assignee: Ajinomoto Co Inc
Current assignee: Ajinomoto Co Inc
Priority date: 2005-11-09
Filing date: 2006-11-08
Publication date: 2012-10-03
Also published as: TWI407916B; MY145984A; CN102707070B; CN102707070A; CN103926410A; BRPI0618350A2; BR122015008513B1; BRPI0618350B1; TW200733890A; MY153690A

Abstract

The present invention relates to agent with kokumi, specifically to a method for selecting materials with kokumi through using calcium receptor activity as an index. In the agent with kokumi, the materials with kokumi obtained through the above selecting method are acted as activity ingredients. Thus a method for producing food or drinks, such as food, seasoning and drinks with kokumi can be realized, and food and drinks with kokumi can be produced.

Description

Give the agent of KOKUMI

The application is to be on November 08th, 2006 applying date, and application number is 200680041748.X (international application no is PCT/JP2006/322694), and name is called the dividing an application of application for a patent for invention of " agent of giving KOKUMI ".

Technical field

The application requires the right of priority of following application: the Japanese patent application No.2005-325300 that on November 9th, 2005 submitted to; The Japanese patent application No.2006-188458 that on July 7th, 2006 submitted to; The U.S. Provisional Patent Application No.60/738562 that on November 22nd, 2005 submitted to; The U.S. Provisional Patent Application No.60/807831 that on July 20th, 2006 submitted to applies for reference to incorporating this paper into said.

The present invention relates to be used to screen the method for the material (kokumi-imparting substance) of giving kokumi; Give the agent (kokumi-imparting agent) of kokumi; It contains the material of giving kokumi that obtains through said screening method as activeconstituents; Be used to produce food or beverage for example given kokumi food, seasonings and beverage method and given food or the beverage of kokumi.

Background technology

The calcium acceptor is also referred to as calcium induction acceptor (CaSR), the acceptor of forming by 1078 amino acid, and be categorized in seven times-transmembrane receptor of C class (g protein coupled receptor; GPCR) in.Reported clone's (non-patent document 1) of the gene of this calcium acceptor in 1993, and known when it being activated, waited and cause that various kinds of cell replys through improving the cellular calcium level with calcium etc.The gene order of people's calcium acceptor is registered as GenBank accession number NM_000388, and very conservative in animal.

Aforementioned calcium acceptor can play promotion or prevent the effect of biological function.Therefore, at present, the therapeutical agent of activator that can be used as the calcium acceptor and suppressor factor is suitably used in sacred disease, hepatopathy, cardiovascular disorder, digestive system and other treatment of diseases according to pathological state.For example, the calcium acceptor can detect the increase of calcium level in the parathyroid gland (parathyroid), and the secretion of preventing Rat parathyroid hormone 1-34 (PTH) is to revise calcium level.Therefore, expection calcium receptor activators has the effect that reduces calcium level.In fact illustrated when using the calcium receptor activators to treat the secondary hyperparathyroidism (secondary hyperparathyroidism) in the hemodialysis patients, it reduces PTH level and does not improve the level of calcium and phosphorus.

Because the functional analysis of calcium acceptor is mainly carried out with regard to calcium homeostasis (calcium homeostasis), so the bone metabolism disease that relates to the calcium adjusting is mainly paid close attention in applied research up to now.Yet, see clearly gradually that from result'ss (non-patent document 2 and 3) such as genetic expression analyses the calcium acceptor extensively is distributed among the live body except that parathyroid gland and kidney, and propose the possibility that they relate to the various biological function and cause disease.For example, estimate that the calcium acceptor relates to the function of liver, the heart, lung, digestive tube, lymphocyte and pancreas.Contriver of the present invention also use the RNAs that from rat tissue, extracts through based on the analysis confirmation of RT-PCR express in the multiple tissue of calcium acceptor in live body.See that from aforementioned viewpoint the activator of calcium acceptor and the using value of suppressor factor increase sharply at present.

In addition, outside the deliming, positively charged ion such as gadolinium (gadolinium) positively charged ion, basic peptide such as poly arginine (polyarginine), polyamines such as spermine, amino acid such as phenylalanine(Phe) etc. have been reported to calcium receptor activators (non-patent document 4).

Although developed up to now as stated as many specificity activator of calcium receptor activators, among them, be present in the live body compound seldom, and the compound activity that is present in the live body is very low.Therefore, the multiple treatment of diseases agent that is used for that contains these activator has and serious relates to side reaction, passes through property and active problem.For example, although known amino acid acts on the calcium acceptor since activity very a little less than, think that amino acid is difficult as the practical application of activator.In addition, although reported macromole such as poly arginine as stated, estimate that said function is based on as the effect with polyvalent cation of erratic composition as activator.That is whether the peptide that, has an ad hoc structure is that useful calcium receptor activators is unknown.

Simultaneously, in food (foodstuff) field, the taste material has been used many years.Particularly, having five kinds of primary tastes is that the material of sweet taste, saline taste, tart flavour, bitter taste and delicate flavour (umami) and the material that strengthens these tastes have been widely used as seasonings.Also there be " kokumi " in taste notion as not representing with above-mentioned taste.The meaning of kokumi is the taste that can not represent with five kinds of primary tastes; And mean such taste; It not only strengthens primary taste; Also strengthen the edge taste (marginal taste) of primary taste, for example mellow sense (thickness), full sense (growth) (profusely sense (mouthfulness)), be continuous sense (continuity) with coordinate to feel (harmony).Reported the several method that is used to give kokumi up to now, reported so far be gsh (glutathione) (patent document 1), gelatin and tropomyosin (tropomyosin) add hot (patent document 2), contain sulfuryl compound (patent document 3), contain the peptide (patent document 4) of Asn-His sequence etc.

Although attempted the exploitation of the material of the multiple kokumi of giving as stated; And mainly the extract to natural product has carried out commercialization, but for example gsh and N-(4-methyl-5-oxygen-1-tetrahydroglyoxaline-2-yl) sarkosine (N-(4-methyl-5-oxo-1-imidazolin-2-yl) sarcosine) come the instance of separation of pure kokumi composition considerably less from natural product extract at present.

Therefore, develop efficient, the safe and cheap material of giving kokumi and expect, and the method that needs a kind of convenience and high-sensitive screening to give the material of kokumi for this purpose.

[non-patent document 1] Nature, 1993 Dec 9; 366 (6455): 575-80

[non-patent document 2] J.Endocrinol., 2000 May, 165 (2): 173-7

[non-patent document 3] Eur.J.Pharmacol., 2002 Jul.5,447 (2-3): 271-8

[non-patent document 4] Cell Calcium., 2004 Mar., 35 (3): 209-16

[patent document 1] Japanese Patent No.1464928

[patent document 2] Japanese Patent Laid-open Publication (KOKAI) No.10-276709

[patent document 3] Japanese Patent Laid-open Publication (KOKAI) No.8-289760

[patent document 4] WO2004/096836

Summary of the invention

[problem that the present invention solves]

An object of the present invention is to provide method convenient and that the material of kokumi is given in high-sensitive screening; Efficiently, the safe and cheap agent of giving kokumi; Be used to produce food or beverage for example given kokumi food, seasonings and beverage method and given the F&B of kokumi.

[method of dealing with problems]

As the result of the activator of searching for the calcium acceptor, contriver of the present invention finds that low molecular peptide (comprising gsh) can activate the calcium acceptor.In addition, because known gsh is the material of giving kokumi, they have assessed as the low molecular peptide of calcium receptor activators whether give kokumi, and find that said low molecular peptide given kokumi.Accomplished the present invention based on these discoveries.

That is, the present invention provides following.

(1) method of the material of kokumi is given in screening, and said method uses calcium receptor active as index.

(2) according to the screening method of (1), the wherein said material of giving kokumi strengthens at least a in saline taste, delicate flavour, sweet taste or the tart flavour.

(3) according to the screening method of (1) or (2), said method comprises: the first step, with calcium acceptor and test substances reaction and detection calcium receptor active; With second step, measure in the first step and detect the effect that the active test substances of calcium receptor activation is given kokumi.

(4) give the agent of kokumi, said agent comprises the material of giving kokumi that can obtain through each method in (1) to (3) as activeconstituents.

