CN101503698A - Non-false positive T vector and preparation - Google Patents
Non-false positive T vector and preparation Download PDFInfo
- Publication number
- CN101503698A CN101503698A CNA2009101033340A CN200910103334A CN101503698A CN 101503698 A CN101503698 A CN 101503698A CN A2009101033340 A CNA2009101033340 A CN A2009101033340A CN 200910103334 A CN200910103334 A CN 200910103334A CN 101503698 A CN101503698 A CN 101503698A
- Authority
- CN
- China
- Prior art keywords
- carrier
- vector
- site
- positive
- xcm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a non-false-positive T vector for cloning PCR fragments, and preparation thereof. The T vector is a linearization plasmid vector, of which two 3' ends both have a prominent dT, wherein sites of the T vector in which the PCR fragments of a dA prominent at the 3' ends, namely two tails ends of a linearization T vector, are positioned between an initiation codon of positive-clone selective marker gene and an upstream ribosome bind site. When the T vector designed and constructed according to the invention is used for cloning the PCR fragments, false-positive cloning cannot be produced because of the frame shift of the positive-clone selective marker gene, which is caused by the self connection of the T vector. The T vector overcomes the technical-mechanism disadvantage that the prior T vector produces false-positive clones during application because of the self connection of the vector. Therefore, from a technical mechanism (namely excluding the interference of other experimental factors), the T vector designed by the invention is void of the rate of false-positive cloning when the T vector is applied to T-A cloning.
Description
Technical field
Content of the present invention belongs to biological technical field, is specifically related to a kind of T carrier and preparation.
Background technology
1, plasmid vector
Molecule clone technology is the basis of genetic engineering technique.Molecule clone technology is used for that one section goal gene (dna fragmentation) is inserted a dna vector and supplies to carry out follow-up study with prolonged preservation and a large amount of this goal gene of preparation.The most frequently used molecular cloning vector is a plasmid vector: energy is self-replicating, the closed hoop double chain DNA molecule that goes down to posterity in bacterial cell.A plasmid vector that is used for molecular cloning will comprise following 3 functional units at least: the gene element that the plasmid self-replicating is necessary, 1-2 antibiotics resistance gene is for inserting the restriction enzyme site that target DNA fragment is used.The modern plasmid vector that just screening also comprises a selection markers gene (carrying out the beta galactosidase enzyme α fragment gene of blue hickie screening as utilizing the α complementarity principle) that is used for positive screening positive clone.
2, T-A clone technology and T carrier
After producing, round pcr become the most frequently used technology of obtaining goal gene, the initial segmental method of clone PCR is to introduce the restriction enzyme site that mates with cloning vector by the PCR primer at the dna fragmentation two ends of amplification, enzyme is cut the PCR product then, is inserted in the cloning vector that same enzyme cuts by ligase enzyme.Developed again afterwards and the segmental T-A clone technology of the faster clone PCR of energy.
The principle of T-A clone technology is: general T aq enzyme can add an outstanding dA at 3 ' end of the dna fragmentation that increases in the PCR reaction, if therefore 3 ' of linearizing carrier end has an outstanding dT, then form the complementary sticky end with the PCR fragment, thereby the two just can efficiently connect acquisition and comprise the segmental recombinant plasmid of purpose PCR, and this technology is the T-A clone technology.T preparing carriers method commonly used at present has two kinds:
(1) flat end adds the T method: at common cloning vector (is pre-T carrier, as pUC18) the positive selection markers gene of positive colony (as the LacZ gene among the pUC18) coding region inner by flat terminal restriction endonuclease (as the Sma I among the pUC18) with the pre-T carrier linearization for enzyme restriction, utilize terminal enzyme (DNA) activity 3 ' end of the flat terminal carrier molecule after linearizing under the condition of having only dTTP to exist of Taq enzyme to add 1 dT again, be prepared into the T carrier.
(2) dibit point enzyme is cut direct preparation method: in the positive-selecting marker gene, introduce two placed in-line, can promptly constitute pre-T carrier at the same restriction enzyme site (as Xcm I) that two 3 ' distal process of linearized vector go out a dT after cutting, this pre-T carrier only need cut pre-T carrier with corresponding restriction endonuclease, and purifying reclaims carrier segments can prepare the T carrier.
