CN102645420B - Method for detecting multiple harmful substance residual components in food based on surface plasma resonance technique - Google Patents
Method for detecting multiple harmful substance residual components in food based on surface plasma resonance technique Download PDFInfo
- Publication number
- CN102645420B CN102645420B CN201210110731.2A CN201210110731A CN102645420B CN 102645420 B CN102645420 B CN 102645420B CN 201210110731 A CN201210110731 A CN 201210110731A CN 102645420 B CN102645420 B CN 102645420B
- Authority
- CN
- China
- Prior art keywords
- aptamers
- probe
- residual component
- surface plasma
- plasma resonance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to a method for detecting multiple harmful substance residual components in food based on a surface plasma resonance (SPR) technique. The method comprises four steps of sensing surface aptamer fixing, sample marking, sample detecting and sensing element regenerating. The surface of a multi-probe optical fiber sensor is connected with the aptamer corresponding to different residual components; a molecular probe marker corresponding to different residual components is added and introduced on the sensing surface; unmarked and marked residual components carry out specificity competitive identification on the corresponding aptamer; molecular probe aptamer solution is introduced and combined with the marked sample connected on the surface of the optical fiber sensor for SPR detection by using the multi-probe optical fiber sensor; and the multi-probe optical fiber sensor can be used for regenerating to realize repeated use of the sensing element. Based on the SPR technique and the aptamer specificity competitive identification, multiple harmful substance residual components in one sample can be simultaneously detected, and the method provided by the invention is particularly suitable for detecting substances with small molecular weight.
Description
Technical field
The present invention relates to the how residual while detection technique of objectionable impurities in a kind of food.Particularly based on Applications of surface plasmon resonance, by aptamer and unmarked, mark sample, carry out specificity competition identification, adopt many probe Fibre Optical Sensors to detect the method for multiple harmful substances contained in foods simultaneously.
Background technology
In food the residual serious harm of objectionable impurities the public healthy, in the face of the significant challenge of food-safety problem, in analyzing and testing food, objectionable impurities is the important step ensuring food safety.Wherein, surface plasma resonance (Surface Plasmon Resonance, SPR), as a kind of hypersensitive fast detecting means, is one of ideal tools of food safety detection.But still there is the deficiencies such as signal to noise ratio (S/N ratio) is large, response is little, sensitivity is low in SPR, and in food, Acetamiprid, kanamycins, terramycin (agricultural chemicals veterinary drug), ochracin (biotoxin), malachite green (chemical pollutant) etc. are low-molecular-weight objectionable impurities when detecting low molecular weight substance.In addition, often have multiple harmful substances in food simultaneously, make testing process complexity loaded down with trivial details, the single material generally adopting at present detects and cannot meet the demands.Therefore,, in the urgent need to the novel detection method of exploitation based on SPR technology, realize the hypersensitive of multiple low-molecular-weight objectionable impurities in food, fast, simultaneously detect.
In recent years, the detection method based on aptamers identification presented huge applications prospect in food safety detection.Aptamers is nucleic acid (DNA or the RNA) fragment that can be combined with target molecules high specific.Because aptamers has high specific and high-affinity, be therefore called " chemical antibody ".With antibody, compare, aptamers has higher chemical stability, is difficult for inactivation, therefore more with potential applications.In addition, aptamers is prepared not Dependent Animals or cell, can pass through polymerase chain reaction (PCR) technology synthetic in a large number in vitro.Therefore,, based on aptamers specific recognition, in order to detect simultaneously, multiple harmful substances contained in foods provides the foundation and foundation.Mating surface plasma resonance technology, the hypersensitive that is expected to realize multiple harmful substances contained in foods detects simultaneously.
Summary of the invention
For solving problems of the prior art, the invention provides a kind of surface plasma body resonant vibration spectral technology that adopts and detect the residual method of multiple low-molecular-weight objectionable impurities in food, solve the problem that is difficult to simultaneously detect multiple low molecular weight substance in existing Applications of surface plasmon resonance.
