CN102618539B

CN102618539B - Material and method for regulating and controlling vernalization of cruciferous plants

Info

Publication number: CN102618539B
Application number: CN201110033386.2A
Authority: CN
Inventors: 何玉科; 张绍峰; 孙传宝
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Priority date: 2011-01-31
Filing date: 2011-01-31
Publication date: 2014-10-22
Anticipated expiration: 2031-01-31
Also published as: CN102618539A

Abstract

The invention relates to a material and method for regulating and controlling the vernalization of cruciferous plants. In particular, the invention relates to a promoter for regulating and controlling the vernalization of cruciferous plants, a construct containing the promoter and a transformant containing the construct. The invention further relates to a method for regulating and controlling the vernalization of cruciferous plants, genetically improving the vernalization of cruciferous plants and the time of forming organs, and promoting the late bolting of cruciferous plants.

Description

Material and the method for regulation and control cress vernalization

Technical field

The invention belongs to regulation and control cress vernalization field, be specifically related to material and the method for cress vernalization.

Background technology

Chinese cabbage (Brassica rapa.pekinensis) is a kind of important vegetable crop, and its vegetative growth phase is divided into four developmental stages: Seedling Stage, rosette state, bag heart stage and heading stage.This biennial herb plant need to experience a winter and just can bloom, and plant, after subzero treatment, blooms to Second Year spring, this troating of process.

In arbitrary period of nourishing and growing in Chinese cabbage, as long as there is the low temperature environment (10 DEG C following) of 20-50 days, plant just can enter generative growth phase by vernalization.On producing, " underdone bolting " is a great problem that causes Chinese Cabbage Yield and quality loss, its reason be plant before heading stage and heading stage just by vernalization and bolting, cause the plant cannot balling and form loose ball.In order to ensure reaching full growth and output formation of product organ-leaf-head, breeding man is often using late bolting as an important breeding objective, and grower avoids the arrival of Chinese cabbage generative growth phase by the arrangement in sowing time.

In Arabidopis thaliana, FLOWER LOCUS DEG C (FLC), as a kind of important arrestin negative regulation vernalization of blooming, participates in plant from nourishing and growing to the conversion process of reproductive growth.A little less than Arabidopsisecotype Col self FLC expresses, so also can bloom without vernalization.But in some mutant, find that FLC expression can raise.Qualification by mutant finds FLC to express favorable FRI, and FCA to FLC expression inhibiting, FLD, LD, FVE.Wherein the interaction of the 5 ' cap sequence of FRI (FRIGIDA) tunable mRNA and Paf (PolII-associated factor complex) and play modify chromatinic effect; FCA is an albumen that has RNA binding domains, and its poly (A) tail to mRNA forms and works; FLD (FLOWERING LOCUS D, a homolog of the humanlysine-specific demethylase 1 (LSD1)) is the catalysis histone H 3 K4 site methylated enzyme that gets on.Except the albumen that these regulation and control FLC expresses, the environmental factors of FLC having been expressed to obvious regulating effect is subzero treatment, i.e. vernalization.In vernalization, FLC expression by inhibitation system is mainly passed through the expression of the non-coding RNA of abduction delivering FLC gene region, then histone methylated by non-coding RNA mediation, thereby on epigenetic, suppresses the expression of FLC.FLC is subject to the inhibition in epigenetics in vernalization, is mainly the disappearance of activated form histone modification (acetylize, H3K4me3), and the increase of inhibition type histone modification (H3K9me3, H3K27me3).VIN3 only expresses in Arabidopis thaliana vernalization process, and it,, in conjunction with promotor and the First Intron region of FLC, causes in vernalization, the DNA methylase inhibitor (Wood et al., 2006) in this region.The H3K4me3 demethylation of histone is by (Liu etal., 2007) of FLD (FLOWERING LOCUSD, a homolog of the human lysine-specific demethylase 1 (LSD1)) catalysis.VRN2 (Gendall et al., 2001) and LHP1 (Sung et al., 2006) are respectively by regulating H3K27me3 and H3K9me3 to methylate to maintain the holddown of FLC.Noncoding RNA can participate in the epigenetics of FLC in vernalization equally to be suppressed, and wherein just comprises the reverse transcription basis of FLC and the short rna of this promoter region of reverse transcription.

Research is found, has a kind of noncoding FLC antisense transcript (Naturalantisence transcripts, NATS) in Arabidopis thaliana plant body, and it is relevant with the expression level of FLC justice transcript.The natural reverse transcription of Arabidopis thaliana was originally found by Tilling as far back as 2003.Within 2007, there is people to report FLC reverse transcription gene structure originally.FLC has two reverse transcriptions originally: Class I and Class II, they form (Liu et al., 2007) by two exons.The end of the year 2009, there are respectively two laboratories on Nature and Science, to report this specifically expressing in vernalization of Arabidopis thaliana FLC reverse transcription, by regulate histone methylated FLC (Swiezewski et al., 2009 of suppressing of FLC promoter region in epigenetics; Liu etal., 2010).

Chinese cabbage and Arabidopis thaliana belong to cress, and sibship is nearer.Chinese cabbage (Brassicarapa) strictly needs vernalization just can bloom, and compares with Arabidopis thaliana, and in Chinese cabbage, the expression amount of FLC wants high.In 2007 (Kim et al., 2007) report Chinese cabbage genome, have 3 FLC, i.e. BrpFLC1, BrpFLC2, BrpFLC3.Wherein BrpFLC2 is positioned on No. 2 karyomit(e)s, and BrpFLC1 is positioned on No. 10 karyomit(e)s, and BrpFLC3 is positioned on No. 3 karyomit(e)s.They all can be subject to the inhibition on epigenetic in vernalization, thus the expression of initial floral genes.

On NCBI in 2007, announce Chinese cabbage FLC, the reverse transcription of BrpFLC2 est sequence (EX096192) originally, the material source of cDNA library is not the Chinese cabbage in vernalization, but soft-rot bacterium is infected the Chinese cabbage blade in 24 hours.

Summary of the invention

In order to understand the molecular mechanism of Chinese cabbage vernalization in depth, we have started separating and functional study of Chinese cabbage FLC forward and reverse transcription basis.From Chinese cabbage early bolting (early a kind of sedge zaotai) and late bolting (late a kind of sedge wantai) genotype Bre and Wantai, we have cloned respectively 4 FLC homologous genes and a natural reverse transcription basis.FLC homologous gene is named as respectively BrpFLC1 (the Genbank number of logging in AY115678), BrpFLC2 (the Genbank number of logging in AY205317), BrpFLC3 (the Genbank number of logging in AY115677) and BrpFLC5 (the Genbank number of logging in AY115675), and a reverse transcription is originally named as BrpFLC2as (the Genbank number of logging in EX096192).Find that early bolting genotype Bre and all FLC homologous genes of late bolting gene type Wantai and reverse transcription genome sequence is originally in full accord, the proterties that shows Chinese cabbage early bolting and late bolting is not because the sequence difference of two genotype FLC genes causes.

