CN102643824A - Method for preparing recombination cystatin C from yeast - Google Patents

Abstract

The invention relates to a method for preparing recombination cystatin C (CysC) from pichia pastoris. The method comprises the following steps that: 1) nucleotide sequences of the cystatin C are provided; 2) the nucleotide sequences are cloned into yeast expression vectors; 3) the vectors are transformed to the same yeast host; 4) the yeast host is induced to express the CysC with histidine tags at the C end; and 5) the CysC is purified. The method has the advantages that the expression quantity is high, expression products do not need degeneration or denaturation, the active CysC can be obtained, and in addition, the subsequent purification steps are also simple and convenient. The prepared recombination CysC can be used for CysC reagent kits for detecting the renal function.

Description

A kind of method that in yeast, prepares the bladder chalone C of recombinating

Technical field

The present invention relates to a kind of preparation method of recombination bladder chalone C, specifically, relate to a kind of method that in yeast, prepares the bladder chalone C of recombinating.

Background technology

Bladder chalone C (Cystatin C or abbreviation Cys C) is one of member in the half skin propylhomoserin proteinase inhibitor superfamily 2.Its molecular weight is 13kD, the lower molecular weight non-glycosylated protein matter of forming by 122 amino acid, and can be constant in all nucleated cells, transcribe constantly and express, can be regarded as House keeping gene.Bladder chalone C is a kind of small molecules plasma proteins, is cystatin, and the nucleated cell of human body can both stably produce.Bladder chalone C can freely be filtered by renal glomerulus, and its concentration and glomerular filtration rate(GFR are negative correlation, does not receive the interference of factors such as sex, age, diet, inflammation, blood fat, hepatic diseases, can reflect renal dysfunction more accurately.Therefore bladder chalone C is the endogenous mark that a kind of ideal reflection glomerular filtration rate(GFR (GFR) changes.All detect index to bladder chalone C as the renal function of generally acknowledging both at home and abroad at present.In view of current global CKD sickness rate constantly rises, bladder chalone C is as the diagnostic value paid more and more attention of clinical examination.

The mensuration of blood plasma bladder chalone C concentration has the important diagnostic meaning.But China does not also have the bladder chalone C diagnostic reagent of independent research basically at present; Reason just is to prepare the bladder chalone C diagnostic kit needs high specificity and the high anti-bladder chalone C monoclonal antibody of susceptibility, just must obtain highly purified bladder chalone C albumen and will obtain this monoclonal antibody.Mainly be from patient's urine, to extract bladder chalone C in the past, it is restricted not only to originate, and cost is high, and output is also extremely low.Produce bladder chalone C with gene recombination method, can solve this a series of problems.

Traditional method is extracted bladder chalone C and is had the shortcoming that is difficult to overcome from patient's urine, for example: yield is very low; Difference between batch is very big; There is Biosafety hidden danger, is difficult to suitability for industrialized production etc.And gene engineering method is expressed, and produces recombinant protein and can not have these problems.The most frequently used engineered protein expression system comprises intestinal bacteria and Yeast system.

In various expression systems, being used what study the earliest is escherichia expression system, also is to grasp the most sophisticated expression system at present.Its main method is with the carrier that is cloned into the goal gene dna fragmentation (being generally plasmid) transform bacteria (what select for use usually is intestinal bacteria), induces and the required target protein of final purifying acquisition through sec.-propyl-β-D-sulfo-galactopyranoside (IPTG) etc.

For expressing different albumen, need to adopt different carriers.At present known colibacillary expression vector can be divided into two kinds of non-pattern of fusion expression vector and pattern of fusion expression vectors.Non-fusion expression is that foreign gene is inserted into expression vector strong promoter and effective ribosome bind site sequence downstream, is initial translation with the AUG of external source gene mRNA, and expression product is consistent with natural target protein on sequence.Amalgamation and expression is that the dna sequence dna with target protein or many skins and another protein or polypeptide fragment melts to be incorporated in the thalline and expresses.The carrier that pattern of fusion is expressed comprises that secretion expression carrier, the expression vector of zone purification label, surface present expression vector, band companion's expression vector.

