CN102618504A - Bivalent vaccine for hemorrhagic fever with renal syndrome and its preparation method - Google Patents
Bivalent vaccine for hemorrhagic fever with renal syndrome and its preparation method Download PDFInfo
- Publication number
- CN102618504A CN102618504A CN2011104261717A CN201110426171A CN102618504A CN 102618504 A CN102618504 A CN 102618504A CN 2011104261717 A CN2011104261717 A CN 2011104261717A CN 201110426171 A CN201110426171 A CN 201110426171A CN 102618504 A CN102618504 A CN 102618504A
- Authority
- CN
- China
- Prior art keywords
- virus
- vaccine
- strain
- hfrs
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a vaccine for hemorrhagic fever with renal syndrome (HFRS) and its preparation method. The vaccine is an inactivated virus of Hantavirus HV004 strain, and the virus has a preservation number of: CCTCC No. v201139. The inactivated virus can effectively prevent and treat HFRS. In addition, the invention also discloses a bivalent vaccine consisting of inactivated virus HV004 and Hantavirus Hubei-I strains. Experiments show that the bivalent vaccine has significant effects in prevention and treatment of HFRS. The invention also provides a preparation method of the vaccine, and the method includes virus proliferation, inactivation, purification and other steps. The bivalent vaccine of the invention provides an effective approach to prevention and treatment of HFRS, and plays an important role in controlling prevalence of the disease.
Description
Technical field
The present invention relates to a kind of new Hantaan virus (Hantavirus), and, the invention still further relates to the preparation method of this vaccine by the bivalent vaccine of the hemorrhagic fever with renal syndrome of this virus preparation.
Background technology
Hemorrhagic fever with renal syndrome (hemorrhagic fever with renal syndrome; HFRS) be the disease of natural focus of propagating through rodent that causes by Hantaan virus (Hantaviruses), have provincialism, burst, periodically, the epidemic characteristic of volatility.China HFRS epidemic-stricken area from the eighties more than 600 counties and cities expand present more than 1300 counties and cities to, the epidemic-stricken area type also changes; Abroad, novel epidemic-stricken area is also constantly enlarging and is developing.The people falls ill through approach infective virus such as aerosol suction, wound, digestive tubes.This disease mortality ratio is high, and hazardness is big.China is that Hantaan virus infects the most serious country of influence, and in the past decade the HFRS case of annual report reaches 25,000 to 60,000 examples, accounts for more than 90% of world's number of the infected.Vaccine prevention is the means of at present unique effective control HFRS.After Korea S Lee pick Wang at first was separated to HFRS virus in 1978, China successively was separated to HFRS virus from 1981～1982 years in Apodemus agrarius and Rattus norvegicus body, and various places also are separated to many virus strain from different animal and human's bodies.Virus type in HFRS epidemic-stricken area is identified, be Chinese beach type (HTN type) epidemic-stricken area the eighties before, occurs soul type (SEO type) and amphitypy afterwards again and deposits, and reports again that Pu Mala type (PUU type) appearance was arranged in 2003.The success of virus is separated into developing vaccines and has established pacing items; The inactivated vaccine of China's approved production comprises hamster kidney cell vaccine (II type, SEOV, L99 strain), gerbil jird kidney cell vaccine (I type; HTNV; The Z10 strain), three kinds of univalent vaccines of purifying mouse brain cell vaccine (I type, HTNV, LR1 strain) and the Preliminary development success in succession of two valency (I, II type) gerbil jird kidney cell vaccines.The three phases clinical observation of these 4 kinds of vaccines plays an important role on control and control HFRS.Yet; The used virus of vaccine obtains from early stage separation, is example with I type HFRS vaccine seed culture of viruses Z10 and LR1, separates from the nineteen eighty-two HFRS of Zhejiang Province epidemic-stricken area patients serum and nineteen eighty-three being trapped in epidemic-stricken area, Shaanxi Province Apodemus agrarius lung tissue respectively; Whether suitable as vaccine strain virus; Proving that the genetic background of virus is also unclear, is not to be directed against HFRS popular advantage vaccine strain in recent years yet.