(5) according to the agent of giving kokumi of (4), said agent comprises one or more and is selected from following material: γ-Glu-X-Gly (amino acid or the amino acid derivative of X representative except that Cys), γ-Glu-Val-Y (Y represented amino acid or amino acid derivative), γ-Glu-Ala, γ-Glu-Gly, γ-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val, γ-Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met (O), γ-Glu-γ-Glu-Val, γ-Glu-Val-NH ₂, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (O), γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t-Leu and γ-Glu-Cys (S-Me).

(6) agent of giving kokumi of basis (5); Wherein said X is Cys (SNO), Cys (S-allyl group), Gly, Cys (S-Me), Abu or Ser, and Y is Gly, Val, Glu, Lys, Phe, Ser, Pro, Arg, Asp, Met, Thr, His, Orn, Asn, Cys or Gln.

(7) each the agent of giving kokumi in the basis (4) to (6), said agent strengthens saline taste, delicate flavour, sweet taste or tart flavour.

(8) foodstuffs compsns, it contains one or more materials that are selected from each the agent of giving kokumi in the basis (4) to (7) and is selected from one or more materials with active other compound of calcium receptor activation.

(9) according to the foodstuffs compsns of (6), wherein said to have active other compound of calcium receptor activation be calcium, protamine, poly arginine, spermine, polylysine, gsh and plan calcium agent (cinacalcet).

(10) production has been endowed the method for food or the beverage of kokumi; Said method comprises being added into food or beverage according to each one or more agents of giving kokumi in (4) to (7), thereby makes said food or beverage contain the agent of the said kokumi of giving of 1 quality ppb to 99.9 quality %.

(11) production has been endowed the method for food or the beverage of kokumi; Said method comprises seasonings is added into food or beverage; Said seasonings contain 1 quality ppb to 99.9 quality % one or more according to each the agent of giving kokumi in (4) to (7), thereby make said food or beverage contain the said seasonings of 0.01-10 quality %.

The food of having given kokumi or the beverage that (12) can obtain through method according to (9) or (10).

(13) compsn, it contains γ-Glu-Val-Gly of 1 quality ppb to 99.9 quality % and one or more materials that are selected from calcium, protamine, poly arginine, spermine, polylysine, gsh and the agent of plan calcium of 1 quality ppb to 99.9 quality %.

(14) compsn, it contains one or more materials that are selected from gsh, protamine, polylysine, GABA and their salt form of 1 quality ppb to 99.9 quality % and calcium or its salt form of 1 quality ppb to 99.9 quality %.

(15) compound that is expressed from the next:

γ-Glu-X-Gly (X represents Asn, Gln, His, Lys, Orn or Arg) or γ-Glu-Val-Y (Y represents Leu, Ile, Ser, Thr, Met, Cys, Asp, Asn, Gln, Lys, Orn, Arg, Phe, Tyr, Pro, Hyp, Trp, His or Abu).

The purposes that the agent of kokumi is given in the material conduct of giving kokumi that (16) can obtain through each method in (1) to (3).

(17) kokumi is given the method for food or beverage, it comprises the material of giving kokumi that can obtain through each method in (1) to (3) is added into food or beverage.

The invention effect

According to the present invention; The method of providing convenience and giving the material of kokumi with high-sensitive screening; Through obtainable efficient, the safe and cheap agent of giving kokumi of said screening method; Produce food or beverage for example given kokumi food, seasonings and beverage method and given the F&B of kokumi.

The accompanying drawing summary

[Fig. 1] shows the diagram of calcium to the effect of calcium acceptor.

Through microinjection people's calcium acceptor cRNA is introduced xenopous laevis (Xenopus laevis) ovocyte.Write down when adding calcium chloride solution the value of replying electric current (intracellular response current) in the born of the same parents of flowing through with any concentration (arbitrary concentration).The peak of electric current in the born of the same parents is seen the current value that responses.Confirmed in the ovocyte that passes through microinjection introducing zero(ppm) water, not observe and replied as contrast.

[Fig. 2] shows the diagram of L-amino acid to the effect of calcium acceptor.

Through microinjection people's calcium acceptor cRNA is introduced the xenopous laevis ovocyte.Record is replied the value of electric current in the born of the same parents of flowing through when adding 10mM L-amino acid solution.The peak of electric current in the born of the same parents is seen the current value that responses.Confirmed in the ovocyte that passes through microinjection introducing zero(ppm) water, not observe and replied as contrast.

[Fig. 3] shows the diagram of D-amino acid to the effect of calcium acceptor.

Through microinjection people's calcium acceptor cRNA is introduced the xenopous laevis ovocyte.Record is replied the value of electric current in the born of the same parents of flowing through when adding 10mM D-amino acid solution.The peak of electric current in the born of the same parents is seen the current value that responses.Confirmed in the ovocyte that passes through microinjection introducing zero(ppm) water, not observe and replied as contrast.

[Fig. 4] show peptide is to the diagram of the effect of calcium acceptor.

Through microinjection people's calcium acceptor cRNA is introduced the xenopous laevis ovocyte.Record is replied the value of electric current in the born of the same parents of flowing through when adding peptide solution with any concentration.The peak of electric current in the born of the same parents is seen the current value that responses.Confirmed in the ovocyte that passes through microinjection introducing zero(ppm) water, not observe and replied as contrast.

The optimal mode that carries out an invention

Hereinafter, with illustrated in detail the present invention.

In this manual, " calcium acceptor " is also referred to as calcium induction acceptor (CaSR), and belongs to seven times-transmembrane receptor of C class (seven-transmembrane receptor).In this manual, the meaning of " calcium receptor active " is to be bonded to aforementioned calcium acceptor to activate guanine-nucleotide-binding protein and to send signal thus.In addition, in this manual, " calcium receptor activators " is to act on aforementioned calcium acceptor to express the material of function of the cell of calcium acceptor to activate this calcium acceptor and control.

In this manual; The meaning of " kokumi " is can not be by five kinds of primary tastes; The taste of sweet taste, saline taste, tart flavour, bitter taste and delicate flavour (umami) expression wherein, not only makes said primary taste strengthen; The edge taste of primary taste is strengthened, the for example mellow sense of said edge taste, full sense (profusely sense), the sense and coordinate sense of being continuous.In addition; " give the agent of kokumi " or " giving the material of kokumi " refers to following agent or material: it can strengthen five kinds of primary tastes; Sweet taste, saline taste, tart flavour, bitter taste and delicate flavour; And follow said primary taste to give the edge taste of primary taste, for example mellow sense, full sense (profusely sense), the sense and coordinate sense of being continuous.Therefore, the agent of giving kokumi of the present invention can also be used as sweetness enhancers, saline taste toughener, tart flavour toughener, bitter taste toughener or flavour enhancer.For the intensity of kokumi, the meaning of " preceding flavor and middle flavor (first and middle taste) " is the taste that 0-4 experienced during second after edible, and the meaning of " aftertaste (aftertaste) " is the taste of impression after edible back 5 seconds.

In this manual, except as otherwise noted, the whole amino acid and the amino-acid residue that constitute peptide are the L-isomer.

< 1>method of the material of kokumi is given in screening

The method (being also referred to as screening method of the present invention hereinafter) that the material of kokumi is given in the present invention's screening is characterised in that the use calcium receptor active is as index.Particularly, screening method of the present invention comprises: the first step, with calcium acceptor and test substances reaction and detection calcium receptor active; With second step, measure in the first step and detect the effect that the active test substances of calcium receptor activation is given kokumi.

The concrete grammar step of screening method of the present invention is example hereinafter.Yet the step of screening method of the present invention is not limited to these steps.

1) test substances is added into the calcium receptor active measuring system that is used to measure calcium receptor active, and measures calcium receptor active.

Calcium receptor active that obtains when 2) relatively adding test substances and the calcium receptor active that obtains when not adding test substances.

3) be chosen in when adding this test substances, show than the active test substances of high calcium receptor for stimulating.

4) effect that the test substances of measure selecting is given kokumi, and select to have the test substances of the effect of giving kokumi.

For example use the measurement system of the cell of expressing the calcium acceptor to measure calcium receptor active through using.Said cell can be the cell of endogenous expression calcium acceptor, or introduces the reconstitution cell of external source calcium acceptor gene.As aforesaid calcium receptor active measuring system; Can not receive the concrete ground that limits to use any system; As long as will be that part specific born of the same parents outside (activator) is when being added into the cell of expression calcium acceptor for the calcium acceptor; The system that usefulness is selected can detect the combination (reaction) of said activator and calcium acceptor, or in response to the combination (reaction) of said activator and calcium acceptor detectable signal is sent in the cell.When the reaction of test compounds produces calcium receptor active; Then this test compounds is confirmed as that to have a calcium receptor activation active, and be the compound of giving kokumi.