As development the earliest, present most widely used classical expression system, the escherichia expression system advantage is that genetic background is clear, breeding is fast, cost is low, expression amount is high, the easy purifying of expression product, good stability, contamination resistance is strong and applied widely etc.But meanwhile also there are many shortcomings that are difficult to overcome in prokaryotic expression system: often with the inclusion body formal representation, cause the product purification difficulty like target protein; And prokaryotic expression system translation post-treatment modification system imperfection, the biological activity of expression product is lower.

The exogenous protein expression system that yeast expression system rises as a kind of back owing to have the advantage of protokaryon and eukaryotic expression system concurrently, is just obtaining increasingly extensive application in the genetically engineered field.Being applied to engineered yeast the earliest is yeast saccharomyces cerevisiae.But compare with the saccharomyces neoformans system; There is the promotor that is not suitable for high-density culture, lacks strong strict regulation and control in the yeast saccharomyces cerevisiae expression system; And secernment efficiency is lower; Especially many molecular weight shortcoming such as secrete hardly greater than the foreign protein of 30kD, are not counted as the desirable host of recombinant protein usually.People had developed fission yeast, methanol yeast etc. again in succession afterwards.

The methanol yeast expression system is present most widely used yeast expression system.Methanol yeast mainly contains HPolymorpha at present, Candida Bodini, and 3 kinds of Pichia Pastris, and use maximum with Pichia Pastoris.The expression vector of methanol yeast is an integrative plasmid, contain in the carrier with yeast chromosomal in the homologous sequence, thereby relatively be easily integrated in the yeast chromosomal.All contain methanol yeast alcohol oxidase gene (AOX1) in the expression vector of most of methanol yeast, under promotor (PAOX1) effect of this gene, foreign gene is able to express.PAOX1 is a strong promoter, when being carbon source with glucose or glycerine.The AOX1 expression of gene is suppressed in the methanol yeast; And PAOX1 can be induced activation when being sole carbon source with methyl alcohol; Thereby foreign gene can be in down expression of its control, the goal gene multi-copy integration is gone into the expression level and the output that can improve foreign protein behind the yeast chromosomal.Methanol yeast is general grows in glycerinated substratum earlier.Be cultured to high density.Be carbon source again with methyl alcohol.The abduction delivering foreign protein.Can improve expression output greatly like this.Utilize methanol yeast to express its output of exogenous protein and often can reach the gram level.

The operation steps of intestinal bacteria system expression recombinant protein comprises:

(1) obtaining of goal gene: goal gene can comprise mikrobe, the animal or plant from suitable donor biology and extracting, also can be by the synthetic goal gene that specific function is arranged of chemical synthesis;

(2) selection of carrier system: a good carrier must possess several conditions: the replicon that is a tool the of self-replication capacity; Can in recipient cell, rise in value in a large number; The otch that has only a restriction endonuclease; A kind of selectivity genetic marker must be arranged on it.For escherichia expression system, carrier mainly is some relaxed type bacterial plasmids;

(3) reorganization of goal gene and carrier DNA: adopt restriction enzyme to handle and produce sticky end, annealed back is under the effect of ligase enzyme, and goal gene just combines to form recombinant vectors with carrier DNA;

(4) recombinant vectors imports recipient cell: in escherichia expression system, through conversion method plasmid is imported recipient cell, like CaCl ₂Conversion method, electricity are worn striking, thermal shock method etc.;

(5) Screening and Identification of recombinant bacterial strain: the recombinant bacterial strain to expressing carries out antibiotic-screening, ability large scale culturing after electrophoresis is identified;

(6) large scale culturing of recombinant bacterial strain: through adopting single-factor and orthogonal test to carry out the optimization of condition, large scale fermentation under optimal culture condition on bottle and the fermentor tank shaking;

(7) separation and purification of recombinant protein: commonly used have methods such as ion exchange chromatography, gel chromatography, affinity chromatography, membrane sepn, or several method is joined together.