Seedling to early bolting genotype zaotai and late bolting gene type wantai carries out respectively low temperature vernalization treatment.Found that, in the leaf of a kind of sedge zaotai morning, this BrpFLC2as of subzero treatment induction reverse transcription expresses, and suppresses the expression of forward transcript BrpFLC2 simultaneously.Along with the prolongation of low temperature vernalization time, BrpFLC2as expression level raises, and the expression level of BrpFLC2 reduces.In the time of low temperature vernalization 3 weeks, when namely vernalization has completed, the expression level of BrpFLC2as reduces, and the expression level of BrpFLC2 starts to raise.This result shows, before vernalization completes, the expression level of BrpFLC2as is directly proportional to vernalization degree, and the expression level of BrpFLC2 and vernalization degree are inversely proportional to.In late a kind of sedge genotype wantai, vernalization needs the time of 7 weeks, and before vernalization completes, the expression level of BrpFLC2as is also directly proportional to vernalization degree, and the expression level of BrpFLC2 is also inversely proportional to vernalization degree.This is explanation just, and BrpFLC2 forward and the expression level of reverse transcription basis and the degree of vernalization have much relations.And, cause the reason of early bolting and late bolting not lie in BrpFLC gene itself, and be the regulation and control of BrpFLC genetic expression time.

In order to fully understand the cause-effect relationship between BrpFLC2 gene and its antisense transcript BrpFLCas, we have built the plant gene expression vector of 4 kinds of BrpFLC2 genes and BrpFLC2as and various combination thereof, respectively arabidopsis thaliana transformation and Chinese cabbage wild-type.In transfer-gen plant, when BrpFLC2 gene and BrpFLC2as are in the time that self promotor starts, BrpFLC2 gene and BrpFLC2as both express; When BrpFLC2 gene and BrpFLC2as are in the time that composition promotor 35S starts, their expression level is compared self promotor and is raise, and the expression level of BrpFLC2 raises, and the flowering time of plant further postpones; When BrpFLC2as can express separately in the time that self promotor starts, can suppress the expression of endogenous FLC forward transcript, but plant blossom time intensity of variation compared with wild-type is little simultaneously; When BrpFLC2as separately under 35S starts its expression level obviously raise than self promotor, the restraining effect of endogenous FLC forward transcript is strengthened, there be shifting to an earlier date to a certain degree the plant blossom time.These results show: the expression of BrpFLC2as depends on BrpFLC2, but the expression of BrpFLC2 gene is had again to restraining effect.BrpFLC2 gene and one of BrpFLC2as composition are controlled the switch of blooming of vernalization and flowering time.When BrpFLC2as expression level raises or the reduction of BrpFLC2 gene expression dose, the vernalization time shorten of plant.

Like this, the non-coding RNA of BrpFLC gene (natural reverse transcription originally) has participated in the epigenetic inhibition of BrpFLC in vernalization.In addition, the BrpFLC genomic DNA fragment of 35S overexpression different lengths and direction in Arabidopis thaliana, according to the difference of Chinese cabbage and Arabidopis thaliana DNA sequence dna, we have proved that by RT-PCR method BrpFLC2 3 ' end downstream 109bp is reverse transcription promotor originally.In the time that BrpFLC2 genomic DNA fragment comprises this 109bp fragment, transgenic arabidopsis can be expressed BrpFLC reverse transcription originally at low temperatures.

According to the phraseology of feature, BrpFLC2as and the BrpFLC2 gene of Chinese cabbage early bolting and late bolting gene type vernalization and the function in Arabidopis thaliana transfer-gen plant thereof, we have proposed the pattern of BrpFLC2 and BrpFLC2as mediation Chinese cabbage FLC vernalization.The process of Chinese cabbage vernalization and degree are subject to the regulation and control of BrpFLC gene and antisense transcript thereof simultaneously.Cold condition can be induced the expression of BrpFLC antisense transcript, and the expression of antisense transcript is subject to the control of BrpFLC gene downstream short-movie section non-coding RNA (i.e. this 109bp promotor, SEQ ID NO:13), then suppresses again the expression of BrpFLC gene.The natural reverse transcription of BrpFLC gene and it this as a switch of blooming, open or close the process of vernalization, control Chinese cabbage and nourish and grow to the transformation of reproductive growth.Our result of study is for improveing the time of Chinese cabbage vernalization in heredity and the formation of product organ provides theoretical foundation reliably.

Therefore, first aspect present invention provides a kind of promoter sequence of separation, is selected from: (a) containing the nucleotide sequence just like sequence shown in SEQ ID NO:13; (b) nucleotide sequence obtaining is modified in replacement, disappearance, the insertion of the sequence (a) Suo Shu being carried out to one or several base, and this nucleotide sequence can regulate transcribing of the transcribed polynucleotide molecule that is operably connected; (c) under stringent condition with (a) or (b) nucleotide sequence of described sequence hybridization.

In a specific embodiment, the present invention also comprises the nucleotide sequence with described (a), (b) complementation.

Second aspect present invention provides a kind of polynucleotide construction, and described polynucleotide construction contains promoter sequence of the present invention.

In one embodiment, described polynucleotide construction also contains FLC gene and/or its natural reverse transcription basis of cress.

In one embodiment, described cress is Chinese cabbage.

In one embodiment, described FLC gene is BrpFLC2 gene.

In one embodiment, described polynucleotide construction contains BrpFLC2 gene and/or its natural reverse transcription basis.

In one embodiment, polynucleotide construction of the present invention can also contain other promotor, for example 35S promoter.

In one embodiment, the 3 ' end of promoter sequence of the present invention in described polynucleotide sequence.

In one embodiment, described polynucleotide construction is selected from the nucleotide sequence shown in SEQ ID NO:14, SEQ ID NO:16 and SEQ ID NO:17.

Third aspect present invention provides a kind of transformant, and this transformant has proceeded to polynucleotide construction of the present invention.

Fourth aspect present invention provide a kind of regulate and control the method for cress vernalization, described method comprises utilizes this expression of the FLC gene of promoter sequence regulation and control cress and/or the natural reverse transcription of this gene.

Fifth aspect present invention provides a kind of method that improves the time of cress vernalization and organ formation in heredity, described method comprises, improves or reduce the FLC gene of this cress and/or the expression originally of the natural reverse transcription of this gene by changing promoter sequence fragment.

Sixth aspect present invention provides a kind of method that promotes cress bolting in evening, described method comprises, utilize promoter regulation with reduce described cress FLC gene natural reverse transcription this expression level or improve the expression level of described cress FLC gene.

In one embodiment, described cress is selected from Chinese cabbage, green vegetables, wild cabbage, rape and radish.

In one embodiment, described promotor is that the promotor of cress FLC gene forward transcript maybe can promote the promotor that this forward transcript is expressed, or its natural reverse transcription promotor originally.

