CN102618529A - Biosynthetic method of long chain padlock probes - Google Patents

Abstract

The invention discloses a biosynthetic method of long chain padlock probes. The biosynthetic method basically comprises the following steps: synthesizing padlock probe precursors through applying a PCR method according to a designed padlock probe sequence, wherein 5' ends of the padlock probe precursors have double chain DNA restriction endonuclease identification sequences, and 3' ends of the padlock probe precursors have double chain DNA cutting enzyme identification sequences; and connecting the precursors to special vectors pOCP for purifying the padlock probes, converting escherichia coli, breeding plasmids, and carrying out enzyme digestion, polyacrylamide gel electrophoresis, recovery, purification, freeze-dry dehydration and the like on the plasmids to finally obtain the high quality long chain padlock probes.

Description

The biological synthesis method of long-chain attacker's probe

Technical field

The present invention relates to genetic engineering field, more particularly to a kind of biological synthesis method of long-chain attacker probe.

Background technology

Attacker's probe (Padlock probes) is also known as open loop probe (Open circle probes), it is combined with biochip technology, and a kind of high-throughout SNP (Single nucleotide polymorphisms have been developed now：SNP) typing method.The health and disease that SNP is change on the diversity being most widely present in human inheritance's diversity, these molecular genetics and the mankind are closely related.

Open loop probe is exactly the ring-shaped probe not closed, it is the oligonucleotide that a 5 ' ends are phosphorylated, respectively there are the sequence and template sequence complementary pairing that length is 15-20nt (nucleotides) in its 5 ' end and 3 ' ends, base of the 3 ' ends with an allele specific, after being matched with complementary series perfection, in the presence of T4DNA ligases, its 5 ' end is connected to form the molecule of annular with 3 ' ends, it can not can not be cyclized with the open loop probe of complementary series perfection pairing, still keep open loop situations.

At present, the synthesis of attacker's probe mainly has two methods：One kind is chemical synthesis, and another is PCR-based (Polymerase chain reaction) enzymatic clarification.SNP typing methods based on attacker's probe and biochip require high-quality attacker's probe, and this attacker's probe also requires complete 5 ' ends and 3 ' ends in addition to sequence is without mistake, and attacker's probe length is in more than 100nt.The obstacle that long-chain attacker's probe of the end of chemical synthesis 5 ' phosphorylation is faced is mainly：First, quality and the yield of chemical synthesis are reduced with the increase of the length of attacker's probe, and in chemical synthesis, the combined coefficient of each step is about 99%, therefore, for attacker's probe containing 150 nucleotides, and total combined coefficient is about 0.99¹⁴⁹=0.22；Second, with the increase of attacker's probe length, its difficulty purified also rises.Existing PAGE and HPLC purification process are purified according to the length of oligonucleotides, with the increase of oligonucleotide length, the oligonucleotides of non-total length of the full length rna oligonucleotide with lacking 1-2 nucleotides is difficult completely separable by PAGE or HPLC purification process, while the few nucleosides for the total length for resultant fault occur can not be distinguished；3rd, with the increase of attacker's probe length, its secondary structure possibility occurred is also increased, and secondary structure also reduces PAGE and HPLC purification efficiency；4th, the cost of chemical synthesis long-chain attacker's probe is very high.And attacker's probe of PCR-based method synthesis, its major defect is that synthetic quantity is small, and a large amount of synthesis costs are high, meanwhile, 3 ' ends of part probe are imperfect.Therefore, it is a kind of inevitable to seek new synthesis long-chain attacker's probe.

The content of the invention

It is an object of the present invention to provide long-chain attacker's probe biological synthesis method.

The method that the present invention is provided, comprises the following steps：

A, add respectively at attacker's probe body fragment two ends and to hold complementary DNA fragmentation 1 with testing gene 5 ' and hold complementary DNA fragmentation 2 with testing gene 3 ', obtain probe precursor；

Double-stranded DNA restriction enzyme MlyI recognition sites are contained in 5 ' ends of the DNA fragmentation 1, and the single-stranded nicking enzyme Nb.Bts I recognition sites of double-stranded DNA are contained in 3 ' ends of the DNA fragmentation 2；

Attacker's probe body fragment is following I or II：

I nucleotides sequence is classified as in sequence table sequence 1 from the oligonucleotides of 5 ' end 24-125；

II nucleotides sequence is classified as in sequence table sequence 2 from the oligonucleotides of 5 ' end 24-125；

B, by step A) obtained probe precursor inserted between the multiple cloning sites of pOCP carriers, obtains recombinant vector；

C, with double-stranded DNA restriction enzyme MlyI and the single-stranded nicking enzyme Nb.Bts I digestions step B of double-stranded DNA) obtained recombinant vector, that is, obtain attacker's probe.

Step A) in, described added respectively at attacker's probe body fragment two ends holds the DNA fragmentation 1 of complementation with testing gene 5 ' and holds the method for complementary DNA fragmentation 2 to comprise the following steps with testing gene 3 '：

1) probe body fragment is split into following 24nt-52nt small fragment, artificial synthesized each small fragment：

Asp1_Com：CTCGTGTATGTCACGTGGCTAACTGGTCCAGTAGAGGTGGTCAGGCAATG；

Link_Asp1：GACATACACGAGCTCCCTTTGTAG；

Tag_7897：TGCGTCGGTAGAATGAGGTATTGTGGGTACTGGGTCTGAACTACAAAGGGAG；

Asp2_Com：GCAGGATCTTACTCCGCAATAACTGGTCCAGTAGAGGTGGTCAGGCAATG；

Link_Asp2：GTAAGATCCTGCCTCCCTTTGTAG；

2) Asp1_Com, Link_Asp1, Tag_7897 are connected, probe body fragment I complementary fragment (probe body fragment I complementary fragment and probe body fragment I reverse complementals) is obtained；