The operation steps of Yeast system express recombinant protein comprises:

(1) clone of goal gene: select for use suitable restriction endonuclease the MCS of exogenous gene cloning in expression vector, if what select for use is secreted expression carrier, then the reading frame of the reading frame of foreign gene and signal peptide should be consistent;

(2) recombinant vectors linearizing: recombinant vectors has only digested linearizing, and integration efficiency could improve greatly, and the cyclic plasmid integration efficiency is very low, selects for use different restriction endonuclease linearizings can obtain different transformants;

(3) yeast conversion: electroporation, spheroplast, PEG, or Lithium Acetate select any conversion in above-mentioned four kinds of methods for use, generally select spheroplast or electroporation for use, because these two kinds of method transformation efficiencies are higher;

(4) screening: transformant is primary dcreening operation on the substratum that does not contain Histidine earlier, sieves available PCR again and carries out, and promptly extracts transformant DNA, and with foreign gene both sides special primer amplification screening, yet this is only limited to a small amount of transformant, and transformant is too many, and workload is too big.For the screening of a large amount of transformants, available original position dot blot carries out;

(5) identify phenotype: the transformant that filters out need be identified phenotype; Promptly confirm it is Mut, or Muts, these two kinds of different phenotypes are variant on the condition of abduction delivering; Can transformant with time point on MD and two kinds of flat boards of MM, growth difference little transformant is Mut+ on MD and MM flat board; On the contrary, it is fast on MD, to grow, and the very slow transformant of the last growth of MM is Muts;

(6) abduction delivering: the expression of foreign protein in methanol yeast in two steps, i.e. thalli growth and protein induced expression earlier cultivated thalline on the substratum that with glycerine is carbon source; After reaching certain OD value, it is abduction delivering in the substratum of carbon source that the centrifugal supernatant of abandoning, thalline are suspended in methyl alcohol; Add methyl alcohol at set intervals one time, to remedy the loss of methyl alcohol, the condition of expression has to be optimized; Like aeration status, pH value, composition of substratum or the like; In case top condition is confirmed, then can amplify in proportion, goes to large scale fermentation from shake-flask culture.

Existing both at home and abroad utilization intestinal bacteria (prokaryotic system) and yeast cell are expressed the article and the patent of bladder chalone C.But in fact the bladder chalone C expression product mainly exists with the inclusion body form in the intestinal bacteria system.The expression product of inclusion body form must be through complicated sex change, and renaturation is handled could recover its BA.All fail obviously to change the solvability of product through changing inducing temperature and IPTG concentration etc.People such as Zhang Wei (expression and the purifying of recombinant human cystatin C in intestinal bacteria; International laboratory medicine magazine, 2007,28 (5): though 393-394) utilization pet28a expression vector at expression in escherichia coli soluble expression product; But in fact according to our reproducible results; The pet28a carrier is at the expression in escherichia coli bladder chalone C, and solvable proportion of products is few, and the overwhelming majority is an inclusion body.(recombinant human Guang proteinase inhibitor C efficiently expressing in the pichia yeast bacterium, Chinese laboratory medicine magazine 2002,25 (5): 271-272) utilize the pet22b expression vector, at the escherichia coli expression bladder chalone C, the product that obtains also is an inclusion body to people such as Li Haixia.

Maike Tech Co., Ltd., Sichuan Prov. (recombinant human cystatin C genes and expression thereof and application; One Chinese patent application number: 200810147715.4) with expression vector pet32a at expression in escherichia coli soluble bladder chalone C, but expression product is the fusion rotein that has Trx.If remove to prepare antibody with this fusion rotein, the possible specificity of the antibody that obtains is not strong, because the antibody that might prepare is to Trx antigen part in the fusion rotein.So preferably with enteropeptidase excision Trx part.And adopt the enteropeptidase excision, not only increase cost (enteropeptidase cost), and increased purification step (after enteropeptidase digestion, needing once more purifying to remove enteropeptidase).