In one embodiment, the described promotor that can promote this forward transcript to express is 35S promoter, and described natural reverse transcription promotor originally contains the sequence shown in SEQ ID NO:13.

In one embodiment, the described step of utilizing promoter regulation comprises and proceeds to polynucleotide construction of the present invention.

Seventh aspect present invention provides a kind of method of preparing transgenosis cress, and described method comprises:

(1) build polynucleotide constructions, the function of the promotor of described polynucleotide construction energy enhancer or inhibitor cress FLC gene forward transcript and/or enhancing or weaken FLC gene reverse transcription this promotor function or make it completely lose promoter function;

(2) the polynucleotide construction of step (1) gained is proceeded to vegetable cell, tissue, organ or seed, obtain the vegetable cell, tissue, organ or the seed that transform; With

(3) vegetable cell, tissue, organ or the seed regeneration plant that step (2) are obtained.

In one embodiment, described polynucleotide construction is selected from: polynucleotide construction of the present invention, comprises the polynucleotide construction shown in SEQ ID NO:14～17.

The present invention is especially suitable for the vernalization of Chinese cabbage, promotes its late bolting.Preferably, control the BrpFLC2 gene of Chinese cabbage and/or the expression of its natural this BrpFLC2as of reverse transcription.

Accordingly, in a preferred embodiment, the present invention regulates and controls the vernalization of Chinese cabbage by suppressing the expression of this BrpFLC2as of Chinese cabbage reverse transcription or the expression of raising Chinese cabbage BrpFLC2 gene, promote its late bolting.The method improving or suppress the expression of described gene comprise example as described herein polynucleotide construction transform cell, tissue or the organ of Chinese cabbage.

Brief description of the drawings

Fig. 1 shows that Chinese cabbage BrpFLC2 and Arabidopis thaliana FLC gene cDNA sequence compare.

Fig. 2 shows BrpFLC2 and BrpFLC3 reverse transcription structure originally.BrpFLC2as-1 is Chinese cabbage FLC2 reverse transcription basis 1; BrpFLC2as-2 is Chinese cabbage FLC2 reverse transcription basis 2; BrpFLC3as-1 is Chinese cabbage FLC3 reverse transcription basis.E1, E2, E3, E4, E5, E6, E7, the respectively interior aobvious son of corresponding forward and reverse transcript.

When Fig. 3 shows a kind of sedge genotype seedling vernalization morning different number of days, the expression of the forward and reverse transcript of BrpFLC.DAC, the number of days after subzero treatment; DAT, the number of days (7 days) after transplanting.BrpFLC2 is Chinese cabbage FLC2 forward transcript; BrpFLCas-1 is Chinese cabbage FLC2 reverse transcription basis.Ubiquitin 5 is internal reference.

When Fig. 4 shows late a kind of sedge genotype seedling vernalization different number of days, the expression of the forward and reverse transcript of BrpFLC2.DAC, the number of days after subzero treatment.BrpFLC2 is Chinese cabbage FLC2 forward transcript; BrpFLC2as-1 is Chinese cabbage FLC2 reverse transcription basis.UBI is internal reference.

Fig. 5 shows the expression of BrpFLC2 in p35S:pBrpFLC2:BrpFLC2/BrpFLC2as:pBrpFLC2as and p35S:pBrpFLC2:BrpFLC2/BrpFLC2as transgenic arabidopsis.35S+pBrpFLCas, refers to carrier p35S:pBrpFLC2:BrpFLC2/BrpFLC2as:pBrpFLC2as transfer-gen plant; 35S+pBrpFLCas, refers to carrier p35S:pBrpFLC2:BrpFLC2/BrpFLC2as transfer-gen plant, and wherein 1,2 is two transgenic lines.BrpFLC2 is Chinese cabbage FLC2 forward transcript; BrpFLCas-1 is Chinese cabbage FLC2 reverse transcription basis.

Fig. 6 shows that BrpFLC2as is at p35S:pBrpFLC2:BrpFLC2/BrpFLC2as:pBrpFLC2as, the expression in pBrpFLC2:BrpFLC2/BrpFLC2as:pBrpFLC2as:p35S and BrpFLC2/BrpFLC2as:pBrpFLC2as:p35S transgenic arabidopsis.

35S → BrpFLCas, refers to carrier pBrpFLC2:BrpFLC2/BrpFLC2as:pBrpFLC2as:p35S transfer-gen plant;

35S → BrpFLC2, refers to carrier p35S:pBrpFLC2:BrpFLC2/BrpFLC2as:pBrpFLC2as transfer-gen plant;

-pBrpFLC2, refers to carrier B rpFLC2/BrpFLC2as:pBrpFLC2as:p35S transfer-gen plant, and wherein 1,2 is two transgenic lines.BrpFLC2 is Chinese cabbage FLC2 forward transcript; BrpFLC2as-1 is Chinese cabbage FLC2 reverse transcription basis.

Fig. 7 shows, provides the sibship between them by the phylogenetic tree of different plant FLC protein sequence contrasts: utilize the Neighbor-joining method of Phylip program program to analyze, wherein, wild cabbage Bo, B.oleracea; Chinese cabbage Br, B.rapa; Turnip Bn, B.napus; Arabidopis thaliana At, Arabidopsis.Protein sequence accession number: AtFLC (AAD21249.1), BnFLC1 (AAK70215), BnFLC2 (AAK70216), BnFLC3 (AAK70217), BnFLC4 (AAK70218), BnFLC5 (AAK70219), BrFLC1 (AAO13159), BrFLC2 (AAO86066 and AAO86067), BrFLC3 (AAO13158), BrFLC5 (AAO13157), BoFLC1 (AAN87902), BoFLC3 (AAN87901), and BoFLC5 (AAN87900), BoFLC4-1 (AY306124), BoFLC3-2 (AY306125).

Embodiment

In the present invention, term " separation " refers to that material separates (if natural substance, primal environment is natural surroundings) from its primal environment.As the polynucleotide under the native state in active somatic cell and polypeptide do not have separation and purification, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, for separation and purification.

Term " regulation and control " refers to adopt biological means to control artificially cress FLC gene and the expression originally of its natural reverse transcription.

In the present invention, the method for regulation and control can comprise that adopting genetic engineering technique to cross expresses FLC gene and/or its natural reverse transcription basis, thereby controls flowering time.

In the present invention, cress includes but not limited to Chinese cabbage, green vegetables, wild cabbage, rape, radish etc.

Term used herein " promotor " is in vegetable cell, to have the natural of function or non-natural promotor.In the time being operably connected with transcribed polynucleotide molecule, promotor generally causes transcribing of this transcribed polynucleotide molecule, and the mode of transcribing of the transcribed polynucleotide molecule that its mode of transcribing is connected conventionally with this promotor is similar.