Or connection Asp2_Com, Link_Asp2, Tag_7897, obtain probe body fragment II complementary fragment (probe body fragment II complementary fragment and probe body fragment II reverse complementals)；

3) complementary fragment using probe body fragment I is template, and 7897A_F1 and 7897A_R1 are primer, enters performing PCR amplification, first round PCR primer is obtained, using first round PCR primer as template, 7897A_F2 and 7897A_R2 are primer, enter performing PCR amplification, obtain PCR primer 1, as probe precursor 1；

Or using probe body fragment II complementary fragment as template, 7897A_F1 and 7897A_R1 are primer, enter performing PCR amplification, first round PCR primer is obtained, using first round PCR primer as template, 7897A_F2 and 7897G_R2 are primer, enter performing PCR amplification, obtain PCR primer 2, as probe precursor 2；

The nucleotide sequence of the 7897A_F1 is as follows：CTCGTTCTGGCTTAGGCATTGCCTGACCACC；

The nucleotide sequence of the 7897A_R1 is as follows：GAAAGCTGTGAAAGGTGCGTCGGTAGAATG；

The nucleotide sequence of the 7897A_F2 is as follows：GAGTCTTCCTAGTCTTTCTCGTTCTGGCTTAG；

The nucleotide sequence of the 7897A_R2 is as follows：GCAGTGAGAGCGGAAAGCTGTGAAAGG；

The nucleotide sequence of the 7897G_R2 is as follows：GCAGTGGGAGCGGAAAGCTGTGAAAGG；

Step B) in, the multiple cloning sites are EcoRI recognition sites；

The nucleotides sequence of the pOCP carriers is classified as the sequence 5 in sequence table；

Step C) in, also comprise the following steps：

4) the digestion products gel electrophoresis for obtaining the digestion is separated, and reclaims 146nt fragment；

5) by step 4) obtained 146nt fragment, reversely chromatographed, collect chromatographic eluate, freezed, as attacker's probe.

Step B) in, the gel electrophoresis uses 5% (weight/mass percentage composition) urea-denatured polyacrylamide gel；

Step C) in, eluted in the reverse chromatography using following solution：The solution that the own nitriles of 30ml and 70ml deionized waters are mixed to get；

The chromatographic column used in the reverse chromatography is Sep-PakC18 post.

Attacker's probe that above-mentioned method is prepared is also the scope of protection of the invention.

Application of the above-mentioned method in the long oligonucleotide that phosphorylation is held in synthesis 5 ' is also the scope of protection of the invention, and the long oligonucleotide is the oligonucleotide more than 100nt.

It is a further object to provide a kind of attacker's probe.

The probe that the present invention is provided, from 5 ' to 3 ' are followed successively by the right side oligonucleotides held complementary left side oligonucleotides, probe body fragment with testing gene 5 ' and complementation is held with testing gene 3 '；

The probe body fragment be in sequence table sequence 1 from 24-125 oligonucleotides of the sequence 2 from 5 ' ends in 24-125 oligonucleotides of 5 ' ends or sequence table.

It is described to hold with testing gene 5 ' complementary left side oligonucleotides to be 1-23 oligonucleotides of the sequence 1 from the 1-23 oligonucleotides or sequence 2 of 5 ' ends from 5 ' ends in sequence table；

It is described hold with testing gene 3 ' complementary right side oligonucleotides be in sequence table sequence 1 from 126-146 oligonucleotides of the sequence 2 from 5 ' ends in 126-146 oligonucleotides of 5 ' ends or sequence table；

5 ' terminal phosphates of attacker's probe, specially described left side oligonucleotides connects phosphate group from 5 ' ends on the 5th C of first nucleotides.

Kit containing attacker's probe is also the scope of protection of the invention.

Recombinant vector or recombinant bacterium containing attacker's probe and its complementary strand are also the scope of protection of the invention,

The recombinant vector is that attacker's probe and its complementary strand are inserted into the carrier obtained at pOCP EcoRI restriction enzyme sites；The nucleotides sequence of the plasmid pOCP is classified as the sequence 5 in sequence table.

Application of the attacker's probe in biological SNP identifications；

Or application of the kit in biological SNP identifications；

Or the application of the recombinant vector or recombinant bacterium in biological SNP identifications；Use above is the scope of protection of the invention.

The biology is plant, and the plant is specially arabidopsis；

The arabidopsis SNP is the polymorphism of the 1055234th nucleotides of arabidopsis rice chromosome；

The 1055234th nucleotides that the polymorphism of 1055234th nucleotides of the arabidopsis rice chromosome is specially arabidopsis rice chromosome is A or G.

The experiment proves that, the biosynthesis of attacker's probe, attacker's probe precursor is produced by PCR method first, attacker's probe precursor is connected with carrier pGEM-T Easy Vector (Promega) and obtains recombinant vector, the carrier pOCP special with purifying attacker's probe of the fragment with attacker's probe precursor is connected after digestion, attacker's probe is separated by gel electrophoresis after digestion, attacker's probe solution of gel separation is purified by Sep-Pak C18 reversed phase chromatographies post, and high-quality attacker's probe is obtained after freeze-dried dehydration.

Brief description of the drawings

Fig. 1 is pGEM-7897A physical maps

Fig. 2 is plasmid pGEM -7897A and pGEM-7897G digestion products

Fig. 3 is pOCP physical map

Fig. 4 is pOCP-7897A physical map

Fig. 5 is plasmid pOCP-7897A digestion products

Fig. 6 is the attacker's probe BKN000007897A synthesized identification

Fig. 7 is the attacker's probe PROBE_BKN000007897A and PROBE_BKN000007897G that synthesize special connection

Fig. 8 is that rolling circle amplification (RCA) reaction carries out SNP identifications

Embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.