Technical scheme of the present invention is: the how residual Simultaneous Detection of objectionable impurities in a kind of food of application surface plasma resonance technology, the content of the multiple harmful substances residual component in same sample is detected simultaneously, and it is characterized in that comprising the steps:
(1) sensor surface aptamers is fixed: many probes Fibre Optical Sensor of selecting Streptavidin SA to modify, each detecting head surface connects a kind of aptamers, by passing into 5-50 μ L concentration, be the 1-50 μ g/L corresponding aptamer of residual component of mark biotin, on many probe Fibre Optical Sensors, fix the corresponding aptamer of different residual components;
(2) residual component to be measured is carried out to molecular probe mark, labeling method is different according to determinand group, selects the crosslinked carboxyl of EDC/NHS method and amino or crosslinked two amino of glutaraldehyde method;
(3) the standard model storing solution of phosphate buffer configuration residual component standard solution preparation: with 0.01-0.1mol/L(pH=7.4), storing solution concentration is 0.1ng/mL to 1mg/mL, equivalent measures the standard reserving solution of residual component respectively, the hybrid standard stoste that preparation contains objectionable impurities residual component, with phosphate buffer, hybrid standard stoste is mixed with to the standard solution of variable concentrations, gets the standard solution of the unmarked residual component to be measured of variable concentrations and the residual component to be measured of molecular probe mark fully mixes;
(4) Criterion curve: adopt surface plasma resonance spectrometer to measure, the phosphate buffer of 0.02mol/L of take is measuring basis, by Micropump, pass into 5-100 μ L biased sample to be measured, pass into subsequently the aptamers solution of the molecular probe that 5-100 μ L concentration is 5-100ng/mL, record surface plasma body resonant vibration instrument spectrogram; Get the surface plasma body resonant vibration spectrogram stationary value of variable concentrations testing sample, drawing curve, and carry out polynomial curve fitting, obtain the equation of regression curve; Record successively the working curve of multiple harmful substances residual component, carry out polynomial curve fitting, obtain typical curve separately;
(5) quantitatively detect: the multiple residual component sample for unknown content detects, and carries out equally according to step (three); Pass into again appropriate molecular probe aptamers solution, adopt surface plasma resonance spectrometer to record the residual spectrogram of multiple harmful substances; By the corresponding regression curve equation of stationary value substitution of different residual components in spectrogram, calculate the concentration value of residual component in different food products;
(6) passing into 0.01-0.05mol/L(pH is 2-3) glycocoll-hydrochloric acid buffer solution, rinse many probe Fibre Optical Sensors surface, carry out sensing element regeneration, for measuring next time.
Described molecular probe comprises fibrin ferment or lysozyme or immunoglobulin E, and labeling method comprises EDC/NHS method or glutaraldehyde method.
Can adopt aptamer is identification molecule, and aptamer sequence is directly related with determinand.
Can adopt the sensing element that many probe Fibre Optical Sensors are surface plasma resonance instrument, each probe connects a kind of aptamers, altogether connects 4 ~ 16 kinds of different aptamers.
Described step (one) sensor surface aptamers is fixed, and comprises the steps:
(1) optical fiber sensing probe of Streptavidin SA being modified inserts in surface plasma body resonant vibration detector, carries out online sensing surface modification in service aisle;
(2) pass into 0.02mol/L(pH=7.4) phosphate buffer;
(3) pass into the labeled molecule aptamers solution that 5-50 μ L concentration is 1-50 μ g/L biotin modification, be coupled to online baseline stability;
(4) repeating step (2), to (3), obtains the optical fiber sensing probe that labeled molecule aptamers is modified.
Can adopt molecular probe mark determinand, identify with the competition of aptamer generation specificity together with unmarked sample.
In described step (four) and (five), pass into appropriate molecular probe aptamers solution, improve surface plasma body resonant vibration spectrometer response, be applicable to measure the little molecular weight objectionable impurities residual component that response signal is less.
Molecular weight < 1000 Da of described little molecular weight objectionable impurities residual component.
The surface plasma body resonant vibration adopting in the inventive method Fibre Optical Sensor of popping one's head in, in the fixing multiple different aptamers of sensor surface, based on aptamers specific recognition, can detect many kinds of substance more simultaneously.