Phrase " stringent condition " is hybridized and functional definition by specific cross program about nucleic acid probe and target nucleic acid (with specific object nucleotide sequence).Can adopt as required different hybridization conditions to obtain the selectivity in various degree of probe to target sequence.For the application that requires highly selective, generally need to adopt relative high stringent condition to form crossbred, for example, can select relative less salt and/or hot conditions, the condition for example providing to about 0.15M NaCl at approximately 50 DEG C to approximately 70 DEG C temperature, about 0.02M.For example, high stringent condition is will hybridize strainer (filter) washing at least twice with high severity lavation buffer solution (0.2X SSC, 0.1%SDS, 65 DEG C).Promote that the suitable medium stringency of DNA hybridization is conventionally known to one of skill in the art, for example approximately 45 DEG C, 6.0x sodium chloride/sodium citrate (SSC), be that the 2.0xSSC of 50 DEG C washs subsequently.In addition, can select the salt concn washing step from the high severity of 50 DEG C, the low severity to 50 of about 2.0xSSC DEG C, about 0.2xSSC.In addition, can increase the temperature washing step from the low stringency of room temperature (approximately 22 DEG C) to the high stringency of approximately 65 DEG C.Temperature and salt all can change, or can keep temperature or salt concn constant and change another variable.Such selective conditions allows the little mispairing between probe and template or target chain.

Can use method qualification well known to those skilled in the art to there is the active object promotor similar to promotor described herein.For example, can application target cell or tissue construction cDNA library, and screen described library and have with qualification the gene of the expression pattern similar to promotor described herein.Then can use the promotor of cDNA sequence isolated genes of the gene of qualification further to characterize.For example United States Patent (USP) 6,096,950; 5,589,583; With 5,898,096, be incorporated herein by reference.In addition, also can use the gene of transcribing signature analysis (profiling) or electronics RNA trace (northern) technical evaluation and have the expression pattern similar to promotor described herein.Once these genes are identified, just can separate its promotor further to characterize.For example United States Patent (USP) 6,506,565 and 6,448,387, be incorporated herein by reference.

In another embodiment, can modify promotor herein.Those skilled in the art can be created on vicissitudinous promotor in polynucleotide sequence.Can modify or change the promotor polynucleotide sequence of the present invention as shown in SEQ ID NO:13, to strengthen its controlling feature.A preferred method that changes polynucleotide sequence is to use PCR with selected Nucleotide or region in modification sequence.These methods are well known to those skilled in the art.Can be in the DNA modification method of PCR-based by insertion, disappearance or the displacement of for example template sequence modification sequence.In the context of the present invention, " variant " is containing vicissitudinous promotor, in described promotor, preferably in basic maintenance promoter function, lacks, adds and/or substitute one or several Nucleotide of original promotor.For example, can be from one or several base of promotor 5 ' or 3 ' terminal deletion to produce " brachymemma " promotor.Can or substitute one or several base in the inner insertion of promotor, disappearance.

Can design or engineered new chimeric promoters by several different methods.Many promotors contain activation, strengthen or limit promotor intensity and/or specific element.For example, promotor may contain other cis element that has defined " TATA " frame of transcription initiation site upstream and be positioned at transcription initiation site upstream regulation transcriptional level.

" construction " used herein refers to any recombination of polynucleotide molecule from any source, for example plasmid, clay, virus, self-replicating polynucleotide molecule, phage linear or annular strand or double-stranded DNA or RNA polynucleotide molecule, it can carry out genome conformity or self-replicating, comprises wherein one or more polynucleotide molecules with polynucleotide molecule that in function, exercisable mode connects.In some specific embodiment, construction of the present invention is a kind of carrier, is preferably expression vector.

" being operably connected " used herein refers to that first polynucleotide molecule (for example promotor) polynucleotide molecule (for example goal gene) transcribed with second is connected, wherein polynucleotide molecule is so arranged, thereby first polynucleotide molecule affects the function of second polynucleotide molecule.Preferably, two polynucleotide molecules are parts of single continuous polynucleotide molecule, and are more preferably and close on.For example, if promotor regulates or mediate transcribing of goal gene in cell, this promotor is operably connected with goal gene.

" transcribed polynucleotide molecule " used herein refers to be transcribed into any polynucleotide molecule of RNA molecule.Knownly construct is introduced to the method for cell so that transcribed polynucleotide molecule is transcribed into the mode of function mRNA molecule, thereby described function mRNA molecule obtains translation and is expressed as protein.In order to suppress the translation of specific object RNA molecule, also can build can antisence RNA molecule construct.In order to implement the present invention, conventional composition and the method for preparation and use construct and host cell are well known to those skilled in the art, and see the people such as such as Sambrook.

Construction of the present invention generally can contain the promotor being operably connected with transcribed polynucleotide molecule, and this transcribed polynucleotide molecule is operably connected with 3 ' Transcription Termination polynucleotide molecule.In addition, construction can include but not limited to the extra adjusting polynucleotide molecule (for example, increasing by 3 ' UTR of the mRNA stability of mRNA) from plant gene 3 '-non-translational region (3 ' UTR).Construct can be including but not limited to 5 ' non-translational region of mRNA polynucleotide molecule (5 ' UTR), and described 5 ' non-translational region has vital role in translation initiation, and also can be the gene element in plant expression constructs.The example of construction of the present invention can be referring to the sequence shown in SEQ ID NO:14 and 17, and wherein, SEQID NO:14,16 and 17 contains promoter sequence of the present invention.SEQ ID NO:14 and 15 can promote the late bolting of cress (especially Chinese cabbage), and SEQ ID NO:17 can promote cress (especially Chinese cabbage) early bolting.

Term " conversion " refers to introduce cell, tissue, organ or the biology of for example construction of external polynucleotide molecule.Preferably the polynucleotide molecule of introducing is incorporated in the genomic dna of recipient cell, tissue, organ or biology, thereby makes the polynucleotide molecule of introducing by descendant inheritting.Therefore, herein, " transformant " comprises various cells, tissue and the organ introducing or transformed promoter sequence of the present invention or construction.Described cell, tissue and organ can be bred into alone single plant." genetically modified " or " conversion " cell or biological also comprise cell or biological offspring, and in hybridization, adopt such transgenic plant as parent and show the offspring who produces due to the procedure of breeding of the phenotype of the change that exists external polynucleotide molecule to produce.Can be by any methods for plant transformation by the Plant Transformation construct introduced plant that contains promotor of the present invention.In practice of the present invention, by by plant expression constructs introduced plant genome and the method for conversion of plant and material can comprise any known and method through proving, comprise in United States Patent (USP) 5384253 electroporation of explanation; The microparticle bombardment of explanation in United States Patent (USP) 5015580,5550318,5538880,6160208,6399861 and 6403865; The agrobacterium-mediated conversion of United States Patent (USP) 5635055,5824877,5591616 and 5981840 explanations; And the protoplast transformation of explanation in United States Patent (USP) 5508184, all these patents are all incorporated herein by reference.