The T carrier is the core of T-A clone technology, and the T carrier of a lot of reagent manufacturers manufacturings, merchandisingization is arranged now.With need enzyme to cut after traditional molecule clone technology of being connected again compare, the T-A clone technology has greatly been simplified the process of clone's goal gene, and make things convenient for the sequencing of goal gene and cut by enzyme and carry out subclone (so that carrying out the expression of goal gene), become the routine techniques of molecular cloning now.
3, the technology mechanism defective of existing T carrier
The T-A clone technology provides the PCR fragment has efficiently been connected the shortcut that inserts carrier, but existing T carrier is because the technology mechanism defective in the design, when being applied to the T-A clone, it still has bigger problem in positive colony screening link, be the false positive problem, and bring very big difficulty therefore for user's cloning experimentation.
Existing T carrier is to utilize the blue hickie triage techniques of α complementarity principle to come screening positive clone mostly: α fragment (Lac Z) expression cassette of beta galactosidase enzyme is arranged on the carrier, and (hold near N) in inside, the segmental coding region of α in the segmental insertion of PCR site just design.Therefore after the purpose fragment is inserted the T carrier, the segmental reading frame of α is interrupted, thereby can not correctly express (insertion inactivation), contain the bacterium colony that the positive transformant of recombinant vectors grows and be white on the screening culture medium that contains inductor IPTG and chromogenic substrate X-gal; Otherwise the negative transformant that contains non-recombinant vectors (being pre-T carrier) can be because segmental being expressed on the above-mentioned screening culture medium of α grows up to blue colonies.Therefore, utilize this positive triage techniques, only converted product just need be cultivated on screening culture medium and can be filtered out positive colony by colony colour.
Yet some does not contain insertion fragment (so-called false positive clone) in the white colony that existing T carrier grows when practical application.How does these false positives clone produce so?
1) flat end adds the T carrier of T preparation
This T carrier is additionally to have added a dT at two 3 ' ends after the intragenic flat terminal restriction enzyme site of the positive colony selection markers of pre-T carrier is with its linearization for enzyme restriction, therefore, if (claim mistake to connect again from connecting at T-A clone neutral line T carrier molecule, mis-ligation, be the connection of incomplementarity sticky end), its be transformed into behind the host cell this not complementary dT-dT base pair can be complementary dT-dA base pair through the host cell reparation, so be to have had more 1 bp in the segmental coding region of α herein, this undoubtedly will make the reading frame (ORF) of its back change fully (to be called frameshit, frame shift), its consequence is that the α fragment can not correctly be expressed, can not finish the α complementation after being transformed into host cell, with the same white colony that is rendered as of positive colony that has the PCR fragment to insert, become the false positive clone.
2) dibit point enzyme is cut the T carrier of direct preparation:
The T carrier of this method preparation can avoid the T carrier because of producing false positive and clone from connecting back positive-selecting gene frameshit through the accurate design of two restriction enzyme sites in the pre-T carrier and intervening sequence thereof.But, when this method prepares the T carrier, after cutting, the pre-T carrier enzyme also can produce a small segment between two restriction enzyme sites, if this small segment is removed not thorough in the T carrier that reclaims (big fragment), this small segment will reconnect into the big fragment of carrier (because they have the complementary sticky end) in the T-A clone, and can reconnect with positive and negative two kinds of directions, thereby with positive colony screening-gene in the carrier that reconnects in the other direction the change of ORF just may destroy its function and form false positive and clone.Wanting 100% in the actual production, to remove this small segment be very difficult, also can produce the false positive clone when therefore using this T carrier.
The connecting certainly of linearizing T carrier molecule that two 3 ' ends all have 1 outstanding dT is difficulty, because their two sticky ends are non-complementary, but this T carrier molecule is from being connected in the generation that the false positive clone can be taken place and cause really in the reality.Certainly this not high from the efficient that connects, this also conforms to practical situation: the false positive cloning efficiency was usually about 20% during commercially available existing various T carriers used.What the user needed must be to contain the segmental true positives clone of purpose though it is not high that 20% false positive rate seems! To obtain real positive colony, obviously this has not only increased the experimental implementation step but also has increased experimental cost so people have in blue hickie screening back white colony to be screened (as bacterium colony PCR screening) once more when using traditional T carrier.
Summary of the invention
The invention provides a kind of non-false positive T vector.