The inventive method is introduced macromolecular markers fibrin ferment or lysozyme or immunoglobulin E, based on the aptamers competition of surface plasma resonance sensing surface, identify the target molecule of unmarked and mark, if target molecule is few in testing sample, the labeled molecule of surface plasma body resonant vibration adsorption is many, the surface plasma resonance response now causing is larger, and anti regular is less.Because molecular probe molecular weight is large, after the absorption of molecular probe aptamers specific recognition, surface plasma resonance response value further increases, and therefore, can realize the super sensitivity detection of small-molecule substance.
Provided by the invention based on surface plasma body resonant vibration spectrometer, adopt many probe Fibre Optical Sensors, detect the residual method of multiple low-molecular-weight objectionable impurities in food, compared with prior art have the following advantages: (1) adopts the aptamer of high stability is identification molecule, comparing antibody-antigen recognizing detects, greatly improve the serviceable life of sensing element, reduced testing cost; (2) adopt the surface plasma body resonant vibration Fibre Optical Sensor of popping one's head in more, can detect multiple harmful substances simultaneously, compare single material detection technique, greatly improved sample detection efficiency, shortened the sample detection time; (3) introduce the molecular probe with macromolecule, based on competition identification, can realize the super sensitivity detection of little molecule objectionable impurities, solved Applications of surface plasmon resonance and detected the problems such as the response of small molecular weight material is little, sensitivity is low.
Accompanying drawing explanation
Fig. 1 is that the multiple little molecule objectionable impurities based on surface plasma resonance of the present invention detects schematic diagram simultaneously; Wherein
for thrombin aptamer.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in detail.
Embodiment: selection fibrin ferment is molecular probe, and thrombin aptamer sequence is: GGTTGGTGTGGTTGG.
Selecting five kinds of typical food small molecular objectionable impuritiess is detected object, is respectively Acetamiprid, kanamycins, terramycin, ochracin, malachite green, and corresponding aptamers sequence is:
Acetamiprid aptamers---CCTGCCACGCTCCGCAAGCTTTGTAATTTGTCTGCAGCGGTTCTT
GATCGCTGACACCATATTATGAAGATAAGCTTGGCACCCGCATCGT
Kanamycins aptamers---CACCTAATACGACTCSCTATAGCGGATCCGAAGATGGGGGTTG
AGGCTAAGCCGACCGTAAGTTGGGCCGTCTGGCTCGAACAAGCTTGC
Terramycin aptamers---CGTACGGAATTCGCTAGCCGAGTTGAGCCGGGCGCGGTACGGGT
ACTGGTATGTGTGGGGATCCGAGCTCCACGTGGGATCCGAGCTCCACGTG
Ochracin aptamers---GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA
Malachite green aptamers---GGAUCCCGACUGGCGAGAGCCAGGUAACGAAUGGAUCC.
Concrete operation step is as follows:
(1) sensor surface aptamers is fixed: many probes Fibre Optical Sensor of selecting Streptavidin (SA) to modify, each detecting head surface connects a kind of aptamers, by passing into 10 μ L concentration, be the 30 μ g/L corresponding aptamers of residual component of mark biotin, on many probe Fibre Optical Sensors, fix the corresponding aptamer of different residual components;
(2) molecular marked compound coupling: five kinds of determinands are carried out to coupling mark by glutaraldehyde method and fibrin ferment, labeling method, according to determinand group different choice, comprises EDC/NHS method, glutaraldehyde method etc., as kanamycins, can adopt glutaraldehyde method to be connected with fibrin ferment, stand-by;
(3) standard solution preparation: take respectively Acetamiprid, kanamycins, terramycin, ochracin, 5 kinds of standard items 10mg of malachite green, be dissolved in 0.02mol/L(pH=7.4) phosphate buffer is settled to 10mL, is the standard stock solution of 1mg/mL; Equivalent measures 5 kinds of standard stock solutions respectively, the hybrid standard stoste 10 μ g/mL that preparation contains 5 kinds of objectionable impurities residual components; With phosphate buffer, hybrid standard stoste is mixed with to the standard solution of variable concentrations, concentration, in pg/mL ~ ng/mL level, is followed successively by 0,1ng/mL, 2ng/mL, 4ng/mL, 6ng/mL, 8ng/mL;
(4) Specification Curve of Increasing: to be the unlabelled standard solution of 0 ng/mL be marked with harmful substances solution with appropriate fibrin ferment fully mixes by above-mentioned concentration, and in this label solution, 5 kinds of objectionable impurities residual component content also equate; Adopt surface plasma resonance spectrometer to measure, passing into 0.02mol/L(pH=7.4) phosphate buffer is as measuring basis, then pump into biased sample to be measured, after response is stable, pass into thrombin aptamer solution, after surface plasma resonance response value stabilization, recording surface plasma resonance optical spectrum figure;
(5) pass into 0.02mol/L(pH=2.4) glycocoll-hydrochloric acid solution, rinse many probe Fibre Optical Sensors surface, destroy the combination of aptamers and determinand, complete sensing element regeneration;
