CN102634579A - Kit for detecting genic mutation of deafness associated genes GJB3 - Google Patents
Kit for detecting genic mutation of deafness associated genes GJB3 Download PDFInfo
- Publication number
- CN102634579A CN102634579A CN2012100871484A CN201210087148A CN102634579A CN 102634579 A CN102634579 A CN 102634579A CN 2012100871484 A CN2012100871484 A CN 2012100871484A CN 201210087148 A CN201210087148 A CN 201210087148A CN 102634579 A CN102634579 A CN 102634579A
- Authority
- CN
- China
- Prior art keywords
- gjb3
- gene
- pcr
- primer
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kit for detecting genic mutation of deafness associated genes GJB3, which is characterized by comprising PCR (polymerase chain reaction) amplification reagent and a PCR primer for amplifying the genes GJB3 in a DNA (deoxyribonucleic acid) sample, wherein a JB3 upstream primer sequence is GGTCGTTGTGAGTATTGAAC, and a GJB3 downstream primer sequence is AGGTCCTACAGGGGCTGAGTGACCC.
Description
Technical field
The invention belongs to life science and biological technical field, particularly a kind of test kit that detects deaf-related gene GJB3 transgenation.
Background technology
In China, listen the barrier crowd to surpass 2,000 ten thousand, child patient is about 800,000, and 80,000 of deaf infants of annual New Development.These patients mostly suffer from the phonosensitive nerve deafness of interchange of having a strong impact on and treatment difficulty, and wherein deafness accounts for more than 50% due to the inherited genetic factors.Can hereditary hearing impairment be divided into according to different modes of inheritance: 1, autosomal dominant inheritance property is deaf; 2, autosomal recessive hereditary deafness; 3, the deafness that mitochondrial gene mutation causes; 4, sex linked inheritance property is deaf.It is generally acknowledged that 50% is changed by genetic material and to cause in the deafness patient.
Except that the deafness that GJB2, SLC26A4 and mtDNA12s rRNA (plastosome XLT) transgenation causes, GJB3 causes one of deaf reason in China.The GJB3 assignment of genes gene mapping is in human chromosomal 1p33-p35, and its complete encoding sequence comprises the ORFs of being made up of 813 Nucleotide, the shearing point that is positioned at 25 Nucleotide places, the atg start codon ATG upper reaches and 3 ' end non-translational region.Coding has 270 amino acid whose slits to connect egg Connex-in31, and total length 3617bP, Cx31 molecular weight are 30.8kD.Structural analysis of protein determines that it is the p-slit and connects albumen.Each born of the same parents' outer shroud comprises 3 conserved cysteine residue.The gene (GJB3) of coding Connex-in31.The slit connects distribution extensively, almost is present in all zooblasts.The slit connects by connecting the wetting ability transmembrane channel that albumen formed, connected flanking cell, communication between mediated cell.Slit in the inner ear connects and mainly is present between each subgroup of non-sensory epithelial cell.Comprising the basal cell of the fibrocyte in i-coch sustenticular cell and conjunctive tissue cell such as the spiral ligament, stria vascularis and intermediate cell etc.The slit connects the protein gene sudden change influences potassium ion circulation approach, thereby influences endolymphatic potential, finally causes the hair cell dysfunction.
The GJB3 transgenation can cause autosomal dominant or recessive inheritance non-syndrome deafness.As: the 547th bit base G → A sudden change causes No. 183 amino acid to have L-glutamic acid to become Methionin; The C of the 538th bit base → T sudden change causes No. 180 amino acid to become terminator codon; The sudden change of the 423rd bit base A → G causes No. 141 amino acid to become Xie Ansuan by Isoleucine.
Summary of the invention
The objective of the invention is to, a kind of test kit that detects deaf-related gene GJB3 transgenation is provided, can be used for detecting the GJB3 gene mutation site.
Detect the test kit of deaf-related gene GJB3 transgenation, it is characterized in that, comprising:
(i) pcr amplification reaction reagent;
The PCR primer that (ii) is used for amplified sample DNA GJB3 gene: JB3 upstream primer sequence: GGTCGTTGTGAGTATTGAAC; GJB3 downstream primer sequence: AGGTCCTACAGGGGCTG AGTGACCC.