Therefore, the present invention includes and adopt gene engineering method regulation and control cress vernalization, for example, adopt method for transformation mentioned above to proceed to required polynucleotide construction to any part of plant, comprise in cell, tissue, organ or biological genomic dna, make polynucleotide construction described in it in this part, express required gene, as FLC gene or its natural reverse transcription this, control thus vernalization, promote early bolting or late bolting.The time transforming can be selected according to this area routine techniques by those skilled in the art.The method of regulation and control cress vernalization also comprises employing certainly, for example, extend or shorten the time of subzero treatment (for example 5 DEG C or following), thereby control FLC or its natural reverse transcription expression originally in this cress, regulate and control thus vernalization.

In the present invention, utilize the method that promotor regulates and controls to comprise the expression that utilizes the carrier proceeding to strengthen FLC forward transcript; Or utilize the carrier that proceeds to destroy sequence shown in SEQ ID NO:13, make its inactivation, or make its disappearance, thereby cause this be suppressed without expressing or expressing of FLC reverse transcription; Etc..

1. materials and methods

1.1 material

Chinese cabbage early a kind of sedge zaotai is different with two Chinese cabbage cultivars of late tongue wantai (seed is from Shanghai Sun Qiao agricultural science and technology company limited) bolting characteristic.Early a kind of sedge zaotai processes at low temperatures and can pass through vernalization and bolting in 15-20 days, and late tongue wantai needs 75 days above consecutive low temperatures to process could pass through vernalization and bolting.Be Columbia and C24 and early a kind of sedge zaotai of Chinese cabbage for the Arabidopsisecotype of transgenosis and character observation.

1.2 plant are cultivated

By Chinese cabbage early the seedling of a kind of sedge zaotai and late tongue wantai self-mating system be placed under the low temperature of 3-5 DEG C vernalization 30 days, evening, tongue wantai self-mating system was processed 75 days under same low temperature, got respectively leaf tissue therebetween and detected BrpFLC2 gene and the expression of this BrpFLas of reverse transcription in vernalization process.Before subzero treatment, process 12 days time, process 29 days, process and within 50 days and 90 days, measure respectively plant growth condition and extract RNA sample.

1.3RNA extract

Trizol extracts RNA step:

1) in liquid nitrogen, material is ground fully.

2) ground material forwards in EP pipe, adds 1ml Trizol.

3) concussion, room temperature is placed 10 minutes.

4) add 0.2ml chloroform, concussion, room temperature is placed 10 minutes.

5) 4 degree, 12000rpm, centrifugal 10 minutes.

6) get supernatant, add 1 times of volume Virahol, mix, place on ice 15 minutes.

7) 4 degree, centrifugal 10 minutes of 12000rpm, abandons supernatant.

8) 70% ethanol is washed once, and centrifugal (4 degree, 12000rpm, 5 minutes), abandon supernatant.Super clean bench dries up.

9) dissolve with 30 μ l DEPC treated waters, deposit for-70 DEG C.

Cold phenol method (being applicable to the material that sugar content is many, as flower and fruit pod) is extracted RNA step:

1) in liquid nitrogen, abrasive substance, to powdery, proceeds in centrifuge tube, adds extract 500 μ l on ice.Add equal-volume phenol: chloroform: primary isoamyl alcohol (25: 24: 1), ice bath 1 hour, every vibration in 10 minutes once.

2) 14000rpm, 4 DEG C centrifugal 15 minutes, get supernatant, add equal-volume phenol: chloroform: primary isoamyl alcohol, ice bath 5 minutes.

3) repeating step 2, until organic phase and water are without protein.

4) add isopyknic chloroform: primary isoamyl alcohol (24: 1), 4 DEG C of 14000rpm are centrifugal 15 minutes.

5) get supernatant, add the high level salt solution of 0.5 times of volume and the Virahol of 0.5 times of volume ,-70 degree 1 hour after mixing.

6) centrifugal 20 minutes of 4 DEG C of 14000rpm, remove supernatant, and precipitation is dissolved in 150ul H ₂in O.

7) centrifugal 10 minutes of 4 DEG C of 14000rpm, get supernatant and go in a new pipe.

8) add the 8M LiCl of 1/3 volume ,-20 DEG C of precipitated rnas that spend the night.

9) 4 DEG C of 14000rpm are centrifugal 15 minutes.

10) precipitation is washed twice with 70% ethanol.

11) 50 μ l H ₂o dissolves RNA.

Reagent:

Extract: 1M Tris-HCl, 50mM EDTA, pH 8.0

High level salt solution: 0.8M Trisodium Citrate, 1.2M NaCl

CDNA synthesis step:

Reverse transcription system: (20 μ l)

5X AMV damping fluid, 4 μ l; 2mM dNTP, 10 μ l; 20 μ M oligo dT ₁₈, 1 μ l; RNA, 2 μ l; RNase inhibitor, 0.5 μ l; AMV, 1 μ l; DEPC water, 1.5 μ l;

25 degree 10 minutes, 42 degree reactions 1 hour, 94 degree 5 minutes.

Primer sequence:

bfas5：ggtagttcttctgtcttcacc(SEQ ID NO：1)

anti-BrpFLC3：gcccttttcgcttccgttcc(SEQ ID NO：2)

BrpFLC5：caagcgaattgagaacaaaa(SEQ ID NO：3)

BrpFLC3：gagtcgacgcttacatcaga(SEQ ID NO：4)

anti-BrpFLC5：ctaacacacacaaactctctacg (SEQ ID NO：5)

PCR program: 94 DEG C, 3min; 94 DEG C, 30sec; 58 DEG C, 30sec; 72 DEG C, 1min; 30 take turns; 72 DEG C, 10min.

The clone of 1.4 genomic dnas

Carry Chinese cabbage specific heat DNA

1) get the specific heat mature leaf of approximately 1.5 square centimeters and be placed in the EP pipe of 2ml, Syrup-homogenizing instrument is smashed (liquid nitrogen), adds the TPS extract of 800 microlitres.

2) blade of smashing is put into the dry bath incubation 20min (mixing) of 75 degree.

3) 12000rpm, centrifugal 10min.

4) get in supernatant liquor and EP pipe, add equal-volume phenol: chloroform: primary isoamyl alcohol (25: 24: 1), mixes 12000rpm, 10min.

5) get supernatant, add equal-volume chloroform: primary isoamyl alcohol (24: 1), mixes 12000rpm, 10min.

6) get supernatant, add isopyknic Virahol, mix, 12000rpm, 15min.

7) abandon supernatant, precipitation adds the ethanol of 500 microlitres 70%, vibration, 12000rpm, 5min.

8) abandon supernatant, drying at room temperature precipitation, adds 50 microlitre HP, 37 degree 1h.

9)PCR。

TPS solution: 100mM Tris-HCl (pH 8.0); 10mM EDTA (pH 8.0); 1M KCl.