1, the T carrier of the present invention design has the following technical characterictic that is different from existing T carrier, and produces the false positive clone because of carrier from connecting the positive colony screening-gene frameshit that causes when avoiding it to be used for the T-A clone with this: described T carrier is positioned between the ribosome bind site (RBS) of positive colony selection markers gene start codon and its upstream for inserting the segmental site of PCR (two ends of linearizing T carrier).And existing T carrier all is positioned at positive colony selection markers gene coding region inside (being positive colony selection markers gene start codon downstream) for inserting the segmental site of PCR.
Theoretical basis of the present invention is: efficient that prokaryotic gene is expressed and goal gene initiator codon are to the distance D between the RBS of its upstream (unit is bp) height correlation.Though the D between the different prokaryotic promoters is not quite similar, goal gene just can efficiently express when usually D was 8 ± 3bp scope in, surpass this distance then expression efficiency sharply descend, when D above behind the 20bp then goal gene do not express fully.The PCR fragment the shortest also more than 50bp (because the length that common two PCR primers are added up has just had 50bp) that needs the clone, so the PCR fragment is inserted D that this site will make recombinant vectors considerably beyond 20bp.According to above-mentioned theory, thereby this will cause positive colony selection markers gene to be beyond expression and feminine gender clone (do not contain and insert segmental clone) difference is come, and reaches the purpose of screening.
Simultaneously, when the insertion site is designed between the initiator codon of RBS and selection markers gene, when the T carrier takes place when connecting, just make from the D that connects the back carrier and increase by 1 bp, also in 8 ± 3bp scope, to the selection markers expression of gene without any influence, more can not influence the selection markers gene ORF, so its transformant will be rendered as negative clone rather than false positive clone.
2, the present invention realizes by the pre-T carrier that designs described T carrier:
Design one: between the RBS of positive colony selection markers gene (as the Lac Z among the pUC18) initiator codon of general cloning vector (as pUC18) and its upstream, promptly constitute required pre-T carrier by a rite-directed mutagenesis single flat terminal restriction enzyme site of introducing (as EcoR V).Cut pre-T carrier in this site with corresponding restriction endonuclease (as EcoR V), then with the Taq archaeal dna polymerase have only dTTP be under the condition of substrate at dT of two 3 ' end interpolations of linearizing DNA, can prepare non-false positive T vector of the present invention.
Design two: design, synthetic one section dna fragmentation that contains two placed in-line, Xcm I restriction enzyme sites that certain intervals is arranged, this fragments sequence satisfies following design requirements: the 8th Nucleotide in the Xcm I site sequence of upstream is designed to T, and in the upstream of this T, as far as possible near RBS sequence of this T design; The 8th Nucleotide in the Xcm I site sequence of downstream is designed to A, and in the upstream of this A, as far as possible near RBS sequence of this A (can comprise this A) design; Back eight nucleotide sequences of upstream Xcm I site sequence are the reverse complementary sequences of the first eight nucleotide sequence of downstream Xcm I site sequence.This synthetic fragment is introduced between the promotor of positive colony selection markers gene (as the Lac Z among the pUC18) initiator codon of general cloning vector (as pUC18) and its upstream and the RBS of the reconstruction in the Xcm I site sequence of downstream and the distance between the positive colony selection markers gene start codon be no more than 11 bp can constitute as described in pre-T carrier.Cut pre-T carrier with XcmI in these two sites, purifying reclaims the big fragment of linearizing carrier can prepare non-false positive T vector of the present invention.
Because this synthetic segmental above-mentioned particular design in the described pre-T carrier, the upstream that prepared T carrier next-door neighbour inserts the site is RBS, and the next-door neighbour inserts the initiator codon of the positive colony screening gene in downstream in site.Therefore, purpose PCR fragment is inserted this site and will be caused positive colony selection markers gene to be beyond expression and form positive colony; And if the T carrier connects certainly, then the distance of positive colony selection markers gene start codon and upstream RBS is no more than 11bp, and its transformant will form negative clone.In addition, reverse complemental design design owing to the sequence that comprises the RBS site among two Xcm I, no matter make that residual enzyme was cut small segment when the enzyme cutting was equipped with the T carrier reconnects in the T carrier with former direction or reverse direction, in the upstream from start codon 11bp of positive colony selection markers gene, all has a RBS, positive colony selection markers expression of gene is unaffected, and its transformant always is rendered as negative clone but not the false positive clone.