Flavor tests through the people etc. can be confirmed the effect of the aforesaid kokumi of giving.In addition, specifically be not defined for the test substances of screening, and can use low molecular compound, sugar, peptide, protein etc.

As aforesaid calcium acceptor, can be used as preferred embodiment by people's calcium acceptor of the people's calcium acceptor gene coding that is registered as GenBank accession number NM 000388 and come example.In addition; The calcium acceptor is not limited to the protein by the genes encoding of aforementioned sequence; And it can be by having 60% or higher homology with aforementioned sequence; Preferred 80% or higher homology, more preferably 90% or the protein of the genes encoding of higher homology, as long as said protein has the calcium function of receptors.Also known GPRC6A acceptor and 5.24 acceptors are hypotypes of calcium acceptor, and can they be used for the present invention.Intracellular free calcium level or change in current in the time of can passing through in cell, to express interested gene and measurement interpolation calcium detect the calcium function of receptors.

Specifically do not limit the source of calcium acceptor, and except that aforementioned people's calcium acceptor, instance also comprises and is derived from the for example calcium acceptor of mouse, rat and dog of animal.

As stated, can confirm calcium receptor active through using expression calcium acceptor or its segmental viable cell, expression calcium acceptor or its segmental cytolemma, the protein that contains the calcium acceptor or its segmental vitro system to wait.

Use the instance of viable cell to show hereinafter.Yet the affirmation of calcium receptor active is not limited to this instance.

The calcium acceptor can for example be expressed in xenopous laevis ovocyte, hamster ovary cell and the people's tire kidney cell in cultured cells.Can express the calcium acceptor through following method: the gene clone of calcium acceptor extremely can be contained in the plasmid of foreign gene, and introduce said plasmid or cRNA through using this plasmid to obtain as template.For detection reaction, can use the fluorescent indicator of electrophysiological technique, the raising of indication cellular calcium level etc.

At first based on replying of calcium or specificity activator confirmed the calcium receptor expression.Use shows the ovocyte of electric current in the born of the same parents or under the calcium concn of about 5mM, shows the culturing cell of the fluorescence of fluorescent indicator under the calcium concn of about 5mM.Measure calcium concn dependency (dependency) through changing calcium concn.Thereafter, with test substances for example peptide be prepared into the concentration of about 1 μ M to 1mM, and be added into ovocyte or cultured cells, and measure the for example receptor active of aforesaid peptide of said test substances.

< 2>give the agent of kokumi

The agent of the kokumi of giving of the present invention comprises the material of giving kokumi that can obtain through screening method of the present invention as activeconstituents.The agent of the kokumi of giving of the present invention contains and for example is selected from γ-Glu-X-Gly (X representative except that Cys amino acid or amino acid derivative); γ-Glu-Val-Y (Y represented amino acid or amino acid derivative); γ-Glu-Ala; γ-Glu-Gly; γ-Glu-Cys; γ-Glu-Met; γ-Glu-Thr; γ-Glu-Val; γ-Glu-Orn; Asp-Gly; Cys-Gly; Cys-Met; Glu-Cys; Gly-Cys; Leu-Asp; D-Cys; γ-Glu-Met (O); γ-Glu-γ-Glu-Val; γ-Glu-Val-NH ₂, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (O), one or more materials (being also referred to as " being used for peptide of the present invention and amino acid " hereinafter) among γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t-Leu and the γ-Glu-Cys (S-Me) are as activeconstituents.Can also obtain these peptides and amino acid through above-mentioned screening method.In this article; The meaning of " amino acid " is but is not limited to neutral amino acids for example Gly, Ala, Val, Leu, Ile, Ser, Thr, Cys, Met, Asn, Gln, Pro and Hyp; Acidic amino acid is Asp and Glu for example; Basic aminoacids is Lys, Arg and His for example; Aromatic amino acid is for example homoserine (homoserine), N.delta.-carbamylornithine (citrulline), ornithine (ornithine), butyrine (alpha-aminobutylic acid), norvaline (norvaline), nor-leucine (norleucine) and taurine (taurine) of Phe, Tyr, Trp and other amino acid for example.

In this manual, the abbreviation of amino-acid residue is following:

(1) Gly: glycocoll

(2) Ala: L-Ala

(3) Val: Xie Ansuan

(4) Leu: leucine

(5) Ile: Isoleucine

(6) Met: methionine(Met)

(7) Phe: phenylalanine(Phe)

(8) Tyr: tyrosine

(9) Trp: tryptophane

(10) His: Histidine

(11) Lys: Methionin

(12) Arg: l-arginine

(13) Ser: Serine

(14) Thr: Threonine

(15) Asp: aspartic acid

(16) Glu: L-glutamic acid

(17) Asn: l-asparagine

(18) Gln: Stimulina

(19) Cys: halfcystine

(20) Pro: proline(Pro)

(21) Orn: ornithine

(22) Sar: sarkosine

(23) Cit: N.delta.-carbamylornithine

(24) N-Val: norvaline

(25) N-Leu: nor-leucine

(26) Abu: butyrine

(27) Tau: taurine

(28) Hyp: oxyproline

(29) t-Leu: Terleu

In addition; The meaning of " amino acid derivative " is above-mentioned amino acid whose polytype verivate; Can be illustrated as but be not limited to rare amino acid, alpha-non-natural amino acid, amino alcohol, substituted amino acid, wherein use various substituting group substituted amino acid side chains for example carbonyl, amino and sulfydryl (thiol group).These substituting groups comprise alkyl (alkyl group), acyl group, hydroxyl, amino, alkylamino (alkylamino), nitro, alkylsulfonyl and kinds of protect group.These substituted amino acids comprise, for example, and Arg (NO ₂): N-γ-nitro l-arginine, Cys (SNO): S-nitro halfcystine, Cys (S-Me): S-methyl halfcystine, Cys (S-allyl group): S-allyl cysteine, Val-NH ₂: valine amide (valinamide), Val-ol: valerian ammonia alcohol (valinol) (2-amino-3-methyl isophthalic acid-butanols).

In this manual, γ-Glu-Cys (SNO)-Gly has following structural formula, and formula γ-Glu-Met (O) and γ-Glu-Cys (S-Me) " (O) " expression sulfoxide structure in (O)." (γ) " expression L-glutamic acid among formula γ-Glu is bonded to another amino acid through the carboxyl of γ position in the L-glutamic acid.

S-GSNO (GNSO)

γ-Glu-X-Gly (amino acid or the amino acid derivative of X representative except that Cys), γ-Glu-Val-Y (Y represented amino acid or amino acid derivative), γ-Glu-Ala, γ-Glu-Gly, γ-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val, γ-Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met (O), γ-Glu-γ-Glu-Val, γ-Glu-Val-NH ₂, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (O), γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t-Leu and γ-Glu-Cys (S-Me) give kokumi.Therefore, γ-Glu-X-Gly (amino acid or the amino acid derivative of X representative except that Cys), γ-Glu-Val-Y (Y represented amino acid or amino acid derivative), γ-Glu-Ala, γ-Glu-Gly, γ-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val, γ-Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met (O), γ-Glu-γ-Glu-Val, γ-Glu-Val-NH ₂, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (O), γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t-Leu and γ-Glu-Cys (S-Me) (hereinafter being also referred to as " being used for peptide of the present invention and amino acid ") can use as the agent of giving kokumi.Being used for peptide of the present invention and amino acid can use independently, perhaps can be used as two or more mixture use arbitrarily in them.Among these, preferably have the compound of following structural formula: γ-Glu-X-Gly (X represents Cys (SNO), Cys (S-allyl group), Gly, Cys (S-Me), Abu or Ser) or γ-Glu-Val-Y (Y represents Gly, Val, Glu, Lys, Phe, Ser, Pro, Arg, Asp, Met, Thr, His, Orn, Asn, Cys or Gln).