The acquisition of embodiment 1, long-chain attacker's probe BKN000007897A and BKN000007897G

1st, attacker's probe BKN000007897A and BKN000007897G structure and design

BKN000007897 is a SNP of arabidopsis (Arabidopsis thaliana) (polymorphism of the 55730th nucleotides in genbank accession number AF069298), positioned at the 1055234-1055234bp of rice chromosome, the homozygote genotype of wherein Columbia (Col) wild type is AA, the homozygote genotype of Landsberg erecta (Ler) wild type is GG, and its flanking sequence is respectively：

- the CCTAAGCCAGAACGAGAAAGACT-3 ' of left side sequence 5 '

- the G of right flanks 5 ' (A) GAGCGGAAAGCTGTGAAAGG-3 '

Attacker probe BKN000007897A specific recognition allele A, attacker probe BKN000007897G specific recognition allele G, the length of two attacker's probes is 146nt, and 5 ' terminal phosphates, implementation sequence and structure illustrated in table 1.

Table 1. attacker's probe BKN000007897A and BKN000007897G implementation sequence and structure explanation

It is described to hold with testing gene 5 ' complementary left side oligonucleotides to be 1-23 oligonucleotides of the sequence 1 from the 1-23 oligonucleotides or sequence 2 of 5 ' ends from 5 ' ends in sequence table；

It is described to hold with testing gene 3 ' complementary right side oligonucleotides 1 to be 126-146 oligonucleotides of the sequence 1 from 5 ' ends in sequence table；

It is described to hold with testing gene 3 ' complementary right side oligonucleotides 2 to be 126-146 oligonucleotides of the sequence 2 from 5 ' ends in sequence table；

2nd, attacker's probe BKN000007897A and BKN000007897G biosynthesis

1. the structure and design of biosynthesis attacker probe precursor

Attacker probe precursor BKN000007897A_ds and BKN000007897G_ds are designed, the two sequences are a difference in that its left and right ends respectively with the addition of a restriction enzyme site with BKN000007897A's and BKN000007897G, its structure illustrated in table 2.

Table 2.BKN000007897A_ds and BKN000007897G_ds implementation sequence and structure explanation

2. the structure of BKN000007897A and BKN000007897G main bodys sequence

Chemical synthetic oligonucleotide Asp1_Com, Link_Asp1, Tag_7897, Asp2_Com, Link_Asp2 (sequence is specifically shown in Table 3)；

Asp1_Com, Link_Asp1 and Tag_7897 obtained above are connected in the presence of T4DNA ligases, specific coupled reaction system is：1ul 10 × T4 ligase buffer solutions, 0.5ul 10uM Asp1_Com, 0.5ul 10uMLink_Asp1, 0.5ul 10uM Tag_7897, 0.1ul 100mM ATP, 0.5ul T4 DNA ligase (400, 000U/ul), plus sterilizing distilled water is to 10ul, after 24 DEG C are stayed overnight, 65 DEG C of heating make enzyme lose activity in 10 minutes, obtaining connection product, (Asp1_Com is connected to form main body complementary sequence with Tag_7897, Asp1_Com and Tag_7897 partial sequence connection difference Link_Asp1 reverse complementals, Asp1_Com is connected with Tag_7897 by Link_Asp1.), sequencing is sent to, is as a result the main body sequence of the BKN000007897A in table 3, is named as Asp1_Tag_7897A.

Asp2_Com, Link_Asp2 and Tag_7897 are connected using above-mentioned same method, obtains sending to sequencing, is as a result the main body sequence of the BKN000007897G in table 3, is named as Asp2_Tag_7897G.

The oligonucleotide of table 3. and PCR primer

Described BKN000007897A subject sequences are classified as 24-125 oligonucleotides of the sequence 1 from 5 ' ends in table 1；

Described BKN000007897G subject sequences are classified as 24-125 oligonucleotides of the sequence 2 from 5 ' ends in table 1；

3. PCR methods synthesize attacker's probe precursor BKN000007897A_ds and BKN000007897G_ds

Design attacker's probe precursor BKN000007897A_ds is synthesized with BKN000007897G_ds PCR using 5 primer 7897A_F1,7897A_F2,7897A_R1,7897A_R2,7897G_R2 (particular sequence is shown in Table 3),

The Asp1_Tag_7897A and Asp2_Tag_7897G that 2. above-mentioned steps are obtained are diluted respectively as template after 10,000 times, carry out two-wheeled PCR.

It is specific as follows：

1) first round PCR, forward primer is 7897A_F1, and reverse primer is 7897A_R1, and the Asp1_Tag_7897A of above-mentioned 10,000 times of dilution is as first round PCR DNA profiling, and reaction system is：2ul 10x PCR buffer solutions, 1.6ul2.5mM dNTP, 0.5ul 10uM forward primer 7897A_F1,0.5ul 10uM reverse primer 7897A_R1,1ul DNA profiling, 0.1ul rTaq (5U/ul), plus sterilizing distilled water is to 20ul.Next round PCR DNA profiling is used as after first round PCR 10,000 times of product dilution.Second wheel PCR forward primer is 7897A_F2, and reverse primer is 7897A_R2.Two-wheeled PCR reaction condition is consistent, and reaction condition is：First 95 DEG C 5 minutes；94 DEG C 30 seconds again, 55 DEG C 30 seconds, 72 DEG C 15 seconds, totally 25 circulations；It is last 72 DEG C 10 minutes, obtain PCR primer 1.

2) first round PCR, to dilute 10,000 times of Asp2_Tag_7897G as first round PCR DNA profiling, reaction system with it is above-mentioned 1) identical, the difference is that first round PCR primer is 7897A_F1 and 7897A_R1, second wheel PCR primer is 7897A_F2 and 7897G_R2, obtains PCR primer 2.