The T carrier of the present invention's design, preparation is when being used for the clone PCR fragment, and the T carrier that (1) flat end adds the preparation of T method can not produce the false positive clone because of the T carrier from connecting the positive colony selection markers gene frameshit that causes; (2) the dibit point enzyme T carrier of cutting direct preparation can not cut small segment because of residual pre-T carrier enzyme and oppositely inserts and produces false positive and clone.T carrier of the present invention has overcome existing T carrier produces the false positive clone in application technology mechanism defective with it to the innovative design of inserting the site.Therefore, (promptly get rid of the interference that other has the empirical factor of general character) from technology mechanism, the T carrier of the present invention's design can not produce the false positive clone when being applied to the T-A clone.
Description of drawings
Accompanying drawing only is the structural representation of carrier, thus each several part not with actual vector in being in proportion of corresponding DNA fragments.
The structural representation of the T carrier that Fig. 1 designs for the present invention.
Fig. 2 is the structural representation of existing T carrier.
3 ' dT represents the dT that two 3 ' distal process that end had of linearizing T carrier go out among the figure, and these two the terminal purpose PCR fragments that supply to go out a dA with 3 ' distal process are connected the recombinant plasmid that forms closed hoop by complementary sticky end.
Straight line among the figure is represented intervening sequence; Ori represents the plasmid replication starting point; R represents antibiotics resistance gene; Hollow arrow S represents positive colony selection markers gene coding region, and the direction of arrow is its direction of transcribing, expressing; RBS represents the ribosome bind site of positive colony selection markers gene.
Hollow arrow S among Fig. 2 is divided into two parts, and two ends of expression linearizing T carrier are positioned at positive colony selection markers gene coding region inside.
Embodiment
Embodiment one: structure and the T preparing carriers of the pre-T carrier pUC-EcoR V of non-false positive T vector
Be the carrier that sets out with general plasmid vector pUC18, implement with method as follows:
1, the structure of pre-T carrier pUC-EcoR V:
With commercially available
Site-directed mutagenesis kit test kit (Strategene company product) and according to the intervening sequence " AACAGCT " between the RBS of LacZ gene start codon and its upstream among the described method rite-directed mutagenesis of its product description pUC18.By design mutagenesis primer sudden change 3 bases wherein, this spacer segment sequence after the sudden change be "
GATATCT " (base that the base phalangeal process of overstriking becomes, the single endonuclease digestion site EcoRV that sequence shown in the underscore produces for the sudden change back).Plasmid after the sudden change is described pre-T carrier pUC-EcoRV, is transformed into propagation and preservation among the DH5a according to a conventional method.
2, the preparation of T carrier:
(1) cuts the pUC-EcoRV plasmid of 1-2ug with EcoR V enzyme, endonuclease reaction is undertaken by EcoR V supplier's specification sheets, get 1/50 reaction product after endonuclease reaction finishes and carry out agarose gel electrophoresis, observation,, otherwise prolong the endonuclease reaction time with thoroughly linearizing of affirmation pUC-EcoRV.
(2) adding isopyknic phenol in the endonuclease reaction product: chloroform: primary isoamyl alcohol (25:24:1), with the abundant mixing of vibrator; Centrifugal 10 minutes of 12000rpm draws the upper strata water and goes in another microtest tube; The 3M sodium acetate (pH 5.2) that adds 1/10 volume adds the freezing dehydrated alcohol of 2.5 times of volumes behind the mixing, mixing postposition-20 ℃ 1 hour; Centrifugal 10 minutes of 4 ℃, 12000rpm are abandoned supernatant, with 70% ethanol 1ml washing DNA precipitation of precooling, abandon supernatant; It is back with an amount of TE (pH 8.0) or ultrapure water dissolving DNA to treat that ethanol residual in the test tube is evaporated completely.
(3) the linearization plasmid DNA 1ug of adding previous step purifying in the PCR pipe, 10 * Taq PolymeraseBuffer (Mg
2+Free) 5ul, MgCl
2(2.5mM) 5ul, dTTP (100mM) 1ul, ultrapure water X ul is 50ul to reacting cumulative volume, adds Taq Polymerase 1-2U at last; Put in the PCR instrument 72 ℃ of incubations 2 hours.
(4) set by step the method purifying in (2) reclaims and adds the reacted DNA of T (determine liquor capacity according to the rate of recovery of estimating when last dissolving DNA precipitates, make DNA concentration be approximately 50ng/ul), is the non-false positive T vector pPosi-T that is available for the T-A clone.