(recombinant human Guang proteinase inhibitor C efficiently expressing in the pichia yeast bacterium, Chinese laboratory medicine magazine 2002,25 (5): 271-272) in the pichia yeast bacterium, expressed bladder chalone C, expression product has BA to people such as Li Haixia.The document is utilized Yeast expression carrier pPIC9, expression amount 16mg/L, and behind ion-exchange purification, the recovery is about 40%.

Summary of the invention

In view of above deficiency; Main purpose of the present invention is to provide a kind of method that in yeast, prepares the bladder chalone C of recombinating; The advantage of present method is: the bladder chalone C that the zymic eukaryotic expression system is produced can correctly fold and possess BA; And be that mode with secreting, expressing is present in the substratum, foreign protein is few in the nutrient solution, very helps proteic purifying.Comparing with people's such as Li Haixia yeast expression product, is pPIC9K because the present invention uses Yeast expression carrier, can on the G418 resistant panel, screen highly to copy yeast transformant, thereby expression amount is increased substantially.In addition, the present invention holds the label (His tag) that has added six Histidines at cystatin C genes N, and purifying gets up very convenient, and the recovery is high.Work contrast (expression amount 16mg/L with people such as Li Haixia; The ion-exchange purification recovery 40%); It is more than the 120mg/L that the high copy of the yeast of the present invention's screening transforms expression amount, and through one step of nickel post affinity chromatography, the recovery is greater than 70%; Purity can satisfy the needs of Antibody Preparation fully more than 95%.

In order to reach above purpose, the present invention is that this method comprises with the method for yeast as preparing carriers reorganization bladder chalone C:

1). the nucleotide sequence of coding bladder chalone C is provided;

2). above-mentioned nucleotide sequence is cloned in the different Yeast expression carriers;

3). above-mentioned carrier is converted into unified yeast host;

4). induce above-mentioned yeast host to express the bladder chalone C that the C end has histidine-tagged (His tag);

5). the above-mentioned bladder chalone C of purifying.

Preferably, the nucleotide sequence of the said coding bladder chalone C in the step 1 can be confirmed according to used host's codon preference, to increase host's expression efficiency.This method is a technology known in those skilled in the art, and definite method of nucleotide sequence can be referring to " the codon usage analysis of pichia spp ", biotechnology journal, Li Yuyang etc., 2000 (3): 308-311 particularly.

Said Yeast expression carrier in the step 2 can be in order to express the shuttle vectors of foreign protein for any one; Preferably; Said Yeast expression carrier adopts the carrier of invitrogen company, for example pPIC9K, pPIC3.5K, pPICZ α A, pPICZ α B, pPICZ α C, pPICZA, pPICZB, pPICZC, pAO815 etc.

Said yeast host in the step 3 can directly be expressed the correct target protein of conformation as a kind of eukaryotic expression system, need not follow-up sex change and renaturation process.Therefore method of the present invention has no restriction to the kind of yeast host, and preferred yeast strain can be debaryomyces hansenii, pichia spp, candiyeast, torulopsis glabrata etc., and preferred yeast strain is a pichia spp.

The method of inducing the yeast host expressing protein in the step 4 also is a technology known in the field.Preferably, said histidine-tagged be the aminoacid sequence that contains 6 successive Histidines, in the abduction delivering process, use methyl alcohol as sole carbon source, and make the final concentration of methyl alcohol reach 0.5% to 3%, make that target protein can obtain to express more efficiently.

Purifying in the step 5 has histidine-tagged proteinic technology and method is known in those skilled in the art, and concrete grammar can be referring to for example GE company: the protein purification operational guidance.Purification process of the present invention preferably adopts Ni ²⁺-NTA matrix is carried out, and is that the imidazoles solution of 20mM to 250mM comes the wash-out target protein through gradient.