4. plasmid pGEM -7897A and pGEM-7897G is built

Above-mentioned PCR primer 1 and PCR primer 2 are connected with pGEM-T easy carriers (being purchased from Promega companies) respectively after purification, linked system is：2.5ul 2x rapid ligation buffers, 0.4ul pGEM-T Easy Vector (50ng/ul), the wheel PCR primers of 0.2ul second (10ng/ul), 0.3ul ul T4DNA Ligase (3U/ul), plus sterilizing distilled water, to 5ul, 24 DEG C incubate 1 hour.2ul connection products are taken to convert e.colistraindh5α respectively respectively.Obtained clone is screened through blue hickie.

The plasmid for the clone for being transferred to PCR primer 1 is extracted as template, performing PCR is entered with M13 forward primers and 7897A_F2, the plasmid of fragment containing 146bp sends to sequencing, as a result there is the DNA molecular shown in the sequence 3 in sequence table for the PCR primer 1 that the plasmid contains, the PCR primer is named as precursor BKN000007897A_ds, the plasmid is that the DNA molecular shown in the sequence 3 in sequence table is inserted to the carrier obtained in pGEM-T easy, and the plasmid is named as into pGEM-7897A.The structural representation of the plasmid is as shown in Figure 1.

The plasmid for the clone for being transferred to PCR primer 2 is extracted as template, performing PCR is entered with M13 forward primers and 7897A_R2, the plasmid of fragment containing 146bp sends to sequencing, as a result there is the DNA molecular shown in the sequence 4 in sequence table for the PCR primer 2 that the plasmid contains, the PCR primer is named as precursor BKN000007897G_ds, the plasmid is that the DNA molecular shown in the sequence 4 in sequence table is inserted to the carrier obtained in pGEM-T easy, and the plasmid is named as into pGEM-7897G.

The method of above-mentioned conversion DH5 α bacterial strains is as follows：The competence DH5 α bacterium solutions preserved are taken out from -80 DEG C of refrigerators, be placed on makes it melt naturally in about 5 minutes on ice, 50ul bacterium solutions and 2ul connection products are put into the centrifuge tube being placed on ice, centrifuge tube is gently rotated to mix, after placing 20 minutes on ice, it is heat-treated 45-50 seconds in 42 DEG C, it is placed in again 2 minutes on ice, then 950ulSOC culture mediums are added, shaken 30 minutes 1 hour in about 150rpm in 37 DEG C of shaking tables, the SOC culture mediums for finally taking 50-100ul to convert are coated on LB/ ammonia benzyl/IPTG/X-Gal flat boards, and the content of ampicillin is 100ug/ml.

Method from the above-mentioned e.colistraindh5α containing pGEM-7897A and extraction pGEM-7897A and pGEM-7897G plasmids in pGEM-7897G e.colistraindh5αs is as follows：The e.colistraindh5α for being respectively provided with pGEM-7897A and pGEM-7897G plasmids is stayed overnight in 37 DEG C of 230rpm of 1ml LB culture mediums, 500ul is taken to be stayed overnight in 37 DEG C of 230rpm of 25ml LB culture mediums, plasmid is extracted according to middle amount plasmid extraction method, finally plus 37 DEG C of 200ulTE and RNase are incubated 3 hours, pGEM-7897A and pGEM-7897G are obtained.

5. attacker's probe BKN000007897A and BKN000007897G are prepared

Plasmid pGEM -7897A and pGEM-7897G distinguishes double digestion, and the enzyme of double digestion is MlyI (NEW ENGLAND BioLabs cut double-strand) and Nb.Bts I (NEW ENGLAND BioLabs, cutting single-chain), and the system of double digestion is：10 × NEB of 2ul buffer solutions 4,100 × BSA of 0.2ul, 0.4ul MlyI (10U/ul), 0.6ul Nb.Bts I (10U/ul), 5ul DNAs (200ng/ul), plus sterilizing distilled water is to 20ul, after 37 DEG C incubate 2 hours, 80 DEG C of heating inactivate enzyme in 20 minutes, obtained digestion products are respectively in 5%PAGE electrophoresis, as a result it is as shown in Figure 2,1 is plasmid pGEM -7897A digestion products, illustrate to obtain the band probe that size is 146nt, be named as BKN000007897A；The result of plasmid pGEM -7897G digestion products, without significant difference, illustrates to obtain the band probe that size is 146nt, is named as BKN000007897G with Fig. 2.

It is as follows by sequencing result：Attacker's probe BKN000007897A has in sequence table sequence 1 from the nucleotides of 5 ' end 1-146.In sequence table sequence 1 from the nucleotides of 5 ' end 24-125 be parent moiety, it is consistent with the sequence of Asp1_Tag_7897A in table 3.

Attacker's probe BKN000007897G has in sequence table sequence 2 from the nucleotides of 5 ' end 1-146, and in sequence table sequence 2 from the nucleotides of 5 ' end 24-125 be parent moiety, it is consistent with the sequence of Asp2_Tag_7897G in table 3.

6. the special carrier pOCP of attacker's Probe Purification

Due to the plasmid pGEM -7897A and pGEM-7897G of above-mentioned acquisition, the carrier used is pGEM-T EasyVector, it carries multiple MlyI and Nb.BtsI restriction enzyme site, cause the purifying of probe more difficult, a new carrier pOCP is constructed (shown in the sequence 3 that the nucleotides sequence of the carrier is classified as in sequence table for ease of the purifying of probe, total length 2456bp), the carrier is in addition to the restriction enzyme site (sequence 5 from the nucleotides of 5 ' end 1063-1067) containing a MlyI in pUC replication orgins (sequence 5 from 5 ' end 765-1438bp), Nb.Bts I restriction enzyme site is free of in full sequence, with kalamycin resistance mark (sequence 5 from 5 ' end 1635-2429bp), BstBI restriction enzyme sites are sequence 5 from 5 ' end 108-113 nucleotides, with sequence 5 from the nucleotides of 5 ' end 1486-1491, MluI restriction enzyme sites are sequence 5 from 5 ' end 544-549 nucleotides, EcoRI restriction enzyme sites are sequence 5 from 5 ' end 50-55.POCP carrier figure is as shown in Figure 3.