Among these; Compound with following structural formula is by the new synthetic novel substance of contriver of the present invention, and the present invention includes the invention of these compounds: γ-Glu-X-Gly (X represents Asn, Gln, His, Lys, Orn or Arg) and γ-Glu-Val-Y (Y represents Leu, Ile, Ser, Thr, Met, Cys, Asp, Asn, Gln, Lys, Orn, Arg, Phe, Tyr, Pro, Hyp, Trp, His or Abu).In addition, in these novel substances, γ-Glu-X-Gly (X represents Asn, Gln, His, Lys, Orn or Arg) and γ-Glu-Val-Y (Y represents Ser, Thr, Met, Cys, Asp, Asn, Gln, Lys, Orn, Arg, Pro or His) are preferred.

Although the threshold concentration of known taste peptide (taste peptide) Cmin of taste (allow sensation) is about 0.2% (threshold concentration of MSG 1/10); Therefore and make not enough (the J.Agr.Food Chem. of their practicality; Vol.23, No.1,49-53 (1975)); But compound of the present invention promptly shows the activity that strengthens kokumi at the extremely low concentration of about 0.0001-0.1%, and therefore they are to have high active very useful compound.

Like aforesaid peptide of the present invention and the amino acid of being used for, if can be used as commerical prod, they obtain, then can use those.In addition, can obtain said peptide through using known technology suitably, said technology is their method of (1) chemosynthesis for example, or their method is synthesized in (2) through enzyme reaction.Because it is relatively little of 2 or 3 residues to be used for the residue number of the amino-acid residue that peptide of the present invention contains, their method of chemosynthesis is easily.Chemosynthesis they the time, can use peptide synthesizer to synthesize or semi-synthetic oligopeptides.The instance of their method of chemosynthesis comprises, for example, and the peptide solid phase synthesis process.Can pass through ordinary method, for example, ion exchange chromatography, RPHPLC, affinity chromatography wait purifying synthetic peptide as stated.The peptide purification of this peptide solid phase synthesis process and hereinafter is well known in the art.

In addition, being used for peptide of the present invention also can prepare through enzyme reaction.For example, can use the method for describing among the open WO2004/011653 of international monopoly.Promptly; Also can as get off preparation they: with C-terminal (for example by esterification or amidated an amino acid or a dipeptides and amino acid with free amine group; The protected amino acid of carboxyl) produce reacting down of enzyme (peptide producing enzyme) at peptide, and the purifying dipeptides or the tripeptides that make.The instance that peptide produces enzyme comprise the mikrobe with the ability that produces peptide culture, produce enzyme etc. from the converted products of the isolating microorganism cells of this culture, these microbial cell, the peptide that obtains by these mikrobes.

Be used for peptide of the present invention and amino acid and also comprise those of salt form.When being used for peptide of the present invention and amino acid and being salt form, they can be acceptable salt on the pharmacology.The instance that in formula, has the salt of acidic-group (for example carboxyl) comprises ammonium salt; With the basic metal salt that becomes with potassium of sodium for example; With the earth alkali metal salt that becomes with magnesium of calcium for example; Aluminium salt, zinc salt, with organic amine for example the salt that becomes of triethylamine, thanomin, morpholine, tetramethyleneimine, piperidines, piperazine and dicyclohexyl amine with the basic aminoacids salt that becomes with Methionin of l-arginine for example.In formula, exist under the situation of basic group; The instance of the salt that becomes with basic group comprises and the mineral acid salt that becomes of hydrochloric acid, sulfuric acid, phosphoric acid, nitric acid and Hydrogen bromide for example; With organic carboxyl acid for example acetate, Hydrocerol A, phenylformic acid, toxilic acid, fumaric acid, tartrate, succsinic acid, tannic acid, butyric acid, hibenzic acid (hibenzoic acid), pounce on the salt that acid (pamoic acid), enanthic acid (enanthoic acid), capric acid (decanoic acid), teoclic acid, Whitfield's ointment, lactic acid, oxalic acid, racemic melic acid (mandelic acid) become with oxysuccinic acid, with the organic sulfonic acid salt that becomes of methylsulfonic acid, Phenylsulfonic acid and tosic acid for example.

Specifically do not limit and give the material of kokumi and the method for use of giving the agent of kokumi; The said material of giving kokumi obtains through screening method of the present invention, the agent of the said kokumi of giving contain be selected from be used for peptide of the present invention and amino acid one or more materials as activeconstituents; And can for example seasonings, F&B use the material of the said kokumi of giving and give the agent of kokumi through they being added into food or beverage.

Material that can be through will giving kokumi independently or be added into food or beverage with combination such as other multiple additives for example seasonings, F&B use the material of giving kokumi that obtains through screening method of the present invention.

In addition, the agent of the kokumi of giving of the present invention can for example only be formed by being selected from aforementioned one or more materials that are used for peptide of the present invention and amino acid; In addition, it can also contain that other of any interpolation is existing to have the active compound (for example gsh and garlicin (alliin)) of giving kokumi or other multiple additives etc.In addition, the agent of the kokumi of giving of the present invention can contain one or more and existingly have the active compound of calcium receptor activation, and such compsn also falls in the scope of the present invention.

Aforementioned existingly have the active examples for compounds of calcium receptor activation and comprise: positively charged ion is calcium and gadolinium positively charged ion for example; Basic peptide is poly arginine and polylysine for example; Polyamines is putrescine (putrescine), spermine (spermine) and spermidine (spermidine) for example; Protein is protamine for example, and amino acid is phenylalanine(Phe) and gsh for example, intends calcium agent etc.These compounds can also be their any acceptable salt forms.In addition, contriver of the present invention finds that gsh has calcium receptor activation activity.

Equally; Contriver of the present invention also finds; When those agents with the active existing compound (for example gsh) of giving kokumi and the kokumi of giving of the present invention with having the active compound of calcium receptor activation when being formulated in the compsn, also can improve the activity that they give kokumi; That is, such compsn also falls within the scope of the invention.

As aforesaid additive, can use any known can add and be mixed to food or beverage for example seasonings, F&B those and do not have concrete qualification.The instance of these additives comprises, for example, spices (perfume), sugar, sweeting agent (sweetner), food fibre, VITAMINs, amino acid is Sodium Glutamate (MSG), nucleic acid for example sodium-chlor, water etc. of inosine-monophosphate (IMP), inorganic salt for example for example.

The amount that the material of giving kokumi that in screening method of the present invention, obtains or the agent of the kokumi of giving of the present invention are used for food or beverage can be the amount of effectively giving kokumi, and depends on purpose and suitably regulate this amount.Yet; For example; Under the situation of seasonings, food or beverage, according to the agent of the kokumi of giving of the present invention or the total amount of giving the material of kokumi, it can be 1 quality ppb to 99.9 quality % of said seasonings, Foods or drinks; Preferred 10 quality ppb to 99.9 quality %, more preferably 10 quality ppm to 10 quality %.

Therefore; Be added into food or beverage through in the agent of the material of giving kokumi that will obtain by screening method of the present invention or the kokumi of giving of the present invention one or more; Thereby make said food or beverage contain about 1 quality ppb to 99.9 quality %; Preferred 10 quality ppb to 99.9 quality %, more preferably said material or the agent of 10 quality ppm to 10 quality % can produce the food or the beverage that have been endowed kokumi thus.

In addition; Also can be through seasonings being added into food or beverage; One or more materials of giving kokumi that obtain by screening method of the present invention that said seasonings contains 1 quality ppb to 99.9 quality % or the agent of the kokumi of giving of the present invention; Thereby make said food or beverage contain 0.01-10 quality %, the said seasonings of preferred 0.1-10 quality % prepares food or the beverage of having given kokumi thus.

When the agent of the material of giving kokumi that will obtain through screening method of the present invention or the kokumi of giving of the present invention is added into food or beverage; The form of said material or agent can be dry powder, paste (paste), solution etc., and does not specifically limit its physical properties.

Embodiment

Hereinafter, the reference implementation example is carried out specific explanations to the present invention.Yet scope of the present invention is not limited to these embodiment.

< embodiment 1 >

< preparation gene (cRNA) >

Be prepared as follows the gene of calcium acceptor.Be based on dna sequence dna (the calcium acceptor: NM_000388), designed the synthetic oligo DNA s (forward primer (N) and reverse primer (C)) (table 1, SEQ ID NOS:1 and 2) that is used for PCR of NCBI registration.