Hantaan virus belongs to the bunyaviridae Hantavirus; Its genome by big (L), in the RNA of (M), little (S) three sub-thread minus strands form; Difference coding RNA polymerase; Two envelope proteins (G1 and G2) and nucleoprotein (N), wherein maximum with the immune pressure from the HV infection host that the M gene is born, it is the most remarkable to make a variation.In veriform Hantaan virus, its S fragment 3 ' NCR region nucleotide sequence is except that the handle shape part, and rest part difference is also bigger.Hantaan virus very easily morphs, and exists between different types and the hypotype.If it is pathogenic change that variation causes virus virulence, then existing vaccine possibly lose the protectiveness effect, causes the continuous appearance and the expansion in new epidemic-stricken area, and the eruption and prevalence of HFRS occurs.In addition, more than the molecules fundamental research of these vaccine strain biological natures, as genome measure, analyze and with relatively the waiting of domestic strain sibship, all be after the clinical use of vaccine, just to carry out.The representativeness that these vaccine strains can be described is not strong; Therefore; Control that HFRS is popular just must to have enough knowledge with the rule and the essence that develop to HFRS is popular; The essence of the popular virus strain of advantage that simultaneously must the clear and definite epidemic peak phase just can be prepared and has more specific aim, preventive effect improved vaccine.
On the basis of the present invention's M gene expression characteristics of Hantaan virus in obtaining 1985～2000 years HFRS patient's bodies of Hubei province; Intend S, M fragment hypervariable region genovariation frequency and variant sites with mouse source, mite source and people source Hantaan virus in the period of the areas 1985～2009, the further analysis of the technology middle and lower reach of Yangtze River such as RT-PCR, nucleotide sequencing, thus the characteristic of the popular virus strain of advantage of clear and definite epidemic peak phase.On this basis, separate the popular virus strain of advantage and the large scale culturing that obtain the epidemic peak phase, finally obtain this regional representative hemorrhagic fever with renal syndrome vaccine strain.Then virus is carried out deactivation, ultrafiltration and concentrated; Through chromatography purification; Identify to obtain inactivated vaccine, and carry out effectiveness and the detection of other conventional projects and the evaluation of vaccine immunogenicity, security and protectiveness of vaccinogen liquid, vaccine, accomplish the preclinical study of production of vaccine.The present invention can be the scheme of preventing and treating of working out HFRS, and the development strategy of controlling the popular of this disease and Hantaan virus vaccine provides new theoretical foundation.
Summary of the invention
The object of the present invention is to provide a kind of novel Hantaan virus, and prepare inactivated vaccine, be used for the control of hemorrhagic fever with renal syndrome by this virus.
Another object of the present invention is to provide a kind of bivalent vaccine that comprises above-mentioned Hantaan virus.
A further object of the present invention is to provide the preparation method of above-mentioned vaccine.
The inventor is through gathering from area, the middle and lower reach of Yangtze River Hantaan virus sample in 1985～2009 years mouse sources, mite source, people source; Its S, M gene are carried out nucleotide sequence analysis; Obtain Hantaan virus genovariation situation; Further screen the virus vaccine strain HV004 that gains the upper hand, this virus (is called for short CGMCC, address: Lopa Nationality an ancient woman's ornament mountain, wuchang, wuhan postcode: 430072) preservation on December 7th, 2011 at China typical culture collection center; Classification called after Hantavirus (Hantavirus) Chinese beach type, preserving number is CCTCC No.v201139.
And then the present invention provides a kind of hemorrhagic fever with renal syndrome vaccine that is made by above-mentioned virus.This vaccine can be to be made by above-mentioned inactivation of virus, can add adjuvant in addition, and aluminium adjuvant for example is with the enhancing immunity effect.
In addition, above-mentioned virus can also be processed two valencys or polyvalent vaccine with other virus, for example, above-mentioned viral HV004 and the strain of Hantaan virus Hubei-I is prepared into bivalent vaccine.