The present invention prepares bladder chalone C and has the following advantages:

1. in the yeast eukaryotic expression system, carry out recombinant expressedly, the expression product bladder chalone C need not sex change and renaturation, collects supernatant of culture medium behind the abduction delivering and can obtain activated bladder chalone C.

2. expression amount is very high, and foreign protein seldom.Expression amount can reach 120mg/L (shaking in the bottle) at least, even purifying not, purity of protein can reach more than 80%.Expectation is in fermentor tank, because air flow, glycerine, methanol content are controlled more easily, and expression amount can improve more than 4 times than shaking in the bottle at least.

3. express generating the bladder chalone C that the C end has histidine-tagged (His tag), make in follow-up affinity chromatography process, only need the single step purification step can obtain pure article.

4. as the nucleotide sequence of the bladder chalone C of coding is provided according to yeast preference codon, can also further improve expression amount.

5. as in the abduction delivering process, making the final concentration of methyl alcohol reach 0.5% to 3%, can express bladder chalone C more efficiently.

Description of drawings

Fig. 1 is the cystatin C genes pcr amplification synoptic diagram as a result of recombinating;

Fig. 2 is reorganization bladder chalone C yeast transformant PCR qualification result synoptic diagram;

Fig. 3 is the positive transformant abduction delivering of reorganization bladder chalone C screening synoptic diagram as a result;

Fig. 4 is the purity qualification result synoptic diagram of reorganization bladder chalone C;

Fig. 5 measures synoptic diagram as a result for the immunologic competence of reorganization bladder chalone C.

Embodiment

Below in conjunction with specific embodiment and accompanying drawing technical scheme of the present invention is further specified, but its qualification of not opposing:

(1), material:

Bacterial strain and plasmid: clone bacterial classification Escherichia coli (DH5a) is a genetically engineered common tool bacterial classification; Pichia pastoris phaff (Pichia pastoris) GS-115, KM-71, KM-71H, X-33, SMD-1168, SMD-1168-H; Plasmid pPIC9K, pPIC3.5K, pPICZ α A, pPICZ α B, pPICZ α C, pPICZA, pPICZB, pPICZC, pAO815 purchase the company in invitrogen.

Enzyme and reagent:

Relate to the used enzyme of molecular biology operation among the embodiment and all purchase in Beijing through company of HTC of section, respective phases of operation is carried out according to relevant product description fully.

PCR purification kit, sepharose recovery test kit, plasmid extraction test kit, PCR product purification test kit (Quan Shijin), cerevisiae dna extract test kit and all purchase the root company (TianGen) in sky, Beijing, and respective phases of operation is carried out according to relevant product description fully.

The examining order of the synthetic and DNA of synthetic, the primer of the nucleotide sequence of related coding bladder chalone C is accomplished by the big gene of China among the embodiment.

Microbiotic G418 purchases the company in invitrogen.

Substratum:

1 following substratum is solid and liquid nutrient medium

LB substratum, AMP resistance LB substratum, YPD substratum, MD substratum, GLP18 resistance YPD substratum

2YPD G-418 solid medium, BMGY substratum, BMMY substratum

Above substratum is a genetically engineered field substratum commonly used, and the prescription of each substratum can be referring to the 64th page the-the 70th page of the pichia spp operational manual (Multi-Copy Pichia Expression Kit) of molecular cloning third edition volume two appendix 2 and invitrogen company; And pPICZ α A, B, the 18th page of and C 17-.

(2), method:

Polymerase chain reaction, the PCR product purification, the enzyme of gene and plasmid is cut, reclaims, is connected and transforms; And the screening of intestinal bacteria transformant, identify these genetically engineered routine operation methods; Can be referring to Sambrook J, Fristsh EF, Maniatis T.MolecularCloning; A Laboratory Manual 2nd ed.NY:Cold Spring Harbor Laboratory Piess, 1989, pp.16-340.The linearizing of recombinant yeast expression vector plasmid; Yeast conversion; The screening of transformant, abduction delivering and express and identify can be referring to the 32nd page the-the 63rd page of the pichia spp operational manuals (Multi-Copy Pichia Expression Kit) of invitrogen company.And pPICZ α A, B, the 14th page of and C 9-.