Primer sequence and clone's BrpFLC genomic DNA fragment

bfgd5+：taaggtaccccatagtatttgagatctaa(SEQ ID NO：6)

bfgd3+：taaggtaccgaatattaagaactcggcct(SEQ ID NO：7)

bfgd4923：ggggtaccggcaaagatggccacgtctc(SEQ ID NO：8)

BrpFLC-22s：ggggtaccaggcttctcggagacagaag(SEQ ID NO：9)

KOD plus expands BrpFLC genomic dna: 94 DEG C, and 3min; 94 DEG C, 30 seconds; 58 DEG C, 30 seconds; 68 DEG C, 5min; 30 take turns; 68 DEG C, 10min.

1.5 vector construction

The restriction enzyme site and the protection base that in primer, are all added with KpnI, the direct KpnI enzyme of PCR product is cut, and links 1300-35S-Nos (pCAMBIA1300 carrier is purchased from CAMBIA company).Improved pCAMBIA1300 (35S-Nos) is at pCAMBIA1300 (Th 4A～4C, NCBI records its physical map) basis on, replaced its original MCS (being EcoR I & Hind III fragment) sequence with the EcoR I & Hind III endonuclease bamhi of pJR1, PCR product is connected in the middle of 35S and Nos; In the middle of these two restriction enzyme sites of EcoR I & Hind III, be 35S-multiple clone site-Nos, wherein in multiple clone site, contain Kpn I restriction enzyme site, fragment is initiated with: EcoR I-35S---Kpn I---Nos-Hind III, fragment finishes.After expression vector KpnI enzyme is cut, dephosphorylation connects again, and the carrier BamH I qualification that connects 1300-35S-Nos is forward and reverse.

1.6 Arabidopis thaliana transgenosiss

The expression vector building is forwarded in Agrobacterium GV3101 (purchased from Invitrogen) by freeze-thaw method.The GV3101 taking a turn for the better is containing rif (50mg/L), and medium and small the shaking of LB liquid nutrient medium (28C) of Km (50mg/L), then the bacterium liquid of getting 1ml is added to shaking greatly containing in antibiotic liquid LB substratum of 400ml, when OD600=1.0, centrifugal (3000-5000rpm, 15min), bacterium is resuspended in 200ml and transforms (H in damping fluid ₂o 200ml, sucrose 10g, silvet 100 microlitres), the Arabidopis thaliana in flowering period is inverted in solution and is soaked after 1min, to wrap with preservative film, place 2 days dark place.

The transgenic arabidopsis of 1300-35s-Nos is hygromycin resistance, broadcasts containing on the MS0 substratum of 25mg/L Totomycin after seed disinfection, secretly cultivates after 5 days the positive seedling that hypocotyl can grow.

1.7 high pressure permeability methods transform Chinese cabbage and screening

Reagent:

Transform damping fluid (1L): macroelement (50 ×): 10ml; Trace element (1000 ×): 0.5ml; CaCl ₂(100 ×): 5ml; Molysite (200 ×): 2.5ml; Organic (100 ×): 10ml; Sucrose: 50g; 6-BA (1mg/ml): 10 μ l; Silwet L-77: 200 μ l for vacuum filtration; Be adjusted to pH5.8, constant volume 1L with KOH.

Screening culture medium flat board: 3% sucrose MS0 solid medium (pH5.8) adds the Totomycin containing 25mg/L.

Step:

A) when just transforming after Chinese cabbage plant bolting.

B) before transforming, the flower of having pollinated and angle fruit are got rid of, and soil water suction is spent the night.

C) Agrobacterium of overnight incubation is diluted at 1: 100 in large bottle substratum, cultivate after 24 hours for 28 DEG C, centrifugal 20 minutes of 4 DEG C of 5000rpm, abandon supernatant, Agrobacterium precipitation is suspended in the conversion damping fluid of two volumes of original bacteria liquid, makes OD600 in 0.8 left and right.

D) over-ground part of Chinese cabbage immerses in bacterium liquid completely, vacuum infiltration 5 minutes, and intermittently 2 minutes, vacuum infiltration 5 minutes again, then took out and keeps flat, and covers preservative film and newspaper, under dark, spends the night, and moved into normal vertical cultivation of phytotron next day.Sowing dry 2 weeks afterwards.

E) seed is laid in the Ms0 solid plate containing 50mg/l Kan after aseptic sterilization, moves on to group training chamber through 4 DEG C of vernalization after 30 days, blocks that resistance seedling and moves on to continued growth in soil.

F) get blade extraction genomic dna and detect and obtain positive seedling through PCR, then screening obtains genetically modified pure lines through two generations, for further analysis.

1.8Northern hybridization

The configuration of 7.5% polyacrylamide gel

7.5% polyacrylamide gel working fluid (75ml):

Urea 31.5g

40% acrylamide mixture 14ml

(38g/100ml acrylamide, 2g/100ml N, N '-methylene diacrylamine)

5×TBE 15ml

H ₂O 23.5ml

Join glue:

Working fluid: 10ml

10％AP：50μl

TEMED：10μl

Sample loading buffer is saturated with urea, ensures that the applied sample amount of RNA is more than 10 μ g as far as possible.

Electrophoresis: 1 × TBE, 80V, 2 hours

Transferring film: 0.5 × TBE, 28mA, spends the night

UV-crosslinked 2 minutes, 80C dried film 2 hours.

Hybridization solution 100ml (2 films): SDS, 7g; Na2HPO4.12H2O, 12.24g; NaH2PO4.2H2O, 2.46g; 0.5M EDTA, 200 μ l; BSA, 1g.

γ-P32 ATP end mark probe: H2O, 21 μ l; PNK, 1.5 μ l; 10 × buffer, 3 μ l; Probe, 2 μ l; γ-P32 ATP, 3.5 μ l;

Wash film:

1 × SSC and 1%SDS wash film 3 times, press phosphorus screen.

Probe sequence

bfas5：ggtagttcttctgtcttcacc(SEQ ID NO：1)

probe a：atggccacgtctctctctactgcaa(SEQ ID NO：10)

probe b：gatacaaagttaattggcgtaaacacac(SEQ ID NO：11)

probe c：cccatgacaatgcgcgctttagata(SEQ ID NO：12)

2. results and analysis

The sequence signature of 2.1BrpFLC gene

From Chinese cabbage a kind of sedge zaotai morning genotype, we have cloned respectively 4 FLC homologous genes, and by them called after BrpFLC1, BrpFLC2, BrpFLC3 and BrpFLC5.Wherein BrpFLC2 plays an important role in vernalization process, compares with the Arabidopis thaliana FLC gene cDNA of reporting, and the homology of BrpFLC2 gene cDNA is 87% (Fig. 1).Wherein, the homology of N-end regions is very high, and the homology of C-end is lower.