Vaccine of the present invention can prepare according to ordinary method, for example, with said virus host cell or the tissue in the increment, gather in the crops viral liquid after, through the deactivation purification process, promptly get.With the univalent vaccine is example, and above-mentioned virus is gone down to posterity in the SMB continuous tissue, and results morbidity mouse brain grinds to form homogenate, through the deactivation purification process, promptly gets.Particularly, after the mouse brain of will falling ill grinds to form homogenate, get reset and add morbidity mouse brain ground to form homogenate after; Get and reset and add protamine sulfate (final concentration is 1mg/ml); Through the centrifugal 2.5h of sucrose density gradient band centrifugation 110,000 g, be taken at bright band between 30% and 45% and 45% and 60%, with dropwise adding 10%W/V BPL; Making its ultimate density is 1/4000; Add 10%V/V Al (OH) 3 colloid adjuvants, Hantaan virus is the 1:128 dilution by the antigen amount, and total protein content is no more than 40 μ g/ agent.The preparation and the univalent vaccine of bivalent vaccine are similar, when obtaining viral liquid, both are mixed, and continue to handle getting final product again.Particularly, above-mentioned two kinds of viruses are gone down to posterity in the SMB continuous tissue respectively, after the mouse brain of will falling ill respectively grinds to form homogenate; Get reset and add morbidity mouse brain ground to form homogenate after, get and reset and add protamine sulfate (final concentration is 1mg/ml), through the centrifugal 2.5h of sucrose density gradient band centrifugation 110,000 g; Be taken at bright band between 30% and 45% and 45% and 60%; With dropwise adding 10%W/V BPL, making its ultimate density is 1/4000, adds 10%V/V Al (OH)
3The colloid adjuvant, Hantaan virus is the 1:128 dilution by the antigen amount, total protein content is no more than 40 μ g/ agent.
The present invention has following advantage:
(1) the present invention carries out nucleotide sequence analysis through S, M gene to the Hantaan virus sample in 1985～2009 years mouse sources, middle and lower reach of Yangtze River area, mite source, people source, on this basis, has obtained this ground gene characteristic.The Hantaan virus vaccine strain of being established among the present invention is the strain that on the basis of existing strain sequence, obtains, and is representative.
(2) the present invention has established area, middle and lower reach of Yangtze River Hantaan virus advantage epidemic strain through the analysis to virogene, makes the selection of vaccine strain virus more targeted than the traditional vaccine strain.
(3) among the present invention the advantage epidemic strain is carried out separation and Culture, increase poison, purifying at the suckling mouse interior generation, the beta-propiolactone deactivation has finally obtained the vaccine that is applicable to that HFRS prevents.
Description of drawings
What Fig. 1 showed is that ELISA detects not the level of serological specificity IgG antibody on the same group;
Fig. 2 shows is on the same group mouse spleen cytositimulation rate not;
What Fig. 3,4 showed is that streaming detects IFN-coloration result in the born of the same parents.
Embodiment
Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.If do not specialize, biochemical reagents used among the embodiment are the commercial reagent, the conventional means that used technique means is well known to those skilled in the art among the embodiment.
Acquisition and the evaluation of embodiment 1 Hantaan virus (Hantavirus) HV004
1, virus collection and order-checking
(1) collects 1985～2009 years mouse lung tissues in area, the middle and lower reach of Yangtze River, mite matchmaker suspension, HFRS patient's blood specimen.