3, non-false positive performance verification
(1) carry out self ligation with 50ng T carrier, ligation is carried out (ligation system volume is controlled in the 20ul) by T4-DNA ligase enzyme supplier's the description of product.
(2) chemical conversion process transforms the DH5a competence with the ligation product routinely, the converted product 200ul that gets after the recovery coats on the LB-Amp flat board that contains IPTG and X-gal, 37 ℃ of incubated overnight to bacterium colony sizes are 0.5-1mm, put 4 ℃ and observe colony colour after 2 hours.Get rid of the influence of IPTG and X-gal crawling, all bacterium colonies that grow (satellite colony that grows after not comprising) should be blue (promptly not having white colony), prove that pPosi-T can not form the false positive clone from connecting because of the T carrier when carrying out the T-A clone.
4, T-A clone performance verification
(1) T-A clone: with the pPosi-T of step 2 preparation routinely the T-A cloning process clone a specific PCR fragment (length is good) about 1000bp.The PCR fragment that is used to clone is terminal must be with 3 ' outstanding-dA, and reclaims through the gel electrophoresis purifying, and the mol ratio of PCR fragment and pPosi-T is 3-7:1 in the ligation.Transform the DH5a competence according to a conventional method.
(2) bacterium colony PCR identify the positive rate of white colony: a. at random picking N white transformant bacterium colony be inoculated in 5ml liquid LB-Amp substratum incubated overnight respectively; Get respectively and respectively manage overnight culture 10-20ul, centrifugal 2 minutes of 10000rpm abandons supernatant liquor, adds the resuspended bacterium of 20ul ultrapure water, and 100 ℃ were boiled 10 minutes, centrifugal 2 minutes of 10000rpm, and getting supernatant liquor 2-5ul is PCR reaction masterplate.B. with the segmental special primer of institute's clone PCR each sample masterplate DNA that previous step prepares is carried out pcr amplification (preferably establishing feminine gender and positive control), the PCR reaction system is pressed Taq Polymerase supplier's specification sheets and is formed.The bacterium colony that amplifies the purpose band is the true positives bacterium colony, otherwise is the false positive bacterium colony.The colony number X that amplifies the purpose band is True Positive Rate divided by the total colony number N that identifies.
(3) can carry out the T-A cloning experimentation with the blue hickie of commercially available tradition screening T carrier is parallel, with the True Positive Rate of the two white colony relatively.
Embodiment two: structure and the T preparing carriers of the pre-T carrier pUC-Xcm I of non-false positive T vector
Implement with method as follows for the carrier that sets out with the pre-T carrier pUC-EcoR V that makes up in the embodiment one:
1, the structure of pre-T carrier pUC-Xcm I
1) one section oligonucleotide sequence of design, this sequence must satisfy following design requirements:
(1) this fragment comprises two spaced, placed in-line Xcm I restriction enzyme sites.The recognition sequence of Xcm I is CCANNNN
NNNNNTGG, N can be A or T or G or C, last Nucleotide before the point of contact that the 8th Nucleotide shown in the underscore is this restriction enzyme site, and it becomes 3 ' outstanding sticky end after enzyme is cut.
(2) the 8th Nucleotide in the upstream Xcm I site sequence is designed to T, and in the upstream of this T, as far as possible near RBS site sequence AGGA of this T design.
(3) the 8th Nucleotide in the downstream Xcm I site sequence is designed to A, and in the upstream of this A, as far as possible near RBS site sequence AGGA of this A design.
(4) one section short intervening sequence of design between these two Xcm I site sequences wherein can not contain Xcm I, EcoR V or EcoR I site.
(5) back eight nucleotide sequences of upstream Xcm I site sequence are the reverse complementary sequences of the first eight nucleotide sequence of downstream Xcm I site sequence.
(6) 1-2 Nucleotide in interval behind the Xcm I site sequence of downstream; be the sequence (being ATGACCATGATTACGAATTC) in the EcoR I site extremely thereafter of LacZ gene coded sequence initiator codon ATG among the pUC-EcoR V then, (3 ' end) designs several protection Nucleotide in downstream, EcoR I site.
(7) design an EcoR V site and several protection Nucleotide in the upstream in Xcm I site, upstream (5 ' end).