Further, the method for use of said test kit comprises the steps:
(i) gather blood sample to be measured, extract DNA;
Be template (ii), carry out pcr amplification, obtain the PCR reaction product with the said PCR primer that is used for amplified sample DNA GJB3 gene with this DNA;
(ⅲ), compare, determine whether to exist the 547th bases G → A mutational site, the 538th base C → T mutational site, 423-425 base ATT deletion segment or the 423rd base A → G mutational site with GJB3 normal gene sequence to the order-checking of PCR reaction product.
Step PCR reaction is (ii) increased by following condition: 94 ℃ of 2 min; 98 ℃ of 10s, 66 ℃ of 30s, 68 ℃ of 40s, 16 circulations; 98 ℃ of 10s, 60 ℃ of 30s, 68 ℃ of 40s, 20 circulations; 68 ℃ of 6 min.
Because 547 G → A, 538 C → T sudden change cause karyomit(e) dominance non-syndrome deaf in the Chinese GJB3 gene; 423 A → G causes recessive non-syndrome deaf.Therefore can design suitable forward and reverse primer the GJB3 gene is increased, and amplified production is directly checked order through comparing with above-mentioned site in the GJB3 gene of wild-type sample.Can be used for judging whether to exist 547 G → A, 538 C → T, 423 A → G sudden change.
The PCR primer of GJB3 gene is used in the test kit of the present invention to increase; Wherein 3 ' the end of forward primer GJB3 is positioned at the about 138bp place, the GJB3 gene coding region upper reaches shown in sequence SEQ ID NO:1; 3 ' the end of reverse primer GJB3 is positioned at about 906bp place, downstream of this coding region; Positive and negative phase primer size is respectively 20bp, 25bp, and the GJB3 gene coding region that can increase fully.SEQ ID NO:1 has provided the gene order of GJB3 coding region.
Above-mentioned primer designs through following scheme: use the Primer 6.0r software assistance to design primer; Pass through pcr amplification; Increased fully in the GJB3 coding region, directly check order then, whether undergo mutation through order-checking detection 547 G → A, 538 C → T, 423 A → G site.
GJB3 upstream primer sequence: GGTCGTTGTGAGTATTGAAC
GJB3 downstream primer sequence: AGGTCCTACAGGGGCTGAGTGACCC
With above-mentioned designed primer the censorship sample is carried out pcr amplification, and the PCR product is carried out the mutational site that sex change behind forward and reverse survey reaction amplification, the purifying, direct order-checking can accurately detect full coding.
Utilize the directly method of order-checking; The GJB3 gene is carried out the sudden change of full coding region to be detected; Hereditary hearing impairment also can be intervened through technique of gene detection in advance like this; Father and mother just can recognize that before pregnant the probability of hereditary hearing impairment appears in children, and in pregnant, fetus are detected, and see whether it exists hereditary hearing impairment.To birth with regard to severe deafness or complete deafness newborn infant, can the clear and definite cause of disease, as confirming what heredity caused, just can join osophone or cochlear implant as early as possible, make infant deaf and do not make mute, with the normal communication of people.Really accomplish " early finding ", " prevention early ", " early intervening ".
Description of drawings
After Fig. 1 is GJB3 gene amplification, the electrophorogram behind 1.5% agarose gel electrophoresis.As shown in the figure, the purpose fragment is about 1000bp.Wherein, swimming lane 1-3 is examined samples from left to right, and swimming lane 4 is the Marker of TAKARA 2000.
Fig. 2 A sample behind the GJB3 primer amplification, the sequencing result of the 423rd base.Can know by figure, not find sample the 423rd base A → G sudden change.
Fig. 2 B sample behind the GJB3 primer amplification, the sequencing result of the 423rd base.Can know by figure, find sample the 423rd base A → G heterozygous mutant.
Fig. 3 A sample behind the GJB3 primer amplification, the sequencing result of the 538th base.Can know by figure, not find sample the 538th base C → T sudden change.