(2) this regional mouse lung tissue, mite matchmaker suspension, HFRS patient's blood specimen are carried out indirect immunofluorescence (Indirect immunofluorescence; IFA), EUSA (Enzyme-linked immunosorbent assay; EILSA), (Reverse transcriptase-polymerase chain reaction; RT-PCR) method detects, the virus antigen positive sample in screening mouse source, mite source, people source.Wherein the RT-PCR screening process is following: extract test kit (Promega) with virus-specific RNA and extract the total RNA of sample; The foranalysis of nucleic acids appearance detects rna content, all sample RNA OD260/280 >=1.9, after get 50ng RNA and carry out the RT-PCR reaction; Use the random primer rt, its reaction conditions is 37oC reaction 60min, and 93oC 5min termination reaction is put cooled on ice 3min rapidly; The novel Hantaan virus universal primer of PCR use design (sequence 5 '-3 ' GATTGAAGATATTGAGTCACC, P1/ 5 '-3 ' GTTGTATCCCCATTGATTGTG, P2); Its reaction conditions is the preparatory sex change 3min of 94oC; 94oC sex change 1min, 50oC renaturation 1min, 72oC extends 1min; Circulate 35 times, last 72oC extends 5min; 1.5% agarose gel electrophoresis is observed the viral nucleic acid amplification.Cutting-out contains the segmental gel of purpose, adopts Omega gel Extraction kit (Omega) to reclaim DNA, and the DNA behind the purifying is dissolved in ddH
2Among the O.The order-checking of the PCR product behind the purifying is transferred to INVITROGEN company (Shanghai) and is accomplished, and the sequencing primer is the PCR primer.
2, confirm Hantaan virus advantage strain
624 parts of humanizeds have been accomplished, 896 parts of mouse source property samples, the extraction of the RNA of 3829 parts of mite matchmaker samples and the screening operation of positive sample.Obtain 537 parts of humanized's Hantaan virus positive samples, 58 parts of mouse source property Hantaan virus positive samples detect viral RNA in the mite body.Detailed content is following:
(1) from the HFRS patients serum, filters out positive sample altogether: from 624 parts of HFRS patients serums, filter out 537 parts of positive samples altogether, obtain Hantaan virus S, M fragment sequence.The somatotype of having accomplished area, middle reaches, 166 parts of the Changjiang river HFRS patient's positive sample detects; Obtained the sequence results of 74 parts of people source samples.To existing viral oncogene homolog property analysis, the result shows that the viral existing HTN C-type virus C of area, middle and lower reach of Yangtze River HFRS outburst also has the SEO C-type virus C.The former with 76-118 strain homology be main, the latter is main with the virus similar with the Z37 strain.
(2) filter out positive sample in the mouse sample: from 687 property samples, filter out positive sample 45 positive rates 6.5%.Obtained the sequencing result of 206 parts of mouse source samples, and carried out virus and host gene homology analysis, the result shows that area, the middle and lower reach of Yangtze River the popular of Hantaan virus is main with SEO type and HTN type still at present, and tangible regional aggregation is arranged.Virus is carried out the evolutionary tree analysis find and can the SEO C-type virus C that we obtain be divided into three evolution branches that they have higher homology up to 96%～100% with the Z37 strain.It is more various that HTN type Hantaan virus gene changes, and they and Q32 and 76-118 strain have higher homology to be respectively 83.9 ~ 84.4% and 89.0 ~ 89.2%.In the mouse body, separate Hantaan virus S, the analysis of M gene order systematic evolution tree.
3, the advantage virus vaccine strain separates and identifies
(1) gets about 0.3 g of positive sample Apodemus agrarius mouse lung of Hantaan virus under the aseptic condition, add 3 m l lapping liquids (DMEM that contains 1% PS) grind to form 1:10 on ice suspension.Draw the 0.02ml suspension, be expelled in the BALB/C mouse brain of 2～3 ages in days; The normal raising 21 days or the aseptic heart, brain, lung, the nephridial tissue of getting mouse in morbidity back; After the RT-PCR test positive; The tissue homogenate of requiring mental skill is received in the newborn SMB again, carries out 8 generations amplifications with such method, cores, brain, lung, kidney etc. are organized in-80 ℃ of preservations.
(2) be seeded in Vero E6 cell with containing the virus tissue in the b step by getting 100 μ L after substratum stoste (1:1000) homogenate simultaneously, after 3 generations, through the IFA test positive, nucleic acid is identified and also is the HV004 genotype at blind passage on the Vero E6 cell.