The oligonucleotide sequence pattern that satisfies above-mentioned design requirements as:
5’
N
n GATATCCCA
NNNNTGGNNATGACCATGATTAC
GAATTC
N
n3’
Or
5’
N
n GATATCCCA
NNNNTGGNNATGACCATGATTAC
GAATTC
N
n3’
The tilted letter sequence is two Xcm I site sequences in this sequence pattern, and wherein the T of overstriking and A are last Nucleotide before the point of contact of these two restriction enzyme sites; The RBS of two sections sequences for rebuilding of band square frame; Sequence is an inverted repeats shown in two sections wavy lines, the N between the two
nThe sequence that expression can design arbitrarily, but length is unsuitable long; Sequence shown in the following setting-out is EcoR V and EcoR I site sequence, the N in its outside
nBe number and the indefinite protection Nucleotide (being generally 4 Nucleotide) of sequence, these two restriction enzyme sites are for cutting this synthetic DNA fragment and its orientation being inserted between the corresponding site of the carrier pUC-EcoR V that sets out.
2) synthetic oligonucleotide strand and complementary strand thereof by above-mentioned pattern design, two synthetic oligonucleotide strands promptly form double chain DNA fragment after sex change, annealing.
3) with EcoR V and the above-mentioned double chain DNA fragment 1-2ug of EcoR I double digestion, gel electrophoresis separates, reclaims the double-stranded fragment after enzyme is cut, and with same double digestion after the big fragment of pUC-EcoR V carrier that gel electrophoresis is reclaimed is connected (mol ratio of fragment and carrier is 10:1).Endonuclease reaction, glue reclaim and ligation is all undertaken by corresponding product supplier's working instructions.
4) the ligation product routinely chemical conversion process transform the DH5a competence, the plasmid that is obtained is pre-T carrier pUC-Xcm I.
2, the preparation of T carrier
Cut 1-2ug pUC-Xcm I plasmid DNA with Xcm I enzyme, the linearizing T carrier segments (big fragment) that gel electrophoresis separates, reclaims after enzyme is cut can prepare described non-false positive T vector.Phenol that also can be routinely: chloroform extracting, dehydrated alcohol intermediate processing reclaim the linearizing T carrier after enzyme is cut, but the T carrier of preparation is compared with the T carrier that glue reclaims preparation like this, and negative background clone ratio is higher during use.
3, the non-false positive performance verification is identical with corresponding method in the embodiment one with T-A clone performance verification method.
Claims (3)
1, a kind of non-false positive T vector, it is the linearization plasmid carrier that a kind of two 3 ' ends all have 1 outstanding dT, when described T carrier is used for the T-A clone, even the T carrier is from also not producing the false positive clone because of positive colony selection markers gene frameshit; It is characterized in that: described T carrier goes out the segmental site of PCR of a dA for inserting 3 ' distal process, i.e. two of linearizing T carrier ends are between the ribosome bind site of positive colony selection markers gene start codon and its upstream.
2, prepare the method for the described non-false positive T vector of claim 1, it is characterized in that:
(1) between the ribosome bind site of the positive colony selection markers gene start codon of general cloning vector and its upstream, introduces a single flat terminal restriction enzyme site, promptly get the pre-T carrier of described T carrier by rite-directed mutagenesis;
(2) cut described pre-T carrier with corresponding restriction endonuclease in this site, having only dTTP to add an outstanding dT at two 3 ' ends of linearizing pre-T carrier under the condition of substrate can prepare described non-false positive T vector with the Taq archaeal dna polymerase then.