(6) concentration, passes into the standard model measuring method to be measured of other concentration (1-8ng/mL) successively with (4) from low to high, obtains respective surfaces plasma resonance optical spectrum figure; Get the surface plasma spectrogram stationary value of each objectionable impurities residual component, drawing standard curve, and carry out polynomial curve fitting, obtain concentration-stationary value and be related to regression curve equation;
(7) after sensing chip regeneration, actual unknown concentration testing sample is marked with to harmful substances solution by step (4) with appropriate fibrin ferment and fully mixes; In the surface plasma body resonant vibration spectrometer pumping into, record the spectrogram of different objectionable impurities residual components simultaneously, determine corresponding stationary value, substitution is typical curve separately, determines each component concentration, and detectability can reach pg/mL ~ ng/mL level;
(8) again pass into 0.02mol/L(pH=2.4) glycocoll-hydrochloric acid solution, rinse the surface plasma body resonant vibration Fibre Optical Sensor of popping one's head in more, the regeneration of popping one's head in, for measuring next time.
The present invention is accurate and convenient for what narrate; take in an embodiment Acetamiprid, kanamycins, terramycin, ochracin, malachite green is described in detail as example; but the present invention is equally applicable to the mensuration of other objectionable impuritiess in food; as accurate detection and the qualitative analysis of botulin toxin, estradiol, TCs etc., so foregoing is all within protection domain of the present invention.In addition, according to the method for embodiment, detect sample, compare with existing surface plasma detection technique, accuracy improves 2 ~ 10 times, shorten detection time more than 5 times, probe life 20%, the little molecular weight (< 1000Da) materials such as Acetamiprid that existing surface plasma detection technique can not accurately detect, can adopt method of the present invention to obtain testing result accurately.
Claims (8)
1. the how residual Simultaneous Detection of objectionable impurities in the food of application surface plasma resonance spectrometer detects the content of the multiple harmful substances residual component in same sample simultaneously, it is characterized in that comprising the steps:
(1) sensor surface aptamers is fixed: many probes Fibre Optical Sensor of selecting Streptavidin SA to modify, each detecting head surface connects a kind of aptamers, by passing into 5-50 μ L concentration, be the 1-50 μ g/L corresponding aptamer of residual component of mark biotin, on many probe Fibre Optical Sensors, fix the corresponding aptamer of different residual components;
(2) residual component to be measured is carried out to molecular probe mark, labeling method is different according to determinand group, selects the crosslinked carboxyl of EDC/NHS method and amino or crosslinked two amino of glutaraldehyde method;
(3) standard solution preparation: the standard model storing solution of the phosphate buffer configuration residual component of the pH=7.4 of use 0.01-0.1mol/L, storing solution concentration is 0.1ng/mL to 1mg/mL, equivalent measures the standard reserving solution of residual component respectively, the hybrid standard stoste that preparation contains objectionable impurities residual component, with phosphate buffer, hybrid standard stoste is mixed with to the standard solution of variable concentrations, gets the standard solution of the unmarked residual component to be measured of variable concentrations and the residual component to be measured of molecular probe mark fully mixes;
(4) Criterion curve: adopt surface plasma resonance spectrometer to measure, the phosphate buffer of 0.02mol/L of take is measuring basis, by Micropump, pass into 5-100 μ L biased sample to be measured, pass into subsequently the aptamers solution of the molecular probe that 5-100 μ L concentration is 5-100ng/mL, record surface plasma resonance spectrometer spectrogram; Get the surface plasma resonance spectrometer spectrogram stationary value of variable concentrations testing sample, drawing curve, and carry out polynomial curve fitting, obtain the equation of regression curve; Record successively the working curve of multiple harmful substances residual component, carry out polynomial curve fitting, obtain typical curve separately;
(5) quantitatively detect: the multiple residual component sample for unknown content detects, and carries out equally according to step (three); Pass into again appropriate molecular probe aptamers solution, adopt surface plasma resonance spectrometer to record the residual spectrogram of multiple harmful substances; By the corresponding regression curve equation of stationary value substitution of different residual components in spectrogram, calculate the concentration value of residual component in different food products;
(6) pass into glycocoll-hydrochloric acid buffer solution that the pH of 0.01-0.05mol/L is 2-3, rinse many probe Fibre Optical Sensors surface, carry out sensing element regeneration, for measuring next time.