(3) to HV004 virus strain sequencing and phylogenetic analysis:
Part S sheet 611nt (558-1168nt) and M fragment 1353nt (51-1404nt) are increased, and carried out homology analysis.The base of M fragment and other HTN type Hantaan virus and the amino acid identity of deduction are respectively 82.8%-90.6% and 92.6%-97.6%, and are lower than 70% with the base homology of the Hantaan virus of other types.Through the segmental analysis of part S, also can obtain similar result.The evolution branch of S, two genes of M is new independent branch, i.e. a HTNV-#10.The homology of this isolating virus of above presentation of results and HTN type Hantaan virus is higher, belongs to HTNV type Hantaan virus.Analyze the molecular characterization of HV004, and it can increase poison at Vero E6 cell and suckling mouse interior generation, explain that HV004 is applicable to preparing the hemorrhagic fever with renal syndrome inactivated vaccine.This virus (is called for short CGMCC on December 7th, 2011 at China typical culture collection center; Address: Lopa Nationality an ancient woman's ornament mountain, wuchang, wuhan postcode: 430072) preservation; Classification called after Hantaan virus (Hantavirus) HV004, preserving number is CCTCC No.v201139.
The preparation of embodiment 2 virus vacciness
1, the preparation of univalent vaccine
(1) HV004 was passed for 8 generations through BALB/C SMB continuous tissue, results morbidity mouse brain grinds to form homogenate, adds protamine sulfate (final concentration is 1mg/ml), tentatively removes tissue DNA, and foreign DNA content is not more than 10ng/ dosage.
(2), be taken at bright band between 30% and 45% and 45% and 60%, the purified virus particle through the centrifugal 2.5h of sucrose density gradient band centrifugation 110,000 g.Virus titer is 6.5 lgCCID50/ml; Bacterioscopy and mycoplasma inspection are negative, and adopting the IFA method to measure virus titer is 1:1024.
(3) transfer purified virus stoste pH to 7.4 with 2%V/V HEPES 1mol/L pH7.5 and 0.14%W/V NaHCO3 at 4 ℃, dropwise add 10%W/V BPL, making its ultimate density is 1/4000.Deactivation 24h again through 37 ℃ of hydrolysis 2 hours, puts 2～8 ℃ of preservations with the viral liquid of deactivation, should be no more than 30 (15 days).It is negative to do virus virulence answer experiment simultaneously.
(4) measure protein content >=200ug/ml, it is 1:4096 that ELISA measures the antigen amount.
(5) Hantaan virus is 1:128 dilution in the antigen amount: autoclaved Al (OH) 3 is added by 10% ratio concentrate, in the viral liquid behind the purifying, and be prepared into Al (OH) in the ratio adding Sodium Mercurothiolate of 0.02% (W/V)
3Adjuvant inactivated vaccine.And total protein content is no more than 40 μ g/ agent.
2, the preparation of polyvalent vaccine
Method is with the preparation of univalent vaccine, and is specific as follows:
(1) during the preparation of II C-type virus C strain Hubei-I strain (SEO type) with the HV004 virus strain.
(2) titration of virus: virus titer is 6.5 lgCCID50/ml; Bacterioscopy and mycoplasma inspection are negative, and adopting the IFA method to measure virus antigen is 1:1024.
(3) transfer purified virus stoste pH to 7.4 with 2%V/V HEPES 1mol/L pH7.5 and 0.14%W/V NaHCO3 at 4 ℃, dropwise add 10%W/V BPL, making its ultimate density is 1/4000.Deactivation 24h again through 37 ℃ of hydrolysis 2 hours, puts 2～8 ℃ of preservations with the viral liquid of deactivation, should be no more than 30 (15 days).It is negative to do virus virulence answer experiment simultaneously.
(4) measure protein content >=200ug/ml, it is 1:4096 that ELISA measures the antigen amount.
(5) be 1:128 dilution back balanced mix by the antigen amount respectively with I type and II type Hantaan virus unit price stoste, and total protein content is no more than 40 μ g/ agent content 10%Al (OH), 3 adjuvants and is vaccine.