Fig. 3 B sample behind the GJB3 primer amplification, the sequencing result of the 538th base.Can know by figure, find sample the 538th base C → T homozygous mutation.
Fig. 4 A sample behind the GJB3 primer amplification, the sequencing result of the 547th base.Can know by figure, not find sample the 547th bases G → A sudden change.
Fig. 4 B sample behind the GJB3 primer amplification, the sequencing result of the 547th base.Can know by figure, find sample the 547th bases G → A homozygous mutation.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be noted that; Unaccounted normal condition and method among the embodiment; Usually according to the conventional employing method of affiliated field experimenter: for example, Ao Sibai and James Kingston chief editor's " fine works molecular biology experiment guide " the 4th edition, the step and the condition of perhaps advising according to manufacturer.
Embodiment 1
Detect the test kit of deaf-related gene GJB3 transgenation, comprising:
(i) pcr amplification reaction reagent; Comprise dNTP, 10*PCR damping fluid, Mg
2+, distilled water, Tag enzyme etc.
The PCR primer that (ii) is used for amplified sample DNA GJB3 gene: JB3 upstream primer sequence: GGTCGTTGTGAGTATTGAAC; GJB3 downstream primer sequence: AGGTCCTACAGGGGCTG AGTGACCC.
The method of use of said test kit comprises the steps:
(i) gather blood sample to be measured, extract DNA;
Be template (ii), carry out pcr amplification, obtain the PCR reaction product with the said PCR primer that is used for amplified sample DNA GJB3 gene with this DNA;
(ⅲ), compare, determine whether to exist the 547th bases G → A mutational site, the 538th base C → T mutational site, the 423rd base A → G mutational site with GJB3 normal gene sequence to the order-checking of PCR reaction product.
Use the GJB3 primer that is designed that the GJB3 gene is increased through the clinical examined samples of hundreds of example.Find that this primer has higher stable amplification property, specificity; As sequencing primer, no matter be forward or the oppositely all disposable GJB3 of running through ORF and flanking sequence simultaneously.
Embodiment 2
1) sample extracting:
Add the 900uL erythrocyte cracked liquid 1.1 extract 300uL blood, put upside down mixing, room temperature was placed 5 minutes, during put upside down mixing more several times.Centrifugal 1 minute of 10000rpm (if the whizzer maximum speed does not allow, but the centrifugal 5min of 3000rpm) inhales and removes supernatant, stays the white corpuscle deposition, adds 200uL damping fluid GA, vibration to thorough mixing.
1.2 add 20 μ l Proteinase K solution, mixing.
1.3 add 200 μ l damping fluid GB, fully put upside down mixing, to place 10 minutes for 70 ℃, the solution strain is limpid, and is brief centrifugal to remove the globule of cap wall.
1.4 add people's 200 μ l absolute ethyl alcohols, the mixing 15 seconds of fully vibrating, flocks may appear in this moment, and is brief centrifugal to remove the globule of cap wall.
All add among the adsorption column CB3 (adsorption column is put into collection tube) 1.5 will go up step gained solution and a flocks, 12,000rpm (13,400 * g) centrifugal 30 seconds, outwell waste liquid, CB3 puts back in the collection tube with adsorption column.
1.6 in adsorption column CB3, add 500 μ l damping fluid GD (please checking to have added absolute ethyl alcohol whether earlier before using), 12,000rpm (13,400 * g) centrifugal 30 seconds, outwell waste liquid, CB3 puts into collection tube with adsorption column.
1.7 in adsorption column CB3, add 700 μ l rinsing liquid PW (please checking to have added absolute ethyl alcohol whether earlier before using), 12,000rpm (13,400 * g) centrifugal 30 seconds, outwell waste liquid, CB3 puts into collection tube with adsorption column.
1.8 in adsorption column CB3, add 500 μ l rinsing liquid PW, and 12,000 rpm (13,400 * g) centrifugal 30 seconds, outwell waste liquid.
1.9 adsorption column CB3 is put back in the collection tube, and 12,000 rpm (13,400 * g) centrifugal 2 minutes, outwell waste liquid.Place room temperature to place several minutes adsorption column CB3, thoroughly to dry rinsing liquid remaining in the sorbing material.