The natural reverse transcription of 2.2BrpFLC gene sequence signature originally

We,, by search Chinese cabbage database, utilize RT-PCR method to separate two these BrpFLC2as of reverse transcription (BrpFLC2 antisense) of BrpFLC2: BrpFLC2as-1 and BrpFLC2as-2 (Fig. 2).These this shortage of reverse transcription reading frames are all non-coding RNA.The transcripting start point of BrpFLC2as-1 is positioned at fragment between the gene in BrpFLC2 3 ' UTR downstream, there is 340bp apart from terminator, sequence is faced, total length 478bp in side corresponding to fragment, 3 ' UTR, exon 7, exons 1,5 ' UTR and 5 ' UTR between the gene in BrpFLC2 downstream.BrpFLC2as-2 is consistent with the former, and just exons 1 is slightly shorter than BrpFLC2as-1.BrpFLC3as-1 site is identical with BrpFLC2as-1 and BrpFLC2as-2, corresponding to the partial sequence of fragment, 3 ' UTR, exon 7, exon 2 and exon 3 between the gene in BrpFLC3 downstream.

The impact of 2.3 vernalization treatment on Chinese cabbage BrpFLC2 and this expression level of reverse transcription thereof

In Arabidopis thaliana, FLOWER LOCUS C (FLC), as a kind of important arrestin negative regulation vernalization of blooming, participates in plant from nourishing and growing to the conversion process of reproductive growth.Research is in recent years found, has a kind of noncoding FLC antisense transcript (Natural antisencetranscripts, NATS) in Arabidopis thaliana plant body, and it is relevant with the expression level of FLC justice transcript.Whether can as Arabidopis thaliana FLC, participate in the adjusting of vernalization for studying Chinese cabbage BrpFLC, first will determine whether the expression originally of Chinese cabbage BrpFLC and reverse transcription thereof is subject to low temperature induction and changes in vernalization.For this reason, we design the special primer of BrpFLC2 and BrpFLC2as-1, get the Chinese cabbage blade in vernalization, are just detecting BrpFLC by RT-PCR, reverse transcription expression originally.In addition, the susceptibility difference of different Chinese cabbage cultivars to vernalization, such as, early a kind of sedge zaotai is easily by the genotype of vernalization, 4 DEG C of placements can complete vernalization in 25 days, and late a kind of sedge wantai is the genotype being difficult to by vernalization, need could bloom by vernalization for 75 days.In order to prove that BrpFLC gene and reverse transcription thereof have originally participated in this process, we by Chinese cabbage early the seedling of a kind of sedge zaotai be placed under the low temperature of 3-5 DEG C vernalization 30 days, get respectively leaf tissue therebetween and detect BrpFLC2 gene and the expression of this BrpFLas-1 of reverse transcription in vernalization process.Before subzero treatment, the expression level of BrpFLC2 is very high, and BrpFLas-1 is without expression signal (Fig. 3).When subzero treatment 12 days, vernalization well afoot, the expression level of BrpFLC2 significantly reduces, and the expression of BrpFLas-1 sharply raises.When subzero treatment 29 days, vernalization completes, and now the expression level of BrpFLC2 further reduces, and the expression level of BrpFLas-1 also reduces simultaneously.After subzero treatment 29 days, it is indoor that the Seedling of Chinese Cabbage of vernalization treatment is transplanted to artificial culture by we, is placed in continued growth under 20C.Transplant latter 7 days mensuration, the expression level of BrpFLC2 reduces before than subzero treatment greatly, but raises to some extent during with subzero treatment 29 days; Meanwhile, the expression level of BrpFLas-1 continues to present the trend of reduction.These results show, the expression of Chinese cabbage BrpFLC2 gene is subject to the inhibition of low temperature, and the expression of BrpFLC2as-1 is subject to the induction of low temperature.After subzero treatment is removed, the expression of BrpFLC2 gene has recovery to a certain degree to raise, and the expression of BrpFLC2as-1 further reduces.

When the genotypic seedling of a kind of sedge wantai on that night carries out same subzero treatment, the expression of BrpFLC2 gene is subject to the inhibition of low temperature, and the expression of BrpFLC2as-1 is subject to the induction (Fig. 4) of low temperature.When subzero treatment 12 days, vernalization well afoot, the expression level of BrpFLC2 obviously reduces, and the expression of BrpFLas-1 raises.When subzero treatment 22 days, vernalization is also underway, the level while now remaining on 12 days.This point is different from early a kind of sedge.In the seedling of a kind of sedge morning, after subzero treatment, 29 days time, the expression level of BrpFLC2 and BrpFLas-1 obviously reduces.In the seedling of late a kind of sedge, when subzero treatment 35 days, although vernalization does not also complete, the expression of BrpFLC2 and BrpFLas-1 obviously reduces.Be not difficult to find out, in late a kind of sedge genotype, late about at least 10 days of the Zao a kind of sedge genotype of ratio that in vernalization process, the forward and reverse transcript of BrpFLC declines.

2.4BrpFLC2 and reverse transcription thereof function originally

In Arabidopis thaliana, express Chinese cabbage BrpFLC genomic dna, utilize the difference in Chinese cabbage and Arabidopis thaliana FLC sequence, the expression of the forward and reverse transcript of detection Chinese cabbage BrpFLC that can be special by RT-PCR.Have this promotor (COOLAIR) of reverse transcription at the 3 ' end of Arabidopis thaliana FLC, it is this expression of initial Arabidopis thaliana FLC reverse transcription under cold condition.Find same this promotor of a reverse transcription that exists of the 3 ' end of Chinese cabbage BrpFLC by our transgenic experiments, it can initial BrpFLC reverse transcription in the transgenic arabidopsis of subzero treatment this expression.Utilize the difference on Arabidopis thaliana and Chinese cabbage FLC genomic dna sequence, in transgenic arabidopsis, can study the relation between the forward and reverse transcript of BrpFLC.Such as, whether reverse transcription generation originally relies on forward transcript, and whether reverse transcription originally can suppress the BrpFLC forward transcript under 35S driving.

In order to study the mutual relationship of knowing between BrpFLC2 and its reverse transcription basis, understand both functions in vernalization process, we have built 4 kind of plant expression vectors (construction process is shown in 1.5 parts):

p35S：pBrpFLC2：BrpFLC2/BrpFLC2as：pBrpFLC2as(SEQ ID NO：14)

p35S：pBrpFLC2：BrpFLC2/BrpFLC2as(SEQ ID NO：15)

pBrpFLC2：BrpFLC2/BrpFLC2as：pBrpFLC2as：p35S(SEQ ID NO：16)

BrpFLC2/BrpFLC2as：pBrpFLC2as：p35S(SEQ ID NO：17)

2.4.1BrpFLC2 the expression in p35S:pBrpFLC2:BrpFLC2/BrpFLC2as:pBrpFLC2as (SEQID NO:14) and p35S:pBrpFLC2:BrpFLC2/BrpFLC2as (SEQ ID NO:15) transgenic arabidopsis

35S strong promoter acts on pBrpFLC2:BrpFLC2/BrpFLC2as:pBrpFLC2as (SEQ IDNO:14), BrpFLC2 and BrpFLC2as express, after BrpFLC2as self promotor is removed, 35S strong promoter still acts in p35S:pBrpFLC2:BrpFLC2/BrpFLC2as (SEQ ID NO:15) transgenic arabidopsis plant, but has lost the driving effect (Fig. 5) to BrpFLC2as.Bearing performance is, when low temperature vernalization treatment 9 days, 35S promoter drives transfer-gen plant BrpFLC2 overexpression, but there is no the expression of this BrpFLC2as of reverse transcription.This explanation gene BrpFLC2 gene 3 ' end 109bp works during subzero treatment as reverse transcription promotor originally.