Below be that example elaborates with the univalent vaccine:
1, vaccine safety experiment
(1) animal allergic experiment research
Sample thief 10ml, simultaneously with calf serum as contrast, three cavys of subcutaneous vaccination, cavy is selected for use between the 250-350g.Every inoculation 1ml carries out the injection second time at interval after the week, every subcutaneous 1 ml makes cavy sensitization, and sensitization three Zhou Houzai observe cavy and do not have the anaphylaxis appearance with every 0.5ml of same sample intravenous injection.
(2) undue toxicity experiment
Abnormal toxicity test should carry out Balb/C and two kinds of animal experiments of cavy, and experimental animal should reach the cleaning rank.Mouse is selected body weight 18-22g for use, and cavy is selected for use between the 250-350g.Take by weighing the body weight of mouse and cavy before the injection respectively, every mouse 0.5ml inspection article, every 5.0ml of cavy observes body weight variation in 7 days and does not have than big difference with normal group.
2, vaccine immunity property experiment
Inoculation method: in 0,7,14,21d is subcutaneous give 1. normal control group pbs organize 2. high dosage vaccine group (10ug/ml) 3. in 4. low dosage vaccine group (2.5ug/ml) of dosage vaccine group (5ug/ml).Detected cellular immunization and humoral immunity level in the 60th day:
(1) ELISA detects the level of serological specificity IgG antibody.The OD value high dose group that under 490nm, reads apparently higher than PBS group and significant difference (
p<0.001), low dose group and PBS group no significant difference (
P>0.05) (see figure 1).
(2) the aseptic sense mouse spleen conventional method of getting prepares the SPL suspension.RPMI-1640 nutrient solution adjustment cell concn to contain 10% foetal calf serum is 2 * 10
6/ ml; Add in the 96 porocyte culture plates, 100 μ l/ holes, every group of each sample done six multiple holes; First three every hole, multiple hole adds the RPMI-1640 nutrient solution 100 μ l that contain 10% foetal calf serum; As control group, every hole, back three multiple holes adds the RPMI-1640 nutrient solution 100 μ l holes of the foetal calf serum that contains 5 μ g/ml canavalines and 10%, as test holes.Put 37 ℃, 5%CO
2Incubator is cultivated 48 h, stop to cultivate the MTT that added 20 μ l/ holes in preceding 4 hours, and the mixing continued is cultivated behind 4 h centrifugal, abandons supernatant.Every hole adds the DMSO of 100 μ l, under the wavelength of ELIASA 490 nm, detects the absorbance (OD value) in its every hole behind the vibration mixing.The splenocyte appreciation rate is represented with SR (SI): SI=test holes OD average/control wells OD average.Figure two be depicted as high dose group SI greater than PBS group (
p<0.01).
(3) IFN-dyeing in the born of the same parents: take out inguinal lymph nodes in the different immune group animal bodies and spleen is processed single cell suspension (effect T cell).From the negative control mouse separating spleen cell of background of the same race, infect Hantaan virus to be used as target cell.Estimate the T cellullar immunologic response with r Interferon, rabbit dyeing in lymphocyte stimulation test and the born of the same parents.Table one is depicted as not on the same group the CD3+CD8+ positive T cell very.* represent high dose group CD3+CD8+T cell be higher than PBS group (
p<0.05).
Table 1 is CD3+CD8+ positive T cell % on the same group not
| Group | CD3+CD8+ (%) |
| The PBS group | 8.11 ± 0.20 |
| High dose group | 13.08 ± 0.85* |
| Middle dose groups | 11.63 ± 1.89 |
| Low dose group | 11.36 ± 1.31 |
| The virus group | 12.21 ± 0.74 |
Shown in Figure 2 is that IFN-dyes in each group born of the same parents.In the born of the same parents IFN-dyeing high dose group greater than the PBS group (
p<0.05).
3, vaccine protective property experiment
Method: according to above-mentioned experiment, attacked poison in the 28th day, dosage is 5LD50 76-118 strain abdominal injection 100ul.Observed 28 days, and observed mouse changes of weight and death condition.Attack and respectively organize the mouse body weight behind the poison and all have and alleviate, immune group mouse body weight in one week the back alleviate.Virus group mouse had 3 (3/12) to take place in the 22nd day dead, and mortality ratio is 25%.All the other each groups do not see that death condition, dead protection ratio are 100%.