2. method according to claim 1, is characterized in that described molecular probe comprises fibrin ferment or lysozyme or immunoglobulin E, and labeling method comprises EDC/NHS method or glutaraldehyde method.
3. method according to claim 1, it is characterized in that adopting aptamer is identification molecule, aptamer sequence is directly related with determinand.
4. method according to claim 1, is characterized in that adopting how probe Fibre Optical Sensors are the sensing element of surface plasma resonance spectrometer, and each probe connects a kind of aptamers, altogether connects 4～16 kinds of different aptamers.
5. method according to claim 1, is characterized in that described step () sensor surface aptamers fixes, and comprises the steps:
(1) optical fiber sensing probe of Streptavidin SA being modified inserts in surface plasma resonance spectrometer, carries out online sensing surface modification in service aisle;
(2) pass into the phosphate buffer of the pH=7.4 of 0.02mol/L;
(3) pass into the labeled molecule aptamers solution that 5-50 μ L concentration is 1-50 μ g/L biotin modification, be coupled to online baseline stability;
(4) repeating step (2), to (3), obtains the optical fiber sensing probe that labeled molecule aptamers is modified.
6. method according to claim 1, is characterized in that adopting molecular probe mark determinand, identifies together with unmarked sample with the competition of aptamer generation specificity.
7. method according to claim 1, it is characterized in that passing in described step (four) and (five) appropriate molecular probe aptamers solution, improve surface plasma resonance spectrometer response, be applicable to measure the little molecular weight objectionable impurities residual component that response signal is less.
8. method according to claim 1, is characterized in that, molecular weight < 1000 Da of described little molecular weight objectionable impurities residual component.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210110731.2A CN102645420B (en) | 2012-04-17 | 2012-04-17 | Method for detecting multiple harmful substance residual components in food based on surface plasma resonance technique |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210110731.2A CN102645420B (en) | 2012-04-17 | 2012-04-17 | Method for detecting multiple harmful substance residual components in food based on surface plasma resonance technique |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102645420A CN102645420A (en) | 2012-08-22 |
| CN102645420B true CN102645420B (en) | 2014-01-15 |
Family
ID=46658377
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210110731.2A Expired - Fee Related CN102645420B (en) | 2012-04-17 | 2012-04-17 | Method for detecting multiple harmful substance residual components in food based on surface plasma resonance technique |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102645420B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103558154B (en) * | 2013-11-18 | 2015-09-23 | 广州赛宝计量检测中心服务有限公司 | A kind of rotary telescopic type analytic sample box and analysis sample |
| CN104178568B (en) * | 2014-07-25 | 2016-03-30 | 清华大学 | A kind of method based on the target substance in nucleic acid aptamer probe fluorescence sense analyzing and testing sample to be tested |
| CN105138820B (en) * | 2015-07-24 | 2019-01-15 | 天津大学 | A kind of calculation method suitable for the surface plasma resonance signal resonant wavelength under multimode fibre |
| CN106596927B (en) * | 2016-12-26 | 2018-10-19 | 中国科学院长春光学精密机械与物理研究所 | A kind of optical fiber bio probe and preparation method thereof and whole blood test method |
| CN106996923A (en) * | 2017-02-17 | 2017-08-01 | 丁利 | The method that a variety of environmental hormones are detected based on the surface plasma resonance technology that regenerated liquid optimizes simultaneously |
| CN106970048A (en) * | 2017-02-17 | 2017-07-21 | 丁利 | The method for detecting a variety of agricultural and veterinary chemicals residuals in food simultaneously based on the surface plasma resonance technology that regenerated liquid optimizes |