1.10 adsorption column CB3 is changed in the clean centrifuge tube, and to the unsettled dropping 100 μ l elution buffer TE in the middle part of adsorption film, room temperature was placed 2-5 minute, and 12,000 rpm (13,400 * g) centrifugal 2 minutes, solution is collected in the centrifuge tube.
2) experimentation
2.1 getting the every pipe 20ul of pre-mixed PCR reaction solution by sample number n (sample number=number of awaiting test sample+1+positive control of negative control 1) is sub-packed in the reaction tubes.
2.2 the above-mentioned sample to be tested of handling well and negative, positive control are respectively got 2ul and added respectively in the reaction tubes, mixing, the low-speed centrifugal several seconds, carry out pcr amplification, concrete reaction system is following:
| Reagent name | Consumption (ul) |
| 2*PCR Buffer | 10 |
| d NTP(5mM) | 4 |
| Upstream primer (10uM) | 0.5 |
| Downstream primer (10uM) | 0.5 |
| The Tag enzyme | 0.5 |
| Template cDNA | 2 |
| ddH 2O | 2.5 |
2.3 PCR condition: see the following form.
2.4 electrophoresis is identified
1.5% agarose gel electrophoresis, 140V, 20min, gel imaging system is observed.Purpose fragment GJB3 is 980bp, and Marker is DL2000.
2.5 PCR product purification
Sample pcr amplification product to be detected carries out the first step purifying by following condition:
Add 0.5 times of volume sodium-acetate (PH=5.2), 3 times of volume 100% alcohol, room temperature was placed 30 minutes, and the centrifugal 30min of 12000rpm abandons supernatant;
Add 75% alcohol 200ul, the centrifugal 20min of 12000rpm abandons supernatant, 95 ℃ of oven dry 1min;
Add 20ul ddH
2The O dissolving; After NANO drop is quantitative, it is diluted to the concentration of 2-5ng/ul.
2.6 sequencing reaction
Each sample is got 2 of 0.2ml PCR reaction tubess, difference mark upstream and downstream (two-way order-checking), and every pipe adds 1 μ l Bigdye Terminator respectively, 1 μ l water, enzyme purification product 2 μ l, and the upper reaches or downstream primer 1 μ l, totally 5 μ l systems.Reaction conditions is: 95 degree 4 minutes, 95 degree 15 seconds; 50 degree 20 seconds; 60 degree 2 minutes, 25 circulations.
2.7 alcohol purifying
Sequencing reaction finishes, and opens the pipe lid, and every pipe adds 2 μ l EDTA earlier, leaves standstill 5 minutes; Stop sequencing reaction, add 15 μ l absolute ethyl alcohols subsequently, centrifugal 30 minutes of 13500 rpm, liquid is removed in centrifugal end; And dry, add 50 μ l, 75% ethanol, centrifugal 15 minutes of 13500 rpm, liquid is removed in centrifugal end; Dry,, need oven dry for fear of the influence of residual alcohol to subsequent experimental.
2.8 3130 gene sequencers order-checking
In the centrifuge tube of oven dry, add 10 μ l HiDi, the vibration mixing, of short duration centrifugal collection all is transferred to the machine of going up on 96 hollow plates with liquid.
2.9 experimental result: with sequencing result with the standard sequence affirmation of comparing
3) data analysis
Mutation analysis: Application of DNA Star7.0 software carries out the sequence alignment analysis.The standard sequence that retrieves among sequence that order-checking is obtained and the NCBI is compared, and finds out mutant nucleotide sequence, confirms whether to find 547 G → A, 538 C → T, 423 A → G mutational site.
SEQUENCE?LISTING
< 110>Shanghai Adicon Clinical Laboratories, Inc.