Table 1

Synthetic oligo DNA s (forward primer (N) and reverse primer (C), h: the people)

Code	Sequence (5 '-3 ')
		hCASR_N	ACTAATACGACTCACTATAGGGACCATGGCATTTTATAGCTGCTGCTGG
hCASR_C	TTATGAATTCACTACGTTTTCTGTAACAG

Through end user's kidney cDNA (Clontech) as material; Synthesized the primer (hCASR_N (SEQ ID NO:1) and hCASR_C (SEQ ID NO:2)) that shows in the table 1, and through using Pfuultra DNA Polymerase (Stratagene) under following condition, to carry out PCR.After 94 ° of C reactions 3 minutes, 30 seconds, 55 ° C of 94 ° of C 30 seconds and 2 minutes reaction cycle of 72 ° of C are repeated 35 times, will be reflected at 72 ° of C thereafter and carry out 7 minutes.Through carrying out agarose electrophoresis, detecting whether obtained amplification through PCR with dyeing of DNA staining agent and uv irradiating.Through with the chain length of relatively confirming the PCR product of the dna marker that carries out electrophoretic known dimensions simultaneously.With restriction enzyme EcoRV digested plasmid carrier pBR322 (Takara).Through using Ligation Kit (connection test kit) (Promega) gene fragment of pcr amplification to be connected to the cleavage site of said plasmid.With every kind of ligation solution transformed into escherichia coli DH5 α bacterial strain, and select to contain the transformant of plasmid, the clone has pcr amplification product in said plasmid.Confirm pcr amplification product through dna sequence analysis.Through using this recombinant plasmid to prepare test kit (Ambion), prepared the cRNA of calcium acceptor gene as template and cRNA.

< embodiment 2 >

< preparation several samples >

As L-amino acid sample; Use 23 kinds of superfine (special grade) amino acid, L-Ala, l-arginine, l-asparagine, aspartic acid, halfcystine, Stimulina, L-glutamic acid, glycocoll, Histidine, Isoleucine, leucine, Methionin, methionine(Met), phenylalanine(Phe), proline(Pro), Serine, Threonine, tryptophane, tyrosine, Xie Ansuan, ornithine, taurine (these are all from Ajinomoto) and oxyproline (Nakarai Tesque).D-Cys and D-Trp (Nakarai Tesque) and calcium chloride use select quality.In addition; As the peptide sample; Use γ-Glu-Cys-Gly (Sigma Aldrich Japan), γ-Glu-Cys (SNO)-Gly (Dojin Chemical Laboratory), γ-Glu-Ala (BachemFeinchemikalien AG), γ-Glu-Gly (Bachem Feinchemikalien AG), γ-Glu-Cys (Sigma Aldrich Japan), γ-Glu-Met (Bachem Feinchemikalien AG), γ-Glu-Abu-Gly (Abu: butyrine, Bachem Feinchemikalien AG), γ-Glu-Thr (Kokusan Chemical), γ-Glu-Val (Kokusan Chemical), γ-Glu-Leu (contract manufacture a product (contract manufactured product)), γ-Glu-Ile (contract manufactures a product), γ-Glu-Orn (Kokusan Chemical), Asp-Gly (contract manufactures a product), Cys-Gly (contract manufactures a product), Cys-Met (contract manufactures a product), Glu-Cys (contract manufactures a product), Gly-Cys (contract manufactures a product), Leu-Asp (contract manufactures a product), γ-Glu-Val-Val (contract manufactures a product), γ-Glu-Val-Glu (contract manufactures a product), γ-Glu-Val-Lys (contract manufactures a product), γ-Glu-γ-Glu-Val (contract manufactures a product), γ-Glu-Gly-Gly (contract manufactures a product), γ-Glu-Val-Phe (contract manufactures a product), γ-Glu-Val-Ser (contract manufactures a product), γ-Glu-Val-Pro (contract manufactures a product) γ-Glu-Val-Arg (contract manufactures a product), γ-Glu-Val-Asp (contract manufactures a product), γ-Glu-Val-Met (contract manufactures a product), γ-Glu-Val-Thr (contract manufactures a product), γ-Glu-Val-His (contract manufactures a product), γ-Glu-Val-Asn (contract manufactures a product), γ-Glu-Val-Gln (contract manufactures a product), γ-Glu-Val-Cys (contract manufactures a product), γ-Glu-Val-Orn (contract manufactures a product) with γ-Glu-Ser-Gly (contract manufactures a product).Stimulina and halfcystine prepare in use, and other sample 20 ° of C of Zhu Zang Zai – after preparation.Peptide uses has 90% or more highly purified peptide.Only γ-Glu-Cys uses and has 80% or γ-the Glu-Cys of higher purity.When the solution of every kind of sample of dissolving shows acidity or alkaline pH, solution is adjusted to about neutral pH through using NaOH or HCl.The solution that is used to dissolve amino acid and peptide, preparation xenopous laevis ovocyte and cultivate said ovocyte has following composition: 96mM NaCl, 2mM KCl, 1mM MgCl ₂, 1.8mM CaCl ₂, 5mM Hepes, pH 7.2.

< embodiment 3 >

< synthetic γ-Glu-Val-Gly >

With Boc-Val-OH (8.69g, 40.0mmol) and Gly-OBzlHCl (8.07g 40.0mmol) is dissolved in the methylene dichloride (100ml), and said solution is remained on 0 ° of C.With triethylamine (6.13ml; 44.0mmol), HOBt (I-hydroxybenzotriazole; 6.74g, 44.0mmol) and WSCHCl (hydrochloric acid 1-ethyl-3-(3-dimethylamine propyl) carbodiimide (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride), 8.44g; 44.0mmol) be added into said solution, and stir said mixture in ambient temperature overnight.With said reaction mixture concentrating under reduced pressure, and resistates is dissolved in the ETHYLE ACETATE (200ml).Water (50ml), 5% aqueous citric acid solution (twice of 50ml x), saturated brine (brine) are (50ml), 5% sodium hydrogencarbonate (sodium hydrogencarbonate) aqueous solution (twice of 50ml x) and saturated brine (50ml) wash said solution.Organic layer through anhydrous magnesium sulfate drying, is removed sal epsom through filtering, and filtrate decompression is concentrated.With resistates from ETHYLE ACETATE/just-hexane recrystallization with obtain white crystal Boc-Val-Gly-OBzl (13.2g, 36.2mmol).

(5.47g 15.0mmol) is added into 4N HCl/ dioxane solution (40ml), and in the said mixture of stirring at room 50 minutes with Boc-Val-Gly-OBzl.Remove diox through concentrating under reduced pressure, just adding-hexane (30ml) to resistates, and with said mixture concentrating under reduced pressure.This process is repeated 3 times to obtain H-Val-Gly-OBzlHCl quantitatively.

(5.57g 15.0mmol) is dissolved in the methylene dichloride (50ml), and said solution is remained on 0 ° of C with above-mentioned H-Val-Gly-OBzlHCl and Z-Glu-OBzl.With triethylamine (2.30ml, 16.5mmol), HOBt (I-hydroxybenzotriazole, 2.53g; 16.5mmol) and WSCHCl (hydrochloric acid 1-ethyl-3-(3-dimethylamine propyl) carbodiimide; 3.16g, 16.5mmol) be added into said solution, and with mixture stirring at room 2 days.With said reaction mixture concentrating under reduced pressure, and with resistates be dissolved in through the heating ETHYLE ACETATE (1500ml) in.Water (200ml), 5% aqueous citric acid solution (twice of 200ml x), saturated brine (150ml), 5% sodium bicarbonate aqueous solution (twice of 200ml x) and saturated brine (150ml) wash said solution.Organic layer through anhydrous magnesium sulfate drying, is removed sal epsom through filtering, and filtrate decompression is concentrated.Through filter collecting sedimentary crystal, and drying under reduced pressure with obtain white crystal Z-Glu (Val-Gly-OBzl)-OBzl (6.51g, 10.5mmol).