7. pOCP-7897A and pOCP-7897G is built

Plasmid pOCP (1 EcoRI site), pGEM-7897A (2 EcoRI sites) and pGEM-7897G (2 EcoRI sites) use EcoRI digestions respectively, and the system of digestion is：2ul 10 × H buffer solutions, 1ul EcoRI (15U/ul) (TaKaRa), 5ul DNAs (200ng/ul), plus sterilizing distilled water are to 20ul, and after 37 DEG C incubate 2 hours, 65 DEG C of heating inactivate enzyme in 20 minutes.

182bp fragment is reclaimed after pGEM-7897A digestions as digestion products,

182bp fragment is reclaimed after pGEM-7897G digestions as digestion products,

Plasmid pOCP is handled with after EcoRI digestions, then with CIAP (Cloned Alkaline Phosphatase, Calf intestine) (TaKaRa), removes the phosphate of the end of vector DNA fragment 5 '.CIAP goes the reaction system of phosphoric acid：

5ul 10 × Alkaline Phosphatase buffer solutions, 40ul plasmid pOCP digestion products (300ng/ul), 2ul CIAP (15U/ul) (TaKaRa), plus sterilizing distilled water is to 50ul, 37 DEG C of incubations reclaim dephosphorylized carrier pOCP after 30 minutes, and method is as follows：Phenol/chloroform/isoamyl alcohol (25: 24: 1) is extracted 2 times；Chloroform/isoamyl alcohol (24: 1) is extracted 1 time；Add 5ul 3M NaOAC；Add 125ul (2.5 times of volumes) cold ethanol, cold insulation 60 minutes at -20 DEG C；Centrifuge and reclaim precipitation, cleaned with 200ul 70% cold ethanol, drying at room temperature 10 minutes；Precipitated with 20ul TE buffer solutions, the pOCP linearized.

Plasmid pGEM -7897A and pGEM-7897G digestion products are connected with the pOCP of linearisation respectively, obtain connection product 1 and connection product 2, and linked system is：2.5ul 2x rapid ligation buffers, 0.5ul pOCP Vector (20ng/ul), 0.5ul pGEM-7897A double digestions products (50ng/ul), 0.3ul ul T4 DNA Ligase (3U/ul), plus sterilizing distilled water, to 5ul, 24 DEG C incubate 1 hour.

Take 2ul connection products 1 and connection product 2 to convert e.colistraindh5α respectively, obtain transformant 1 and transformant 2.

The plasmid for extracting transformant 1 is used as template, enter performing PCR with primer 7897A_F2 and 7897A_R2 to identify, obtain the plasmid that size is 146bp fragments and send to sequencing, as a result be that the plasmid is the carrier that will be obtained between the EcoRI restriction enzyme sites of the DNA molecular insertion pOCP shown in the sequence 3 in sequence table, the plasmid is named as pOCP-7897A (plasmid construct collection of illustrative plates is as shown in Figure 4).

The plasmid for extracting transformant 2 is used as template, enter performing PCR with primer 7897A_F2 and 7897G_R2 to identify, obtain the plasmid that size is 146bp fragments and send to sequencing, as a result it is that the plasmid is the carrier that will be obtained between the EcoRI restriction enzyme sites of the DNA molecular insertion pOCP shown in the sequence 4 in sequence table, the plasmid is named as pOCP-7897G.

The method of DH5 α bacterial strains is converted it has been observed that the SOC culture mediums of conversion are coated on LB/ cards that flat boards, the content of kanamycins is 50ug/ml.

The plasmid pOCP-7897A of above-mentioned acquisition and pOCP-7897G is distinguished into double digestion, the enzyme of double digestion is MlyI (NEW ENGLAND BioLabs) and Nb.Bts I (NEW ENGLAND BioLabs), and the system of double digestion is：2ul 10x NEB buffer solutions 4,0.2ul 100x BSA,0.4ul MlyI(10U/ul),0.6ul Nb.BtsI(10U/ul),5ul DNAs (200ng/ul),Plus sterilizing distilled water is to 20ul,After 37 DEG C incubate 2 hours,80 DEG C of heating inactivate enzyme in 20 minutes,Obtained digestion products are respectively in 5% urea-denatured polyacrylamide gel (PAGE),Electrophoresis 1 hour under 250 volts of voltages,As a result it is as shown in Figure 5,1-10 is respectively that with the digestion products of different enzyme amount, (1 is 0.6ul Mly I and 0.6ul Nb.BtsI to plasmid pOCP-7897,2 be 0.6ul MlyI and 0.4ul Nb.BtsI,3 be 0.6ul Mly I and 0.2ul Nb.BtsI,4 be 0.4ul Mly I and 0.6ul Nb.Bts I,5 be 0.4ul Mly I and 0.4ul Nb.Bts I,6 be 0.4ul Mly I and 0.2ul Nb.Bts I,7 be 0.2ul MlyI and 0.6ul Nb.Bts I,8 be 0.2ul Mly I and 0.4ul Nb.Bts I,9 be 0.2ul Mly I and 0.2ulNb.Bts I,10 be 0.5ul Mly I and 0ul Nb.Bts I),It can be seen that size is 146nt,As obtain attacker's probe BKN000007897A；

POCP-7897G digestion result, without significant difference, illustrates to obtain attacker's probe BKN000007897G that size is 146nt with Fig. 5.