| CN110501506A (en) * | 2018-07-05 | 2019-11-26 | 东莞东阳光医疗智能器件研发有限公司 | A kind of biosensor and its application |
| CN109540847B (en) * | 2018-12-13 | 2021-10-19 | 山东师范大学 | graphene/gold/D type plastic optical fiber SPR sensor and preparation method thereof |
| CN113933281B (en) * | 2021-12-14 | 2022-03-18 | 中国农业大学 | Exosome detection method based on optical fiber evanescent wave fluorescence biosensor |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5891658A (en) * | 1996-06-27 | 1999-04-06 | FCI--FiberChem, Inc. | Single-step, solid-state competitive immunoassay |
| JP5463621B2 (en) * | 2008-02-27 | 2014-04-09 | ソニー株式会社 | Target substance quantification method |
| CN101349643B (en) * | 2008-08-18 | 2011-07-06 | 中国人民解放军第三军医大学第一附属医院 | Multichannel surface plasma wave sensing detection system |
-
2012
- 2012-04-17 CN CN201210110731.2A patent/CN102645420B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN102645420A (en) | 2012-08-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102645420B (en) | Method for detecting multiple harmful substance residual components in food based on surface plasma resonance technique | |
| CN102628802B (en) | Method for detecting biotoxins in foods based on surface plasma resonance technology | |
| Li et al. | Detection of peptides with different charges and lengths by using the aerolysin nanopore | |
| Zhang et al. | Molecular sensing with magnetic nanoparticles using magnetic spectroscopy of nanoparticle Brownian motion | |
| US9983191B2 (en) | Nanopore detection of small molecules through competition assays | |
| CN103852460B (en) | Based on the method that how residual the magnetic nano fluorescent sensor detection of antibiotics of aptamers is | |
| KR101945366B1 (en) | Detection of Nanopore of Low Molecule by Competition Test | |
| Huang et al. | Sensitive turn-on fluorescent detection of tartrazine based on fluorescence resonance energy transfer | |
| CN104569424B (en) | A kind of method of hair clip type DNA probe and detection by quantitative zymoplasm thereof | |
| CN110308289B (en) | Aminoglycoside antibiotic multi-residue simultaneous rapid fluorescence detection reagent and application thereof | |
| CN105044055A (en) | Detection method of protein and sensor array for protein detection | |
| Kaur et al. | Analytical techniques for characterization of biological molecules–proteins and aptamers/oligonucleotides | |
| CN102628803B (en) | Method for detecting pesticide and veterinary medicament residues in foods based on surface plasma resonance technology | |
| CN102980878A (en) | Quantitative plasmid DNA (Deoxyribonucleic Acid) detection kit | |
| CN106018513A (en) | Fingerprint method for detecting adulteration of dairy products | |
| CN102628801B (en) | Method detecting harmful compounds in plastic toy based on surface plasma resonance technology | |
| CN104483295A (en) | Method for detecting glycoprotein by molecularly imprinted microspheres based on boric acid fluorescence probe | |
| Chen et al. | Simultaneous identification and quantification of amino acids in biofluids by reactive 19 F-tags | |
| Wang et al. | A CRISPR/Cas12a-SERS platform for amplification-free detection of African swine fever virus genes | |
| CN110274982A (en) | The quantitative detecting method of rabies viruses inactivation antigen | |
| CN102661932B (en) | Method for identifying specific DNA sequences in germplasm resources based on surface plasma resonance technology | |
| CN110257388B (en) | Polypeptide aptamer capable of specifically recognizing arginine and application thereof | |
| Hennig et al. | Cucurbituril-based sensors and assays | |
| Decuir et al. | Automated capture and on-column detection of biotinylated DNA on a disposable solid support | |
| CN110221085B (en) | Streptomycin and neomycin multi-residue simultaneous rapid fluorescence detection reagent and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140115 Termination date: 20170417 |