The structure of embodiment 1 reorganization bladder chalone C expression vector

1. the full gene of bladder chalone C is synthetic: according to the nucleotide sequence of pichia spp codon preference chemosynthesis cystatin C genes, final gene is the base sequence shown in the SEQ ID NO:1.

With above-mentioned synthetic base sequence as template, with the design two primers be the upstream and downstream primer, carry out pcr amplification, wherein,

Upstream primer CysC-U (SEQ ID NO:2):

GCTTACGTACATCATCACCATCACCATCCAGTCCCGGCAA

Downstream primer CysC-R (SEQ ID NO:3):

TTATGCGGCCGC?CTATTAGGCGTCCTGA

The PCR reaction system is:

Template (synthetic gene) 0.5ul,

Upstream primer CysC-U (10uM) 0.5uL,

Downstream primer CysC-R (10uM) 0.5uL,

NTPs(10mM) 2.5uL，

5 times of pfu damping fluid 5uL,

Archaeal dna polymerase pfu (1U/uL) 0.5uL,

Sterilized water 15.5uL,

TV: 25uL.

Amplification condition is:

95℃2min；

95 ℃ of 20sec, 55 ℃ of 20sec, 35 circulations of 72 ℃ of 40sec;

72℃10min。

Cystatin C genes pcr amplification result sees Fig. 1, and wherein M is QDL2000Quantitative DNA Marker;

1 is ddH ₂O is the PCR negative control of template; 2,3 is bladder chalone C PCR product.

3. above-mentioned PCR product is carried out purifying with the PCR purification kit.

4. use restriction enzyme SnaBI and NotI that above-mentioned PCR purified product is carried out double digestion, and reclaim test kit with sepharose and cut the glue recovery.

5. use restriction enzyme SnaBI and NOtI that plasmid pPIC9K is carried out double digestion, and reclaim test kit with sepharose and cut the glue recovery.

6. use the fragment of recovery in T4 ligase enzyme Connection Step (4) and the step (5), wherein to cut the concentration ratio of product be 1 for plasmid enzyme restriction product and cystatin C genes enzyme: 3-5.

7. above-mentioned connection product is imported among the Escherichia coli (DH5a) through the method that CaCl2 transforms, and coat the LB substratum, 200rpm in shaking table cultivated 1 hour, and got bacterium liquid then and be laid on ammonia benzyl resistance LB substratum, 37 ℃ of overnight cultures for 37 ℃.

8. select 8 to 20 transformants, insert ammonia benzyl resistance LB substratum respectively, overnight cultures.From these overnight culture, extracted plasmid again in second day with the plasmid extraction test kit.SnaBI and NotI double digestion clone identify.The positive colony of screening is delivered to Beijing Nuo Sai genome company and is carried out sequencing, selects the correct bladder chalone C recombinant plasmid of sequencing result.

9. carry recombinant plasmid greatly, the SacI linearization plasmid uses PCR product purification test kit (Quan Shijin) purifying then, obtains the linearizing recombinant plasmid.

The structure of embodiment 2 reorganization bladder chalone C Yeast engineering bacterias

According to the pichia spp operational manual of invitrogen company, the reorganization TRY zymogen expression carrier electricity after the above-mentioned linearizing is converted in the GS115 pichia spp competent cell.GS115 pichia spp after will transforming is then coated on the MD solid medium, hatches 3-4 days for 29 ℃.