3rd, attacker's probe BKN000007897A and BKN000007897G isolation and purification

1) separate：

The band PAGE glue with target DNA that above-mentioned digestion is obtained, gel slice is moved into isometric oligonucleotides elution buffer, 37 DEG C of shaking tables are shaken after 3 hours in 250rpm, attacker's probe is just dissolved in elution buffer, so as to respectively obtain attacker's probe BKN000007897A solution and BKN000007897G solution.

Oligonucleotides elution buffer is made up of ammonium acetate, magnesium acetate and water, and concentration of the ammonium acetate in oligonucleotides elution buffer is 10mM.

2) purifying of attacker's probe

10 milligrams of C18 reversed phase chromatography silica gel are loaded in the above-mentioned attacker's probe BKN000007897A solution and BKN000007897G solution 1) obtained, the attacker's probe reclaimed with 1 milliliter of Sep-Pak C18 posts reverse phase chromatography, the post.

With Sep-Pak C18 reversed phase chromatography posts purify attacker's probe the step of it is as follows：

1 milliliter of own nitrile passes through phase layer post；

2 milliliters of sterilizing distilled waters pass through phase layer post；

1 milliliter of 10mM ammonium acetate solutions (formula：77.1 grams of ammonium acetates are dissolved in 100 ml deionized waters, concentration of the ammonium acetate in ammonium acetate solution is 10mM.) pass through phase layer post；

Attacker's probe BKN000007897A solution of recovery passes through phase layer post；

200 microlitres of 25mM ammonium hydrogen carbonate pass through phase layer post；

3000rpm is centrifuged 2 minutes；

With 3 milliliter of 30% own nitrile solution (formula of solution：The own nitriles of 30ml and 70ml deionized waters are mixed to get.) it would be incorporated into Sep-Pak C18 reversed phase chromatography posts (Waters, US, WAT020805 attacker's probe on) is eluted, merge eluent, -20 DEG C are placed in freeze, the lyophilized lyophilized dehydration of centrifuge, dissolved with 50 microlitres of sterilizing distilled waters, the attacker's probe BKN000007897A purified.

The product of 5% urea-denatured polyacrylamide gel detection purifying, as a result as shown in fig. 6, the wherein the 1st, 2,3 roads be respectively chemical synthesis 56nt, 102nt, 94nt oligonucleotide, the 4th road is attacker's probe BKN000007897A of purifying obtained above.

BKN000007897G solution, the attacker's probe BKN000007897G purified are purified using same method.

The SNP partings of embodiment 2, BKN000007897 attacker's probes

1st, asymmetric PCR amplification target DNA

The DNA fragmentation in site carries out asymmetric PCR amplification with forward primer BKN000007897F (being shown in Table 3) and reverse primer BKN000007897R (being shown in Table 3) where SNP (BKN000007897), arabidopsis (Arabidopsis thaliana) Col-0 and Ler-1 (Meinke D, Scholl R.The preservation of plant genetic resources.Experiences with Arabidopsis.Plant Physiol.2003Nov are expanded respectively；133(3)：1046-50. the public can obtain from Institute of Botany, Chinese Academy of Sciences.) genomic DNA, amplification obtain PCR primer (Col-0) and PCR primer (Ler-1), fragment length is 321bp.

PCR reaction systems are：

2uL 10 × PCR buffer solutions

1.6uL 2.5mmol/L dNTP

0.45uL 10umol/L forward primers BKN000007897F

0.05uL 10umol/L reverse primers BKN000007897R

1uL DNA profilings (50ng/uL)

0.1uL rTaq(5U/uL)(TaKaRa)

Plus sterilizing distilled water is to 20uL.

PCR reaction conditions：First 95 DEG C 5 minutes；94 DEG C 30 seconds again, 55 DEG C 30 seconds, 72 DEG C 40 seconds, totally 35 circulations；It is last 72 DEG C 10 minutes.

2nd, the connection of attacker's probe

The attacker's probe BKN000007897A for the purifying for taking the PCR primer (Col-0) of the above-mentioned acquisitions of 1uL and being obtained by embodiment 1 is attached, and obtains connection product 7897A (C)；

The attacker's probe BKN000007897G for the purifying for taking the PCR primer (Col-0) of the above-mentioned acquisitions of 1uL and being obtained by embodiment 1 is attached, and obtains connection product 7897G (C)；

The attacker's probe BKN000007897A for the purifying for taking the PCR primer (Ler-1) of the above-mentioned acquisitions of 1uL and being obtained by embodiment 1 is attached, and obtains connection product 7897A (L)；

The attacker's probe BKN000007897G for the purifying for taking the PCR primer (Ler-1) of the above-mentioned acquisitions of 1uL and being obtained by embodiment 1 is attached, and obtains connection product 7897G (L)；

The coupled reaction system of attacker's probe：

2uL

Buffer solution

1uL NAD(10mmol/L)

10uL attackers probe (1umol/L)

0.4uL

Heat-staple DNA ligase (5U/uL)

1uL PCR primers

Plus sterilizing distilled water is to 20uL

The coupled reaction condition of attacker's probe：First 95 DEG C 5 minutes；94 DEG C 30 seconds again, 55 DEG C 5 minutes, 15 circulations.

3rd, DNA excision enzymes endonuclease reaction

The above-mentioned attacker's probe connection product 7897A (C) of 12uL, 7897G (C), 7897A (L), 7897G (L) is taken to carry out DNA excision enzyme endonuclease reactions respectively.Exonuclease III (TaKaRa) have double-stranded DNA 5 prime excision enzyme activity, and only tangent linear fragment, ring-type fragment is not cut；Exonuclease I (NEB) have single stranded DNA 5 prime excision enzyme activity, and only tangent linear fragment, ring-type fragment is not cut.The system of digestion is carried out as control to be added without Exonuclease III and Exonuclease I.