Bivalent vaccine has also been done similar experiment, and the result shows it and obtained similar protection effect.
Sequence table
< 110>Wuhan University
< 120>a kind of hemorrhagic fever with renal syndrome bivalent vaccine and preparation method thereof
<130>
<160> 2
<170> PatentIn?version?3.5
<210> 1
<211> 21
<212> DNA
< 213>artificial sequence
<400> 1
gattgaagat?attgagtcac?c 21
<210> 2
<211> 21
<212> DNA
< 213>artificial sequence
<400> 2
gttgtatccc?cattgattgt?g 21
Claims (9)
- Hantaan virus ( Hantaviruses) the HV004 strain, its preserving number is: CCTCC No. v201139.
- 2. the application of the said virus of claim 1 in preparation hemorrhagic fever with renal syndrome vaccine.
- 3. the vaccine of the said virus preparation of claim 1.
- 4. vaccine according to claim 3, it comprises described inactivation of viruses HV004 of claim 1 and adjuvant.
- 5. bivalent vaccine, it comprises described inactivation of viruses HV004 of claim 1 and the strain of Hantaan virus Hubei-I.
- 6. a method for preparing claim 3 or 4 said vaccines is characterized in that, the said virus of claim 1 is gone down to posterity in the SMB continuous tissue, gathers in the crops for 8 generations with interior morbidity mouse brain, grinds to form homogenate, through the deactivation purification process, promptly gets.
- 7. method according to claim 6 is characterized in that, after the mouse brain of will falling ill grinds to form homogenate; Get that to reset and add protamine sulfate to final concentration be 1mg/ml; Through the centrifugal 2.5h of sucrose density gradient band centrifugation 110,000 g, be taken at bright band between 30% and 45% and 45% and 60%, with dropwise adding 10%W/V BPL; Making its ultimate density is 1/4000, adds 10%V/V Al (OH) 3The colloid adjuvant.
- 8. a method for preparing the said bivalent vaccine of claim 5 is characterized in that, with the said virus of claim 1 with go down to posterity in the SMB continuous tissue respectively, results morbidity mouse brain grinds to form homogenate, and balanced mix through the deactivation purification process, promptly gets.
- 9. method according to claim 8 is characterized in that, after the mouse brain of will falling ill grinds to form homogenate; Get that to reset and add protamine sulfate to final concentration be 1mg/ml; Through the centrifugal 2.5h of sucrose density gradient band centrifugation 110,000 g, be taken at bright band between 30% and 45% and 45% and 60%, with dropwise adding 10%W/V BPL; Making its ultimate density is 1/4000, adds 10%V/V Al (OH) 3The colloid adjuvant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110426171.7A CN102618504B (en) | 2011-12-19 | 2011-12-19 | Bivalent vaccine for hemorrhagic fever with renal syndrome and its preparation method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110426171.7A CN102618504B (en) | 2011-12-19 | 2011-12-19 | Bivalent vaccine for hemorrhagic fever with renal syndrome and its preparation method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102618504A true CN102618504A (en) | 2012-08-01 |
| CN102618504B CN102618504B (en) | 2014-02-05 |
Family
ID=46558716
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110426171.7A Expired - Fee Related CN102618504B (en) | 2011-12-19 | 2011-12-19 | Bivalent vaccine for hemorrhagic fever with renal syndrome and its preparation method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102618504B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114561362A (en) * | 2021-12-28 | 2022-05-31 | 江西省疾病预防控制中心 | Separation method of hantavirus with hemorrhagic fever with human renal syndrome |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1650013A (en) * | 2002-03-22 | 2005-08-03 | 美国传染性疾病军医研究所 | DNA vaccines against hantavirus infections |
| CN101249261A (en) * | 2008-03-18 | 2008-08-27 | 中国疾病预防控制中心病毒病预防控制所 | Kidney syndrome hemorrhagic fever mucosa immune vaccines and method of preparing the same |