Picking transformant from the above-mentioned solid medium is transferred to 0.5mg/ml YPD G-418 successively, 1.5mg/ml YPD G-418, and 3mg/ml YPD G-418, on the 4mg/ml YPD G-418 solid medium, 29 ℃ of cultivations are to screen the transformant of high copy.After treating that high copy transformant is grown, picking list colony inoculation is in 5ml MD liquid nutrient medium, and 29 ℃, 200rpm cultivates two days after certain OD value, extracts yeast transformant genome step and sees the pichia spp operational manual of invitrogen company.Yeast conversion to extract is a template from genome, with pPIC9K general forward primer 5AOX1 and reverse primer 3AOX1PCR amplification, comes further to identify different yeast transformants.

The PCR reaction system is:

Template (genome, about 1ug) 5ul,

5AOX1 primer (0.1ug/ul) 5uL,

3AOX1 primer (0.1ug/ul) 5uL,

NTPs(100mM) 1uL，

10xPCR damping fluid 5uL,

Taq?polymerase(5U/uL) 0.25uL，

Sterilized water 13.25uL,

TV: 50uL

Amplification condition is:

94℃2min；

94 ℃ of 1min, 55 ℃ of 1min, 35 circulations of 72 ℃ of 1min;

72℃7min。

Yeast transformant PCR qualification result is seen Fig. 2, and wherein M is QDL2000 Quantitative DNA Marker; 1,2,3 is yeast transformant GS115/pPIC9K-Cys C; 4 is ddH ₂O is the PCR negative control of template.

Embodiment 3 reorganization bladder chalone Cs are expressed the abduction delivering of engineering bacteria

The yeast transformant that above-mentioned PCR is identified is inoculated in the 10ml YPD liquid nutrient medium according to 2% inoculum size, and 28 ℃, 200rpm cultivates; After treating that bacteria growing gets up, it is inoculated in the 1L BMGY liquid nutrient medium 28 ℃ according to 0.5% inoculum size; 200rpm cultivates, and treats OD _600nmFor about 2 o'clock, centrifugal, abandon supernatant, with the resuspended thalline of 0.5L BMMY liquid nutrient medium, be loaded on 2L and shake in the bottle, 28 ℃, 200rpm adds methyl alcohol to 1% (V/V) and cultivates, and replenishes methyl alcohol to 1% (V/V) once more in per 24 hours, induces until the 4th day to finish.The reorganization bladder chalone C by secreting, expressing to liquid nutrient medium.The positive transformant abduction delivering electrophoresis result of reorganization bladder chalone C screening is seen Fig. 3, and wherein M is a protein molecular weight standard; 1 for contrasting the supernatant that transformant GS115/pPIC9K induced 6 days; 2-6 induces 6 days supernatant respectively for reorganization transformant GS115/pPIC9K-Cys C.

The purifying and the evaluation of embodiment 4 reorganization bladder chalone Cs

Above-mentioned nutrient solution supernatant is carried out purifying with NTA-Ni prepacked column (GE company), at first use the 20mM imidazoles to carry out wash-out to remove foreigh protein removing, 250mM imidazoles wash-out target protein (bladder chalone C) is collected component peaks then, obtains containing the bladder chalone C solution of imidazoles.

The above-mentioned bladder chalone C solution that contains imidazoles is removed imidazoles with desalting column (GE company), and elutriant is for comprising 24.75mMTris and 100mM NaCl, and pH is 7.65 solution, collects component peaks, obtains pure article bladder chalone C solution.Final every liter of fermented liquid can obtain greater than 80mg reorganization bladder chalone C.

The purity of SDS-PAGE electrophoresis detection reorganization bladder chalone C, the result sees Fig. 4, wherein M is a protein molecular weight standard; 1 is the bladder chalone C of affinitive layer purification, can learn from figure, and gained reorganization bladder chalone C purity is very high, greater than 95%.

The immunologic competence of embodiment 5 reorganization bladder chalone Cs is measured (Western Blotting)

Material:

Reorganization bladder chalone C solution comprises: according to the reorganization bladder chalone C of embodiment 1-4 step preparation, and 24.75mM Tris, 100mM NaCl, and adjusting pH value is 7.65.