DNA excision enzyme endonuclease reaction systems：

2uL 10 × Exonuclease III buffer solutions (TaKaRa)

0.4uL Exonuclease III(200U/uL)(TaKaRa)

2uL Exonuclease I(20000U/uL)(NEB)

The connection product of 12uL attacker's probes

Plus sterilizing distilled water is to 20uL.

DNA excision enzyme endonuclease reaction conditions：After 37 DEG C incubate 3 hours, 95 DEG C of heating inactivate 10 minutes DNA excision enzymes.

10 × Exonuclease III buffer solutions：

500mmol/L Tris-HCl(pH 8.0)

50mmol/L MgCl₂

100mmol/L 2 mercapto ethanols

By 5% urea-polyacrylamide gel electrophoresis, observed after silver staining, as a result as shown in Figure 4.

In Fig. 7, M1 is the oligonucleotides (94nt of 94nt chemical synthesis, small arrow is signified), M2 is the oligonucleotides (102nt of 102nt chemical synthesis, small arrow is signified), P is attacker's probe PROBE_BKN000007897A (146nt, small arrow is signified), C represents that Col-0, L represent Ler.7897A, 7897G represent attacker's probe BKN000007897A and attacker's probe BKN000007897G in coupled reaction respectively."-" represents that connection product does not use DNA excision enzyme digestions, and "+" represents that connection product passes through the circumscribed ferment treatments of DNA.Big arrow meaning is the cyclisation product of attacker's probe.

As can be seen from Figure 7, attacker's probe BKN000007897A and BKN000007897G have the specificity of connection, BKN000007897A specific recognitions Col-0 A genotype, it can be connected in the presence of Col-0 PCR primer, attacker's probe (swimming lane 4) of cyclisation is formed, the cyclisation product can not degrade (swimming lane 8) by DNA excision enzymes.BKN000007897G specific recognitions Ler G genotype, forms attacker's probe (swimming lane 6) of cyclisation, and its cyclisation product can not be degraded (swimming lane 11) by DNA excision enzymes.In the presence of the target DNA without attacker's probe, attacker's probe can not form cyclisation product.

4th, RCA reacts

The above-mentioned attacker's probe connection product 7897A (C) of 1uL, 7897G (C), 7897A (L), 7897G (L) is taken to carry out RCA reactions respectively.

(1) sample heat denatured and primer and attacker's probe anneals of cyclisation react

4.3uL sterilizing distilled waters

1uL 10 × phi29 DNA polymerase buffer liquid

1uL 10umol/L primers Commn_pri_F (being shown in Table 3)

The connection product of 1uL attacker's probes

95 DEG C are heated 3 minutes, are subsequently placed in 15 minutes on ice.

(2) added in above-mentioned reaction solution

2uL 2.5mmol/L dNTP

0.2uL 100×RSA

0.5uL phi29 archaeal dna polymerases (10U/uL) (NEB)

37 DEG C incubate 3 hours.

(3) 65 DEG C are heated 10 minutes, inactivate phi29 archaeal dna polymerases.

The cyclisation product of attacker's probe formation can be reacted by RCA to be expanded, and carries out RCA reactions with a primer, its product is single-stranded for long DNA, and after 0.6% agarose electrophoresis, RCA reaction products are still near loading wells.

As a result as shown in Figure 8, wherein C represents that Col-0, L represent Ler.7897A, 7897G represent attacker's probe BKN000007897A and attacker's probe BKN000007897G in coupled reaction respectively.M is D2000 DNA Marker, the product that arrow meaning is reacted for RCA.

All be that on the side of loading wells, can only judge from amount it can be seen that band is too big (general length is in more than 10000nt), amount it is big to go out long DNA for PCR single-stranded.Attacker's probe BKN000007897A and BKN000007897G have the specificity of connection, BKN000007897A specific recognitions Col-0 A genotype, form attacker's probe of cyclisation, and carry out RCA reactions with a primer, long DNA single-stranded (swimming lane 2) can be obtained, Ler G genotype, or linear fragment (swimming lane 3) can not be recognized.

BKN000007897G specific recognitions Ler G genotype, attacker's probe of cyclisation is formed, and RCA reactions are carried out with a primer, long DNA single-stranded (swimming lane 5) can be obtained, Col-0 A genotype, or linear fragment (swimming lane 4) can not be recognized.

It can be seen that, the result of RCA reactions is consistent with the result of above-mentioned 5% urea-denatured polyacrylamide gel electrophoresis, therefore SNP partings can be carried out by RCA reactions and DNA excision enzymes endonuclease reaction, SNP is differentiated without carrying out loaded down with trivial details urea-denatured polyacrylamide gel electrophoresis.

Claims (10)

1. a kind of biological synthesis method of long-chain attacker probe, comprises the following steps：

A, add respectively at attacker's probe body fragment two ends and to hold complementary DNA fragmentation 1 with testing gene 5 ' and hold complementary DNA fragmentation 2 with testing gene 3 ', obtain probe precursor；

Double-stranded DNA restriction enzyme MlyI recognition sites are contained in 5 ' ends of the DNA fragmentation 1, and the single-stranded nicking enzyme Nb.Bts I recognition sites of double-stranded DNA are contained in 3 ' ends of the DNA fragmentation 2；

Attacker's probe body fragment is following I or II：

I nucleotides sequence is classified as in sequence table sequence 1 from the oligonucleotides of 5 ' end 24-125；

II nucleotides sequence is classified as in sequence table sequence 2 from the oligonucleotides of 5 ' end 24-125；

B, by step A) obtained probe precursor inserted between the multiple cloning sites of pOCP carriers, obtains recombinant vector；

C, with double-stranded DNA restriction enzyme MlyI and the single-stranded nicking enzyme Nb.Bts I digestions step B of double-stranded DNA) obtained recombinant vector, that is, obtain attacker's probe.