< 120>test kit of detection deaf-related gene GJB3 transgenation
<130>
<160> 3
<170> PatentIn?version?3.3
<210> 1
<211> 1057
<212> DNA
<213> GJB3
<400> 1
cagagggtcg?ttgtgagtat?tgaacaagtc?agaactcaga?acactgcctg?gtacatagta 60
aatgctcaat?aaagtcacct?attcattcat?acgatggttt?ttcctctaat?tctctcaggt 120
aggcacggcc?cccaccaggc?gccatggact?ggaagacact?ccaggcccta?ctgagcggtg 180
tgaacaagta?ctccacagcg?ttcgggcgca?tctggctgtc?cgtggtgttc?gtcttccggg 240
tgctggtata?cgtggtggct?gcagagcgcg?tgtgggggga?tgagcagaag?gactttgact 300
gcaacaccaa?gcagcccggc?tgcaccaacg?tctgctacga?caactacttc?cccatctcca 360
acatccgcct?ctgggccctg?cagctcatct?tcgtcacatg?cccctcgctg?ctggtcatcc 420
tgcacgtggc?ctaccgtgag?gagcgggagc?gccggcaccg?ccagaaacac?ggggaccagt 480
gcgccaagct?gtacgacaac?gcaggcaaga?agcacggagg?cctgtggtgg?acctacctgt 540
tcagcctcat?cttcaagctc?atcattgagt?tcctcttcct?ctacctgctg?cacactctct 600
ggcatggctt?caatatgccg?cgcctggtgc?agtgtgccaa?cgtggccccc?tgccccaaca 660
tcgtggactg?ctacattgcc?cgacctaccg?agaagaaaat?cttcacctac?ttcatggtgg 720
gcgcctccgc?cgtctgcatc?gtactcacca?tctgtgagct?ctgctacctc?atctgccaca 780
gggtcctgcg?aggcctgcac?aaggacaagc?ctcgaggggg?ttgcagcccc?tcgtcctccg 840
ccagccgagc?ttccacctgc?cgctgccacc?acaagctggt?ggaggctggg?gaggtggatc 900
cagacccagg?caataacaag?ctgcaggctt?cagcacccaa?cctgaccccc?atctgaccac 960
agggcagggg?tggggcaaca?tgcgggctgc?caatgggaca?tgcagggcgg?tgtggcaggt 1020
ggagaggtcc?tacaggggct?gagtgacccc?actctga 1057
<210> 2
<211> 20
<212> DNA
< 213>artificial sequence
<400> 2
ggtcgttgtg?agtattgaac 20
<210> 3
<211> 25
<212> DNA
< 213>artificial sequence
<400> 3
aggtcctaca?ggggctgagt?gaccc 25
Claims (3)
1. detect the test kit of deaf-related gene GJB3 transgenation, it is characterized in that, comprising:
(i) pcr amplification reaction reagent;
The PCR primer that (ii) is used for amplified sample DNA GJB3 gene: JB3 upstream primer sequence: GGTCGTTGTGAGTATTGAAC; GJB3 downstream primer sequence: AGGTCCTACAGGGGCTG AGTGACCC.
2. test kit as claimed in claim 1 is characterized in that the method for use of said test kit comprises the steps:
(i) gather blood sample to be measured, extract DNA;
Be template (ii), carry out pcr amplification, obtain the PCR reaction product with the said PCR primer that is used for amplified sample DNA GJB3 gene with this DNA;
(ⅲ), compare, determine whether to exist the 547th bases G → A mutational site, the 538th base C → T mutational site, 423 bases A → G mutational site with GJB3 normal gene sequence to the order-checking of PCR reaction product.