(6.20g 10.03mmol) is suspended in the ethanol (200ml), and adds 10% palladium/carbon (1.50g), in hydrogen atmosphere (hydrogen atmosphere), carries out reduction reaction 5 hours at 55 ° of C with above-mentioned Z-Glu (Val-Gly-OBzl)-OBzl.During reaction, progressively add the water of 100ml altogether.Remove catalyzer through using the Kiriyama funnel to filter, and filtrate decompression is concentrated into half the volume.Reaction mixture is further filtered through membranous filter (membrane filter), and concentrating under reduced pressure filtrating.Resistates is dissolved in the water of little volume, and adds ethanol, and drying under reduced pressure is to obtain γ-Glu-Val-Gly (2.85g, white powder 9.40mmol) so that crystal deposition is collected crystal through filtering again.

ESI-MS:(M+H) ⁺=304.1

¹H-NMR(400MHz,D ₂O)δ(ppm)：0.87(3H,d,J=6.8Hz)、0.88(3H,d,J=6.8Hz)、1.99-2.09(3H,m)、2.38-2.51(2H,m)3.72(1H,t,J=6.35Hz)、3.86(1H,d,J=17.8Hz)、3.80(1H,d,J=17.8Hz)、4.07(1H,d,J=6.8Hz)。

< embodiment 4 >

< synthetic γ-Glu-Cys (S-Me)-Gly [Cys (S-Me): S-methyl halfcystine] >

With reduced glutathion (15.0g; 48.8mmol) be added into water (45ml), and when bubbling in said mixture feeds (bubble) nitrogen, with sodium hydroxide (4.52g; 2.2 equivalent, 107mmol) piecemeal (portionwise) is added into said mixture.(4.56ml, 1.5 equivalents 73mmol) are added into mixture, with mixture sealing and stirring at room 2 hours with methyl iodide (methyl iodide).With concentrated hydrochloric acid reaction mixture is adjusted to pH 2 to 3, adds ethanol (150ml), and in refrigerator, preserve and spend the night.Because oily mater is isolating, therefore supernatant is removed.Soluble in water and when adding ethanol gradually when remaining oily mater, make the oily mater deposition of partial crystallization.Therefore, remove supernatant once more.With resistates water-soluble (300ml), be adsorbed on the ion exchange resin that is filled in the post (Dowex 1-acetic ester, 400ml) on, after with water washing, with 1N acetic acid aqueous solution wash-out.With the elutriant concentrating under reduced pressure, and from water/ethanol, precipitate to obtain γ-Glu-Cys (S-Me)-Gly (5.08g, white powder 15.8mmol).

FAB-MS:(M+H) ⁺=322

¹H-NMR(400MHz,D ₂O)δ(ppm):2.14(3H,s)、2.15-2.22(2H,m)、2.50-2.58(2H,m)、2.86(1H,dd,J=9.0Hz,J=14.0Hz)、3.03(1H,dd,J=5.0Hz,J=14.0Hz)、3.84(1H,t,J=6.5Hz)、3.99(2H,S)、4.59(1H,dd,J=5.0Hz,J=9.0Hz)。

< embodiment 5 >

< synthetic other peptide >

According to embodiment 3 and 4 in the synthetic γ-Glu-Met (O) of similar mode, γ-Glu-Val-NH ₂, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (O), γ-Glu-t-Leu, γ-Glu-Cys (S-allyl group)-Gly and γ-Glu-Cys (S-Me).

< embodiment 6 >

< assessment calcium receptor activation is active >

Active in order to assess the calcium receptor activation, use Ca ionic concn dependency Cl ion(ic)current measuring method, said method is used xenopous laevis ovocyte expression system.If every kind of activator is added into the xenopous laevis ovocyte of expressing the calcium acceptor, then the Ca ion increases in the born of the same parents.Subsequently, Ca ionic concn dependency Cl passage is opened, and current value changes as ion(ic)current in the born of the same parents.Whether exist the calcium receptor activation active through measuring the variation of current value in this born of the same parents, can learning.

Particularly, the belly of xenopous laevis is opened, in batch ovum (egg batch) is taken out and handles 2 hours with acquisition ovocyte alone with 1% collagenase solution at 20 ° of C.Through using little glass capillary (micro glass capillary) that each ovocyte 50nl sterilized water or 50nl 1 μ g/ μ l acceptor cRNA are introduced in the ovocyte, and said ovocyte was cultivated 2 or 3 days at 18 ° of C.For cultivation, use through adding the solution that 2mM pyruvic acid, 10U/ml penicillium mould and 10 μ g/ml Streptomycin sulphates obtain to solution described in the embodiment 2.After cultivating, test soln is added into the ovocyte of having introduced cRNA or sterilized water.Through using magnifying glass Geneclamp500 (Axon) and logging software AxoScope 9.0 (Axon) to carry out electrophysiologicalmeasurements measurements (electrophysiological measurement).With ovocyte voltage clamp Zai – 70mV, and measure electric current in the born of the same parents through two electrodes voltage clamp method (double electrode voltage clamp method) through Ca ionic concn dependency Cl ionic channel.The peak of electric current in the born of the same parents is seen the current value that responses.

< embodiment 7 >

< the calcium receptor activation of assessment calcium is active >

Assess the calcium receptor activation activity of calcium through using the method for describing among the embodiment 6.That is, the ovocyte of calcium acceptor cRNA or sterilized water has been introduced in preparation, and passes through two electrodes voltage clamp method with said ovocyte voltage clamp Zai – 70mV.Ovocyte to voltage clamp adds calcium (2mM, 5mM, 10mM, 20mM), and measures Ca ionic concn dependency Cl and reply electric current.The result is shown in Fig. 1.From these results, confirmed to introduce the functional expression of the calcium acceptor cRNA in the ovocyte.In addition, even, confirmed that self does not express the calcium acceptor in the ovocyte owing to the ovocyte of having introduced water is not replied high-concentration Ca yet.

< embodiment 8 >

< the amino acid whose calcium receptor activation of assessment L-is active >

Active through using the method for describing among the embodiment 6 to assess the amino acid whose calcium receptor activation of L-.That is, the ovocyte of calcium acceptor cRNA or sterilized water has been introduced in preparation, and through two electrodes voltage clamp method with said ovocyte voltage clamp at 70mV.Ovocyte to voltage clamp adds L-Ala (10mM), l-arginine (10mM), l-asparagine (10mM), aspartic acid (10mM), halfcystine (10mM), Stimulina (10mM), L-glutamic acid (10mM), glycocoll (10mM), Histidine (10mM), Isoleucine (10mM), leucine (10mM), Methionin (10mM), methionine(Met) (10mM), phenylalanine(Phe) (10mM), proline(Pro) (10mM), Serine (10mM), Threonine (10mM), tryptophane (10mM), tyrosine (10mM), Xie Ansuan (10mM), ornithine (10mM), taurine (10mM) or oxyproline (10mM), and measures Ca ionic concn dependency Cl and reply electric current.The result is shown in Fig. 2.Prove that by these results halfcystine, Histidine, phenylalanine(Phe), tryptophane and tyrosine have definite calcium receptor activation activity.For aforementioned amino acid, said activation activity is at Proc.Natl.Acad.Sci.USA, 2000Apr.25,97 (9): report among the 4814-9.

< embodiment 9 >

< the calcium receptor activation of assessment D-halfcystine is active >

Assess the calcium receptor activation activity of D-halfcystine through using the method for describing among the embodiment 6.That is, the ovocyte of calcium acceptor cRNA or sterilized water has been introduced in preparation, and passes through two electrodes voltage clamp method with said ovocyte voltage clamp Zai – 70mV.Ovocyte to voltage clamp adds D-halfcystine (10mM), L-halfcystine (10mM), D-tryptophane (10mM) or L-tryptophane (10mM), and measures Ca ionic concn dependency Cl and reply electric current.The result is shown in Fig. 3.Proved that by these results the D-halfcystine has definite calcium receptor activation activity.

< embodiment 10 >

< the calcium receptor activation of evaluation of peptide is active >

Come the calcium receptor activation of evaluation of peptide active through using the method for describing among the embodiment 6.That is, the ovocyte of calcium acceptor cRNA or sterilized water has been introduced in preparation, and through two electrodes voltage clamp method with said ovocyte voltage clamp at 70mV.Ovocyte to voltage clamp adds γ-Glu-Cys-Gly (50 μ M), γ-Glu-Cys (SNO)-Gly (50 μ M), γ-Glu-Ala (50 μ M), γ-Glu-Gly (500 μ M), γ-Glu-Cys (50 μ M), γ-Glu-Met (500 μ M), γ-Glu-Thr (50 μ M), γ-Glu-Val (50 μ M), γ-Glu-Orn (500 μ M), Asp-Gly (1mM), Cys-Gly (1mM), Cys-Met (1mM), Glu-Cys (50 μ M), Gly-Cys (500 μ M) or Leu-Asp (1mM), and measures Ca ionic concn dependency Cl and reply electric current.The result is shown in Fig. 4.Proved that by these results aforementioned peptide has definite calcium receptor activation activity.