2. according to the method described in claim 1, it is characterised in that：

Step A) in, described added respectively at attacker's probe body fragment two ends holds the DNA fragmentation 1 of complementation with testing gene 5 ' and holds the method for complementary DNA fragmentation 2 to comprise the following steps with testing gene 3 '：

1) probe body fragment is split into following 24nt-52nt small fragment, artificial synthesized each small fragment：

Asp1_Com：CTCGTGTATGTCACGTGGCTAACTGGTCCAGTAGAGGTGGTCAGGCAATG；

Link_Asp1：GACATACACGAGCTCCCTTTGTAG；

Tag_7897：TGCGTCGGTAGAATGAGGTATTGTGGGTACTGGGTCTGAACTACAAAGGGAG；

Asp2_Com：GCAGGATCTTACTCCGCAATAACTGGTCCAGTAGAGGTGGTCAGGCAATG；

Link_Asp2：GTAAGATCCTGCCTCCCTTTGTAG；

2) Asp1_Com, Link_Asp1, Tag_7897 are connected, probe body fragment I complementary fragment is obtained；

Or connection Asp2_Com, Link_Asp2, Tag_7897, obtain probe body fragment II complementary fragment；

3) complementary fragment using probe body fragment I is template, and 7897A_F1 and 7897A_R1 are primer, enters performing PCR amplification, first round PCR primer is obtained, using first round PCR primer as template, 7897A_F2 and 7897A_R2 are primer, enter performing PCR amplification, obtain PCR primer 1, as probe precursor 1；

Or using probe body fragment II complementary fragment as template, 7897A_F1 and 7897A_R1 are primer, enter performing PCR amplification, first round PCR primer is obtained, using first round PCR primer as template, 7897A_F2 and 7897G_R2 are primer, enter performing PCR amplification, obtain PCR primer 2, as probe precursor 2；

The nucleotide sequence of the 7897A_F1 is as follows：CTCGTTCTGGCTTAGGCATTGCCTGACCACC；

The nucleotide sequence of the 7897A_R1 is as follows：GAAAGCTGTGAAAGGTGCGTCGGTAGAATG；

The nucleotide sequence of the 7897A_F2 is as follows：GAGTCTTCCTAGTCTTTCTCGTTCTGGCTTAG；

The nucleotide sequence of the 7897A_R2 is as follows：GCAGTGAGAGCGGAAAGCTGTGAAAGG；

The nucleotide sequence of the 7897G_R2 is as follows：GCAGTGGGAGCGGAAAGCTGTGAAAGG；

Step B) in, the multiple cloning sites are EcoRI recognition sites；

The nucleotides sequence of the pOCP carriers is classified as the sequence 5 in sequence table；

Step C) in, also comprise the following steps：

4) the digestion products gel electrophoresis for obtaining the digestion is separated, and reclaims 146nt fragment；

5) by step 4) obtained 146nt fragment, reversely chromatographed, collect chromatographic eluate, freeze dehydration, as attacker's probe.

3. method according to claim 1 or 2, it is characterised in that：

Step B) in, the gel electrophoresis uses 5% (weight/mass percentage composition) urea-denatured polyacrylamide gel；

Step C) in, eluted in the reverse chromatography using following solution：The solution that the own nitriles of 30ml and 70ml deionized waters are mixed to get；

The chromatographic column used in the reverse chromatography is Sep-PakC18 post.

4. attacker's probe that any described methods of claim 1-3 are prepared.

5. application of any described methods of claim 1-3 in the long oligonucleotide that phosphorylation is held in synthesis 5 ', the long oligonucleotide is the oligonucleotide more than 100nt.

6. a kind of attacker's probe, from 5 ' to 3 ' are followed successively by the right side oligonucleotides held complementary left side oligonucleotides, probe body fragment with testing gene 5 ' and complementation is held with testing gene 3 '；

The probe body fragment be in sequence table sequence 1 from 24-125 oligonucleotides of the sequence 2 from 5 ' ends in 24-125 oligonucleotides of 5 ' ends or sequence table.

7. attacker's probe according to claim 6, it is characterised in that：

It is described to hold with testing gene 5 ' complementary left side oligonucleotides to be 1-23 oligonucleotides of the sequence 1 from the 1-23 oligonucleotides or sequence 2 of 5 ' ends from 5 ' ends in sequence table；

It is described hold with testing gene 3 ' complementary right side oligonucleotides be in sequence table sequence 1 from 126-146 oligonucleotides of the sequence 2 from 5 ' ends in 126-146 oligonucleotides of 5 ' ends or sequence table；

5 ' terminal phosphates of attacker's probe, specially described left side oligonucleotides connects phosphate group from 5 ' ends on the 5th C of first nucleotides.

8. the kit containing attacker's probe described in claim 4 or 6；Or recombinant vector or recombinant bacterium containing attacker's probe described in claim 4 or 6 and its complementary strand,

The recombinant vector is that attacker's probe and its complementary strand are inserted into the carrier obtained between pOCP EcoRI restriction enzyme sites；The nucleotides sequence of the plasmid pOCP is classified as the sequence 5 in sequence table.

9. application of attacker's probe in biological SNP identifications described in claim 4 or 6；

Or application of the kit described in claim 7 in biological SNP identifications；

Or the application of recombinant vector described in claim 8 or recombinant bacterium in biological SNP identifications.

10. application according to claim 9, it is characterised in that：

The biology is plant, and the plant is specially arabidopsis；

The arabidopsis SNP is the polymorphism of the 1055234th nucleotides of arabidopsis rice chromosome；

The 1055234th nucleotides that the polymorphism of 1055234th nucleotides of the arabidopsis rice chromosome is specially arabidopsis rice chromosome is A or G.

Images