-
2011
- 2011-12-19 CN CN201110426171.7A patent/CN102618504B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1650013A (en) * | 2002-03-22 | 2005-08-03 | 美国传染性疾病军医研究所 | DNA vaccines against hantavirus infections |
| CN101249261A (en) * | 2008-03-18 | 2008-08-27 | 中国疾病预防控制中心病毒病预防控制所 | Kidney syndrome hemorrhagic fever mucosa immune vaccines and method of preparing the same |
Non-Patent Citations (2)
| Title |
|---|
| JING LIU ET AL: "Genetic analysis of hantaviruses and their rodent hosts in central south China", 《VIRUS RESEARCH》 * |
| 魏光伟 等: "汉坦病毒疫苗研究进展", 《中国畜牧兽医》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114561362A (en) * | 2021-12-28 | 2022-05-31 | 江西省疾病预防控制中心 | Separation method of hantavirus with hemorrhagic fever with human renal syndrome |
| CN114561362B (en) * | 2021-12-28 | 2023-12-15 | 江西省疾病预防控制中心 | Separation method of human-derived kidney syndrome hemorrhagic fever Hantaan virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102618504B (en) | 2014-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106497890B (en) | A kind of XF-1 plants of porcine pseudorabies virus variant and preparation method and application | |
| CN104099301B (en) | Coxsackie virus A16 type virus strain, application, vaccine and preparation method thereof | |
| CN110117576B (en) | Duck adenovirus type-3 virus strain and preparation and application of yolk antibody thereof | |
| CN112500458B (en) | Novel variant subunit vaccine of chicken infectious bursal disease virus, preparation method and application thereof | |
| CN109536460A (en) | A kind of CV-A10 virus seed culture of viruses and its inactivated vaccine for human | |
| CN109136198A (en) | A kind of expression Chicken Infectious Anemia Virus VP1, VP2 genetic recombination bird pox virus live vector vaccine | |
| CN110680912B (en) | H3N2 and H3N8 subtype canine influenza bivalent inactivated vaccine as well as preparation method and application thereof | |
| CN111057682B (en) | Avian H9N2 subtype avian influenza strain separation identification and application | |
| CN104611299B (en) | H9N2 avian flus strain, preparation method, vaccine combination and its application of a kind of artificial recombination | |
| CN102580079A (en) | Porcine parvovirus nanometer alumina gel adjuvant inactivated vaccine and preparation method thereof | |
| CN112063596A (en) | Pigeon paramyxovirus type 1 PPMV-1/BJ-C strain and application thereof | |
| CN104419686A (en) | Recombinant prrs virus hv-nsp9 and application thereof | |
| CN107893056B (en) | I type vaccine strain of bovid herpesvirus 5 and its application | |
| CN102805862A (en) | Preparation method for SFTS bunyavirus purification and inactivation vaccines through VERO cell culture | |
| CN102618504B (en) | Bivalent vaccine for hemorrhagic fever with renal syndrome and its preparation method | |
| CN107287168A (en) | A kind of NDV saves method and its application | |
| CN102181406A (en) | Recombinant adenovirus, dendritic cell (DC) modified by recombinant adenovirus and application of recombinant adenovirus and DC | |
| CN109797139A (en) | 3 type duck hepatitis A virus low virulent strain CH-P60 of one kind and its application | |
| CN102218139A (en) | Medicament for treating and/or preventing viral infection | |
| CN108707589B (en) | Bovine viral diarrhea virus SMU-Z6/1a/SC/2016 isolate and application thereof | |
| CN113736749A (en) | Avian influenza virus strain and application thereof | |
| CN105218679A (en) | Human metapneumovirus multi-epitope antigen and application thereof | |
| CN107686833B (en) | Porcine parvovirus strain and application thereof | |
| CN102140441B (en) | Bird flu vaccine by using attenuated vaccinia Tian Tan as vector | |
| CN107033227B (en) | A kind of erysipelothrix rhusiopathiae antigen albumen sbp and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140205 Termination date: 20151219 |
|
| EXPY | Termination of patent right or utility model |