3, prepare the method for the described non-false positive T vector of claim 1, it is characterized in that:
(1) design and synthetic section of DNA fragment, the sequence of this dna fragmentation has following characteristics: this sequence of a. contains two certain intervals, placed in-line Xcm I restriction enzyme site; B. last Nucleotide is T before the point of contact in the Xcm I site of upstream, and last Nucleotide is A before the point of contact in the Xcm I site in downstream; C. comprise an identical ribosome bind site respectively in the sequence before the point of contact in these two Xcm I site sequences; D. back eight nucleotide sequences of upstream Xcm I site sequence are the reverse complementary sequences of the first eight nucleotide sequence of downstream Xcm I site sequence; Between the promotor of the initiator codon of the positive colony selection markers gene of general cloning vector and its upstream, introduce the pre-T carrier that above-mentioned synthetic DNA fragment promptly gets described T carrier;
(2) cut described pre-T carrier with Xcm I in these two sites, purifying reclaims the big fragment of linearizing carrier can prepare described non-false positive T vector.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009101033340A CN101503698A (en) | 2009-03-06 | 2009-03-06 | Non-false positive T vector and preparation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009101033340A CN101503698A (en) | 2009-03-06 | 2009-03-06 | Non-false positive T vector and preparation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101503698A true CN101503698A (en) | 2009-08-12 |
Family
ID=40976073
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2009101033340A Pending CN101503698A (en) | 2009-03-06 | 2009-03-06 | Non-false positive T vector and preparation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101503698A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102628057A (en) * | 2012-03-21 | 2012-08-08 | 中国科学院武汉病毒研究所 | Vector for non-background directed cloning of PCR products, preparation method thereof and application thereof |
| CN103757039A (en) * | 2013-03-27 | 2014-04-30 | 广州赛哲生物科技有限公司 | Multifunctional cloning vector and use method thereof |
| CN107058357A (en) * | 2017-03-13 | 2017-08-18 | 四川农业大学 | A kind of TA cloning vectors and its construction method and application based on digestion |
-
2009
- 2009-03-06 CN CNA2009101033340A patent/CN101503698A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102628057A (en) * | 2012-03-21 | 2012-08-08 | 中国科学院武汉病毒研究所 | Vector for non-background directed cloning of PCR products, preparation method thereof and application thereof |
| CN102628057B (en) * | 2012-03-21 | 2013-06-19 | 中国科学院武汉病毒研究所 | Vector for non-background directed cloning of PCR products, preparation method thereof and application thereof |
| CN103757039A (en) * | 2013-03-27 | 2014-04-30 | 广州赛哲生物科技有限公司 | Multifunctional cloning vector and use method thereof |
| CN103757039B (en) * | 2013-03-27 | 2016-04-27 | 广州赛哲生物科技股份有限公司 | Multifunctional cloning vector and use method thereof |
| CN107058357A (en) * | 2017-03-13 | 2017-08-18 | 四川农业大学 | A kind of TA cloning vectors and its construction method and application based on digestion |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104903466B (en) | Bar coding nucleic acid | |
| CN101263227A (en) | CDNA library preparation | |
| EP2943579A1 (en) | Templates, libraries, kits and methods for generating molecules | |
| CN112359093B (en) | Method and kit for preparing and expressing and quantifying free miRNA library in blood | |
| US20200131504A1 (en) | Plasmid library comprising two random markers and use thereof in high throughput sequencing | |
| CN101126176A (en) | Preparation method for PCR high flux construction siRNA whole site molecule library | |
| CN102181527B (en) | Construction method of terminal gene library of full genome mRNA3' | |
| WO2021123062A1 (en) | Ngs library preparation using covalently closed nucleic acid molecule ends | |
| CN101935670B (en) | Method for constructing RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers | |
| CN116694603A (en) | Novel Cas protein, crispr-Cas system and use thereof in the field of gene editing | |
| CN101503698A (en) | Non-false positive T vector and preparation | |
| Delarbre et al. | The complete mitochondrial genome of the hagfish Myxine glutinosa: unique features of the control region | |
| US20240301445A1 (en) | Crispr-associated transposon systems and methods of using same | |
| US20240301371A1 (en) | Crispr-associated transposon systems and methods of using same | |
| CN114250241A (en) | One-step BsaI enzyme digestion connecting fragment assembling method, assembling kit and application | |
| CN116135982A (en) | Application method and kit for gene fragment ligation | |
| CN105154444A (en) | Asymmetric high-throughput sequencing linkers capable of effectively improving library construction efficiency, and application of linkers | |
| CN101709334B (en) | DNA molecular mark and application thereof of SXI inbred line mouse | |
| CN112176422A (en) | Construction method of RNA library | |
| US10066262B2 (en) | Methods for amplification of nucleic acids utilizing hairpin loop or duplex primers | |
| CN112359090A (en) | Nucleic acid fragment connection method, sequencing library construction method and application thereof | |
| CN111434771A (en) | Plasmid construction method for self-recombination of linearized vector | |
| CN102144031A (en) | DNA molecule for expressing hairpin RNA, the constructing method and the use thereof | |
| CN102559660A (en) | Method for preparing double-stranded deoxyribonucleic acid (DNA) molecule with protruding end | |
| CN101532181A (en) | Method and kit for in-situ construction of gene mutation library |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Open date: 20090812 |