3. test kit as claimed in claim 2 is characterized in that, step PCR reaction is (ii) increased by following condition: 94 ℃ of 2 min; 98 ℃ of 10s, 66 ℃ of 30s, 68 ℃ of 40s, 16 circulations; 98 ℃ of 10s, 60 ℃ of 30s, 68 ℃ of 40s, 20 circulations; 68 ℃ of 6 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100871484A CN102634579A (en) | 2012-03-28 | 2012-03-28 | Kit for detecting genic mutation of deafness associated genes GJB3 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100871484A CN102634579A (en) | 2012-03-28 | 2012-03-28 | Kit for detecting genic mutation of deafness associated genes GJB3 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102634579A true CN102634579A (en) | 2012-08-15 |
Family
ID=46619153
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012100871484A Pending CN102634579A (en) | 2012-03-28 | 2012-03-28 | Kit for detecting genic mutation of deafness associated genes GJB3 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102634579A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107419028A (en) * | 2017-09-12 | 2017-12-01 | 西南医科大学附属医院 | A kind of kit and its application for being used to detect changeability erythema keratosis |
| CN107881229A (en) * | 2017-12-26 | 2018-04-06 | 武汉艾迪康医学检验所有限公司 | A kind of primer and method of mitochondria Related Drug physical property deaf gene abrupt climatic change |
-
2012
- 2012-03-28 CN CN2012100871484A patent/CN102634579A/en active Pending
Non-Patent Citations (1)
| Title |
|---|
| 李庆忠 等: "国人非综合症型遗传性聋患者GJB3基因突变分析", 《听力学及言语疾病杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107419028A (en) * | 2017-09-12 | 2017-12-01 | 西南医科大学附属医院 | A kind of kit and its application for being used to detect changeability erythema keratosis |
| CN107419028B (en) * | 2017-09-12 | 2021-01-05 | 西南医科大学附属医院 | Kit for detecting variable hyperkeratosis rubra and application thereof |
| CN107881229A (en) * | 2017-12-26 | 2018-04-06 | 武汉艾迪康医学检验所有限公司 | A kind of primer and method of mitochondria Related Drug physical property deaf gene abrupt climatic change |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107190064B (en) | SnaPshot kit for detecting polymorphism of 22-site deafness genes | |
| CN105506107A (en) | Primers and method for detecting polymorphic hotspot mutation condition of DOCK2 gene | |
| CN104745697B (en) | Detect the method and primer of NF1 the 31st No. 34 full extron of gene | |
| CN104404164A (en) | Hereditary deafness gene mutation detection kit | |
| CN110229880A (en) | Detect primer, kit and the method for hereditary hearing impairment gene mutation site | |
| CN109593841A (en) | Detect method, kit, oligonucleotides and its application of F13A1 gene mutation | |
| CN106987642A (en) | Detect the kit and method of the full extron of MPL genes | |
| CN106834287B (en) | SNP marker for detecting RhD negative phenotype | |
| CN109486938A (en) | Detect method, primer and the application of SMN1 and SMN2 gene mutation | |
| CN104962658A (en) | MYOZ1 gene and application of expression product of MYOZ1 gene in diagnosing and treating parkinsonism | |
| CN105441540A (en) | Non-syndromic deafness gene polymorphism detecting kit and application thereof | |
| CN111424114A (en) | 2019-nCoV novel coronavirus saliva detection biomarker and application thereof | |
| CN114703278A (en) | Amyotrophic lateral sclerosis pathogenic gene, detection kit and primer group | |
| CN102634579A (en) | Kit for detecting genic mutation of deafness associated genes GJB3 | |
| CN106967808B (en) | Primer group for detecting RhD negative blood type and application thereof | |
| CN111004849B (en) | Primer, method and kit for detecting multiple site mutations of CDH1 gene | |
| CN106222287A (en) | The method of detection ELA2 gene and primer | |
| CN104232789A (en) | RT-PCR (reverse transcription-polymerase chain reaction) technique capable of simultaneously identifying porcine reproductive and respiratory syndrome virus (PRRSV) | |
| CN107190071A (en) | A kind of SNP marker for being used to detect RhD variation phenotypes | |
| CN103045722B (en) | Detection kit of disease-causing gene CRYGD of crystalline congenital cataract | |
| CN105177152A (en) | Method and primers for detecting HLA-B*51 allelomorphic gene | |
| CN102816838A (en) | Kit for detecting polymorphism of hepatitis C patients IL28B SNP12980275 | |
| CN114317550A (en) | Nucleic acid for coding MITF gene mutant and application thereof | |
| KR102019950B1 (en) | Novel primer set for detecting rotavirus and kit to distinguish wild rotavirus and vaccine rotavirus using the same | |
| CN112442528B (en) | LOXHD1 gene mutant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120815 |