< embodiment 11 >

< the calcium receptor activation of evaluation of peptide is active >

According to embodiment 10 in identical mode come the calcium receptor activation of evaluation of peptide active.The every kind of peptide that shows in the table 2 is added into the ovocyte of voltage clamp with 1000 μ M, 300 μ M, 100 μ M, 30 μ M, 10 μ M, 3 μ M, 1 μ M, 0.3 μ M and 0.1 μ M, and measures Ca ionic concn dependency Cl and reply electric current.The minimum concentration that detects electric current is shown in Table 2 as active.From these results, it is active that obviously these 32 kinds of peptides have the calcium receptor activation.

Table 2

Numbering	Peptide	Active
			1	γ-Glu-Met(O)	1000μM
2	γ-Glu-Val-Val	1000μM
			3	γ-Glu-Val-Glu	1000μM
4	γ-Glu-Val-Lys	1000μM
			5	γ-Glu-Val-Arg	1000μM
6	γ-Glu-Val-Asp	1000μM
			7	γ-Glu-Val-Met	1000μM
8	γ-Glu-Val-Thr	1000μM
			9	γ-Glu-γ-Glu-Val	1000μM
10	γ-Glu-Val·NH ₂	1000μM
			11	γ-Glu-Val·ol	1000μM
12	γ-Glu-Ser	300μM
			13	γ-Glu-Tau	300μM
14	γ-Glu-Cys(S-Me)(O)	300μM
			15	γ-Glu-Val-His	100μM
16	γ-Glu-Val-Orn	100μM
			17	γ-Glu-Leu	100μM
18	γ-Glu-Ile	100μM
			19	γ-Glu-t-Leu	100μM
20	γ-Glu-Cys (S-allyl group)-Gly	100μM
			21	γ-Glu-Val-Asn	30μM
22	γ-Glu-Gly-Gly	30μM
			23	γ-Glu-Val-Phe	30μM
24	γ-Glu-Val-Ser	30μM
			25	γ-Glu-Val-Pro	30μM
26	γ-Glu-Ser-Gly	30μM
			27	γ-Glu-Cys(S-Me)	30μM
28	γ-Glu-Val-Cys	10μM
			29	γ-Glu-Val-Gln	10μM

30	γ-Glu-Abu-Gly	3μM
			31	γ-Glu-Cys(S-Me)-Gly	3μM
32	γ-Glu-Val-Gly	0.1μM

< embodiment 12 >

Conventional instance is selected from those and has confirmed that (X represents Cys (SNO) for the active peptide of calcium receptor activation and amino acid: γ-Glu-X-Gly; Cys (S-allyl group); Gly; Cys (S-Me); Abu or Ser); (Y represents Gly to γ-Glu-Val-Y; Val; Glu; Lys; Phe; Ser; Pro; Arg; Asp; Met; Thr; His; Orn; Asn; Cys or Gln); γ-Glu-Ala; γ-Glu-Gly; γ-Glu-Cys; γ-Glu-Met; γ-Glu-Thr; γ-Glu-Val; γ-Glu-Orn; Asp-Gly; Cys-Gly; Cys-Met; Glu-Cys; Gly-Cys; Leu-Asp; D-Cys; γ-Glu-Met (O); γ-Glu-γ-Glu-Val; γ-Glu-Val-NH ₂, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (O), γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t-Leu and γ-Glu-Cys (S-Me), and measure them through sensory evaluation test and whether have the activity of giving kokumi.

Carry out sensory evaluation test as follows.Garlicin (S-allyl group-halfcystine sulfoxide: give kokumi active control experiment), γ-Glu-Cys-Gly, γ-Glu-Cys, γ-Glu-Ala or γ-Glu-Val are mixed into the zero(ppm) water that contains Sodium Glutamate (0.05g/dl), inosine-monophosphate (0.05g/dl) and calcium chloride (1mM) as sample with the amount of 0.2g/dl, and measure them and whether have the activity of giving kokumi.Sample solution becomes tart after the sample dissolution, before using, with NaOH sample solution is adjusted to pH 6.8 to 7.2.The result is shown in table 3.

Table 3

The calcium receptor activators is given the activity of kokumi

The calcium receptor activators	Give the activity of kokumi
		γGlu-Cys-Gly	+
γGlu-Cys	+
		γGlu-Ala	+
γGlu-Val	+

< embodiment 13 >

< activity of giving kokumi that is used for peptide of the present invention >

Measure the active intensity of giving kokumi that those have confirmed the active various peptides of calcium receptor activation through the quantitative sensory evaluation test.

Carry out the quantitative sensory evaluation test as follows.γ-Glu-Cys-Gly (gsh), γ-Glu-Ala, γ-Glu-Met or γ-Glu-Val are mixed into the zero(ppm) water that contains Sodium Glutamate (0.05g/dl), inosine-monophosphate (0.05g/dl) and sodium-chlor (0.5g/dl) as sample with the amount of 0.1g/dl, and measure the active intensity of giving kokumi.Sample solution becomes tart after the sample dissolution, before using, with NaOH sample solution is adjusted to pH 6.8-7.2.Assessment result is expressed as based on the control sample (0 minute) and the perceptual evaluation score of having added the sample (3 minutes) of gsh, and carries out said test with n=3.The result is shown in table 4.

Table 4

< embodiment 14 >

Confirmed the active intensity of giving kokumi of the active every kind of peptide of calcium receptor activation through quantitative sensory evaluation test measurement.

Carry out the quantitative sensory evaluation test as follows.With γ-Glu-Cys-Gly (gsh), γ-Glu-Cys, γ-Glu-Val or γ-Glu-Val-Gly as the amount of sample with 0.1g/dl; Or if needed with the amount of 0.01g/dl; Be mixed into the zero(ppm) water that contains Sodium Glutamate (0.05g/dl), inosine-monophosphate (0.05g/dl) and sodium-chlor (0.5g/dl), and measure the active intensity of giving kokumi.Sample solution after the sample dissolution is become acidity, before using, sample solution is adjusted to pH 6.8 to 7.2 with NaOH.Evaluation form is shown based on the control sample (0 minute) and the perceptual evaluation score of having added the sample (3 minutes) of gsh, and carries out said test with n=5.The result is shown in table 5.

Table 5

* can not survey: the activity of giving kokumi can not be measured through perceptual evaluation too by force.

< embodiment 15 >

< activity of giving kokumi that is used for peptide of the present invention >

Carry out the quantitative sensory evaluation test as follows.γ-Glu-Cys-Gly (gsh), γ-Glu-Abu-Gly or γ-Glu-Val-Gly are mixed into the zero(ppm) water that contains Sodium Glutamate (0.05g/dl), inosine-monophosphate (0.05g/dl) and sodium-chlor (0.5g/dl) as sample with the amount of 0.1g/dl or 0.01g/dl, and measure the active intensity of giving kokumi.Sample solution becomes tart after the sample dissolution, before using, with NaOH sample solution is adjusted to pH 6.8 to 7.2.Evaluation form is shown based on the control sample (0 minute) and the perceptual evaluation score of having added the sample (3 minutes) of gsh, and carries out said test with n=12.The result is shown in table 6.

Table 6

< embodiment 16 >

<being used for the activity of peptide of the present invention>to primary taste

Confirmed the active intensity of the active every kind of peptide of those calcium receptor activations through quantitative sensory evaluation test measurement to primary taste.

Carry out the quantitative sensory evaluation test as follows.With γ-Glu-Cys-Gly (gsh) or γ-Glu-Val-Gly as sample with 0.0001 to 1g/dl concentration be mixed into the zero(ppm) water that contains Sodium Glutamate (0.2g/dl) as the delicate flavour standardized solution, as the zero(ppm) water that contains sucrose (5g/dl) of sweet taste standardized solution, as the zero(ppm) water that contains sodium-chlor (0.7g/dl) of saline taste standardized solution or as the zero(ppm) water that contains Hydrocerol A (0.05g/dl) of tart flavour standardized solution, and measure the active intensity of each sample to primary taste.