One is anti-: Anti-Cystain C antibody (Mouse monclonal) ab24327

Two is anti-: Peroxidase-conjungated Affinipure Goat Anti-Mouse IgG (H+L)

Chemical luminous substrate: ECL Western Blotting substrate (purchases in Themro Pierce, article No.: 32106)

Instrument: BIO-RAD Molecular Imager ChemiDoc ^TMXRS ⁺Imaging System

After the SDS-PAGE electrophoresis finishes, with the half-dried commentaries on classics film of the albumen in the gel to PVDF.Change the film rear enclosed that finishes.After sealing is accomplished, rinsing, room temperature 2 hours is hatched in one anti-(1: 4000).Wash each 5-10 minute three times.Two anti-(1: 8000) are hatched room temperature 1-2 hour then.Wash each 5-10 minute three times.Colour developing then: A liquid and B liquid volume in container of ECL Plus colour developing liquid are mixed at 1: 1,, behind the 1min, film is fully contacted with the liquid that develops the color according to the size of film confirm the to develop the color amount of liquid.Film is placed on the transparent film, puts into the imaging of BIO-RAD Molecular Imager sequentially exposing, select the imaging of best exposure time.Experimental result is seen Fig. 5, and wherein M is preparatory dsred protein molecular weight standard; 1,4 are contrast transformant GS115/pPIC9K tunning; 2 bladder chalone Cs for reorganization transformant GS115/pPIC9K-Cys C expression; 3 is the reorganization bladder chalone C of affinitive layer purification.

Below technology contents of the present invention has been done detailed description.As far as persons skilled in the art, any conspicuous change of under the prerequisite that does not deviate from the principle of the invention, it being done can not exceed the protection domain of the application's accompanying claims.

Claims (8)

1. a method that in yeast, prepares the bladder chalone C of recombinating is characterized in that, may further comprise the steps:

1). the nucleotide sequence of coding bladder chalone C is provided;

2). above-mentioned nucleotide sequence is cloned in the Yeast expression carrier;

3). above-mentioned carrier is converted into same yeast host;

4). induce above-mentioned yeast host to express the C end and have histidine-tagged bladder chalone C;

5). the above-mentioned bladder chalone C of purifying.

2. the method that in yeast, prepares the bladder chalone C of recombinating according to claim 1 is characterized in that the nucleotide sequence of the said coding bladder chalone C in the step 1) is confirmed according to used host's codon preference.

3. the method that in yeast, prepares the bladder chalone C of recombinating according to claim 1 is characterized in that, the said nucleotide sequence coding in the step 1) is shown in the SEQ ID NO:1.

4. the method that in yeast, prepares the bladder chalone C of recombinating according to claim 1; It is characterized in that step 2) in said Yeast expression carrier be selected from one of pPIC9K, pPIC3.5K, pPICZ α A, pPICZ α B, pPICZ α C, pPICZA, pPICZB, pPICZC or pAO815.

5. the method that in yeast, prepares the bladder chalone C of recombinating according to claim 1 is characterized in that the said yeast host in the step 3) is selected from one of debaryomyces hansenii, pichia spp, candiyeast or torulopsis glabrata.

6. the method that in yeast, prepares the bladder chalone C of recombinating according to claim 1 is characterized in that, said histidine-tagged in the step 4) is the aminoacid sequence that contains 6 successive Histidines.

7. the method that in yeast, prepares the bladder chalone C of recombinating according to claim 1 is characterized in that, the said abduction delivering in the step 4) uses methyl alcohol as sole carbon source, and to make the final concentration of methyl alcohol be volume ratio 0.5% to 3%.

8. the method that in yeast, prepares the bladder chalone C of recombinating according to claim 1 is characterized in that, the purifying in the step 5) adopts Ni ²⁺-NTA matrix is carried out, and adopts imidazoles solution to carry out wash-out.

Images