In the time of the flowering time of this transgenic lines (p35S:pBrpFLC2:BrpFLC2/BrpFLC2as) relatively and wild-type, we find, the former flowering time postpones about 3 weeks, this delay is relevant with the expression level of BrpFLC2, simultaneously, the phenomenon postponing of blooming in Arabidopis thaliana also obtains identical certification in transgenosis Chinese cabbage, and transfer-gen plant (p35S:pBrpFLC2:BrpFLC2/BrpFLC2as) postpones about 3.5 weeks than wild-type flowering time.

2.4.2BrpFLC2as at p35S:pBrpFLC2:BrpFLC2/BrpFLC2as:pBrpFLC2as (SEQ ID NO:14), the expression in pBrpFLC2:BrpFLC2/BrpFLC2as:pBrpFLC2as:p35S (SEQ IDNO:16) and BrpFLC2/BrpFLC2as:pBrpFLC2as:p35S (SEQ ID NO:17) transgenic arabidopsis

In the time that 35S promoter directly drives BrpFLCas (SEQ ID NO:16, not subzero treatment), we expect that the expression level of BrpFLCas can obviously raise.But result is to our surprise, do not having under subzero treatment condition, this does not express BrpFLC reverse transcription, but still expresses forward transcript.But, with 35S drive forward transcript compared with (SEQ ID NO:14, not subzero treatment), express weaker (Fig. 6).The appearance of forward transcript may be interpreted as, and contains the 374bp endogenesis promoter of forward transcript in structure.In order to verify the effect of forward transcript promotor and this expression of reverse transcription, we have built again and in former structure, have removed forward transcript promotor (SEQ ID NO:17, not subzero treatment).Result is, this BrpFLCas of reverse transcription obtains the expression of certain level, visible, and the existence of forward transcript has suppressed this expression (not under subzero treatment condition) of reverse transcription.We find, the flowering time of this transgenic arabidopsis plant (BrpFLC2/BrpFLC2as:pBrpFLC2as:p35S) and Chinese cabbage transfer-gen plant (BrpFLC2/BrpFLC2as:pBrpFLC2as:p35S) is all corresponding to wild-type 1 week and about 1.5 weeks ahead of time respectively.This explanation, the high level expression of BrpFLCas, is conducive to the conversion of nourishing and growing to reproductive growth.

3. discuss

The 4093bp fragment of Chinese cabbage BrpFLC2 genomic dna is structured in transgene expression vector, initial object is in transgenic arabidopsis, to detect the expression originally of BrpFLC reverse transcription, checking reverse transcription is originally crossed in the situation of expression, and in transgenic arabidopsis, whether the chromosomal region at BrpFLC genomic dna place occurs that the histone methylated epigenetic that waits suppresses mechanism.

This initial playing an important role that BrpFLC epigenetic in vernalization is suppressed of 3.1 reverse transcriptions

Seedling of Chinese Cabbage in low temperature vernalization treatment, need to process about 10 days, and BrpFLC forward transcript could reduce.Lasting this expression of reverse transcription could suppress BrpFLC forward transcript.The genotypic plant of a kind of sedge wantai in evening is difficult to by vernalization, and a kind of sedge zaotai compares with morning, and what in vernalization, BrpFLC forward transcript declined is slow, and the unobvious difference of reverse transcription expression originally, is not to cause the different reason of two kind vernalization susceptibilitys.

Early a kind of sedge zaotai BrpFLC forward transcript in the time of vernalization 12 days is substantially suppressed, and this expression of reverse transcription is higher.But now, not by vernalization, if put back to greenhouse, can go vernalization, BrpFLC expresses again.

The expression originally of 3.2 reverse transcriptions relies on the promotor of forward transcript

In animal, research is found, forward and reverse transcript has positively related trend, in Arabidopis thaliana, finds equally, and the reverse transcription of inducing under low temperature expression amount originally relies on the expression level of forward transcript self.This indication reverse transcription expression originally relies on the promotor of forward transcript.But in nature, report that in 09 year reverse transcription promotor originally can drive separately the expression (Swiezewski et al., 2007) of reporter gene.

The basic model of 3.3 Chinese cabbage BrpFLC2 genes and this BrpFLC2as of reverse transcription coordinated regulation vernalization

According to the phraseology of feature, BrpFLC2as and the BrpFLC2 gene of Chinese cabbage early bolting and late bolting gene type vernalization and the function in Arabidopis thaliana transfer-gen plant thereof, we have proposed the pattern of BrpFLC2 and its this mediation of non-coding RNA reverse transcription Chinese cabbage FLC vernalization.The process of Chinese cabbage vernalization and degree are subject to the regulation and control of BrpFLC gene and antisense transcript thereof simultaneously.Cold condition can be induced the expression of BrpFLC antisense transcript, and the expression of antisense transcript can be subject to the control of BrpFLC gene downstream short-movie section non-coding RNA, and depends on the promotor of BrpFLC gene, then suppresses again the expression of BrpFLC gene.The natural reverse transcription of BrpFLC gene and it this as a switch of blooming, open or close the process of vernalization, control Chinese cabbage and nourish and grow to the transformation of reproductive growth.We have carried out systematic evolution tree analysis to the homologous genes encoding protein sequence of Chinese cabbage BrpFLC2, see Fig. 7.Result shows, in cress, as wild cabbage, have this homologous gene in turnip etc., can estimate, this regulate and control method can be applied in other crops of Cruciferae and obtain corresponding regulating effect.

Claims

1. the promoter sequence separating, is characterized in that, the nucleotide sequence of described promoter sequence is as shown in SEQ ID NO:13.

2. a polynucleotide construction, its nucleotide sequence is as shown in SEQ ID NO:17.

3. one kind regulates and controls the method for cress vernalization, it is characterized in that, described method comprises utilizes the FLC gene of promoter regulation cress and/or the expression originally of the natural reverse transcription of this gene, wherein, the described step of utilizing promoter regulation comprises and proceeds to polynucleotide construction claimed in claim 2.

4. method as claimed in claim 3, is characterized in that, described cress is selected from Chinese cabbage, green vegetables, wild cabbage, rape and radish.

5. prepare a method for transgenosis cress, described method comprises:

(1) build polynucleotide construction claimed in claim 2;

(2) the polynucleotide construction of step (1) gained is proceeded to vegetable cell, tissue or organ, obtain the vegetable cell, tissue or the organ that transform; With

(3) vegetable cell, tissue or the neomorph that step (2) are obtained become plant.

6. method as claimed in claim 5, is characterized in that, described organ is seed.