With respect to the standardized solution that does not contain sample, sample solution souring after the sample dissolution is adjusted to sample solution to compare with the pH of standardized solution with NaOH before use and is not less than or is not higher than 0.2 pH.Assessment result is represented with following perceptual evaluation score: control sample 0 minute is 1 minute with respect to the strong slightly activity that contrasts, and is 2 minutes with respect to the strong activity that contrasts, and will tests with n=12 and carry out.Sample has shown the activity that strengthens primary taste within aforesaid wide concentration range.Conventional concentration result is shown in table 7.

Table 7

< embodiment 17 >

Confirmed the active intensity that the active every kind of peptide of calcium receptor activation is given kokumi meat soup through quantitative sensory evaluation test measurement.

Carry out the quantitative sensory evaluation test as follows.Gravy powder (35% sodium-chlor, 18% Sodium Glutamate, 0.2% inosine-monophosphate, 0.3% white pepper powder, 0.5% black ground pepper, 8.0% beef extract powder (beef extract powder), 3.0% white wine powder (white wine powder), 2.0% celery powder, 8.0% Chinese cabbage (chinese cabbage) extract powder, 2.5% Bulbus Allii Cepae extract powder, 25.5% lactose) dissolved with the concentration of 5g/dl prepare meat soup.γ-Glu-Cys-Gly (gsh) or γ-Glu-Val-Gly are mixed into this meat soup as sample with 0.0001 to 1g/dl concentration, and measure the active intensity that each sample is given kokumi.With respect to the meat soup that does not contain sample, the meat soup that contains sample souring after sample dissolution is adjusted to meat soup to compare with the pH of the meat soup that does not contain sample with NaOH before use and is not less than or is not higher than 0.2 pH.Assessment result must be assigned to represent with following perceptual evaluation: control sample 0 minute is 3 minutes with respect to the strong activity that contrasts, and is 5 minutes with respect to the extremely strong activity that contrasts, and will tests with n=12 and carry out.Sample has shown the activity of giving kokumi within aforesaid wide concentration range.Conventional concentration result is shown in table 8.

Table 8

< embodiment 18 >

Confirmed the active intensity that the active every kind of peptide of calcium receptor activation is given kokumi clear soup through quantitative sensory evaluation test measurement.

Carry out the quantitative sensory evaluation test as follows.Through 0.5g/dl soy sauce (soy sauce) and 0.6g/dl sodium-chlor are added into the former soup of stripped tuna marine alga (bonito kelp stock) (the following solution that obtains: the 5g dry seaweed is added in the entry; Water is heated; Be about to add the dried stripped tuna sheet of 25g (dried bonito flake) before the boiling, its after-filtration contains the water of marine alga and stripped tuna sheet) prepare Japanese clear soup.γ-Glu-Cys-Gly (gsh) or γ-Glu-Val-Gly are mixed into this clear soup as sample with 0.0001 to 1g/dl concentration, and measure the active intensity that every kind of sample is given kokumi.With respect to the clear soup that does not contain sample, the clear soup that contains sample souring after sample dissolution is adjusted to clear soup to compare with the pH of the clear soup that does not contain sample with NaOH before use and is not less than or is not higher than 0.2 pH.Assessment result must be assigned to represent with following perceptual evaluation: control sample 0 minute is 3 minutes with respect to the strong activity that contrasts, and is 5 minutes with respect to the extremely strong activity that contrasts, and will tests with n=12 and carry out.Sample has shown the activity of giving kokumi within aforesaid wide concentration range.Conventional concentration result is shown in table 9.

Table 9

< embodiment 19 >

Confirmed the active intensity that the active every kind of peptide of calcium receptor activation is given kokumi corn soup through quantitative sensory evaluation test measurement.

Carry out the quantitative sensory evaluation test as follows.γ-Glu-Cys-Gly (gsh) or γ-Glu-Val-Gly are mixed into the commercial corn soup that can obtain as sample with 0.0001 to 1g/dl concentration, and measure the active intensity that every kind of sample is given kokumi.With respect to the corn soup that does not contain sample, the corn soup that contains sample souring after sample dissolution is adjusted to corn soup to compare with the pH of the corn soup that does not contain sample with NaOH before use and is not less than or is not higher than 0.2 pH.Assessment result must be assigned to represent with following perceptual evaluation: control sample 0 minute is 3 minutes with respect to the strong activity that contrasts, and is 5 minutes with respect to the extremely strong activity that contrasts, and will tests with n=12 and carry out.Sample has shown the activity of giving kokumi within aforesaid wide concentration range.Conventional concentration result is shown in table 10.

Table 10

< embodiment 20 >

Confirmed the active intensity that the active every kind of peptide of calcium receptor activation is given kokumi in curried juice through quantitative sensory evaluation test measurement.

Carry out the quantitative sensory evaluation test as follows.Through using the commercial curry roux that can obtain (curry roux) to prepare curried juice with ordinary method; γ-Glu-Cys-Gly (gsh) or γ-Glu-Val-Gly are mixed into said curried juice as sample with 0.0001 to 1g/dl concentration, and measure the active intensity that every kind of sample is given kokumi.With respect to the curried juice that does not contain sample, the curried juice that contains sample souring after sample dissolution is adjusted to curried juice to compare with the pH of the curried juice that does not contain sample with NaOH before use and is not less than or is not higher than 0.2 pH.Assessment result must be assigned to represent with following perceptual evaluation: control sample 0 minute is 3 minutes with respect to the strong activity that contrasts, and is 5 minutes with respect to the extremely strong activity that contrasts, and will tests with n=12 and carry out.Sample has shown the activity of giving kokumi within aforesaid wide concentration range.Conventional concentration result is shown in table 11.

Table 11

< embodiment 21 >

< activity of giving kokumi of observing in the time of will being used for the for example known calcium receptor activators combination of peptide of the present invention and additive use >

Measure the active intensity of using the active every kind of peptide of calcium receptor activation of accepting really to give kokumi with the for example known calcium receptor activators combination of additive through the quantitative sensory evaluation test.

Carry out the quantitative sensory evaluation test as follows.γ-Glu-Cys-Gly with 0.0001 to 1g/dl (gsh) or γ-Glu-Val-Gly; Or any is mixed into the zero(ppm) water that contains Sodium Glutamate (0.05g/dl), inosine-monophosphate (0.05g/dl) and sodium-chlor (0.5g/dl) with other calcium receptor activators (lactic acid ca, protamine or polylysine) or GABA (adding concentration 0.0001 to 1g/dl) in these peptides, and measure the active intensity of giving kokumi.Sample solution becomes tart after sample dissolution, before using, with NaOH said sample solution is adjusted to pH 6.8 to 7.2.To assess with following perceptual evaluation and must assign to represent: control sample 0 minute; Strong activity is 3 minutes (like the intensity of 0.05g/dl γ-Glu-Cys-Gly and 0.005g/dl γ-Glu-Val-Gly); Extremely strong activity is 6 minutes (like the twice of the intensity of 0.05g/dl γ-Glu-Cys-Gly and 0.005g/dl γ-Glu-Val-Gly), and will test with n=12 and carry out.Sample has shown the activity of giving kokumi within aforesaid wide concentration range.Conventional concentration result is shown in table 12.The result is when for example calcium uses with existing calcium receptor activators etc., and existing agent with the active compound gsh of giving kokumi and the kokumi of giving of the present invention all shows the activity of the improved kokumi of giving.

Table 12

Industrial usability

Through the present invention, obviously having active specific amino acids of calcium receptor activation and peptide also is useful as the material of giving kokumi.Particularly, shown in embodiment 12 to 21, newly discovered several kinds of dipeptides and tripeptides as the material of giving kokumi, and because they are peptides, so they can use in requiring the field of food of high security.In addition,, therefore can use so-called high flux screening owing to developed the method for using the calcium receptor activation to give the material of kokumi as the screening of index, and therefore make exploitation more efficiently the kokumi material become possibility.

Although the present invention describes in detail with reference to its preferred implementation, it will be apparent to one skilled in the art that under the situation that does not deviate from the scope of the invention, can carry out multiple variation and use equivalent.Whole reference papers that this paper quotes are incorporated into for referencial use as the application's a part.

Claims

1. the compound that is expressed from the next: