CN102559675A - PsPR10P796 promoter and application thereof - Google Patents

Abstract

The invention discloses a PsPR10P796 promoter, a DNA construct, a vector, recombinant cells, a plant callus or a plant, and application of the PsPR10P796 promoter in plant stress resistance gene engineering. The promoter contains any one of the following groups of nucleotide sequences: (a) nucleotide sequence shown in SEQ. ID. NO.1; and (b) sequence complementary to the sequence shows in SEQ. ID. NO.1. The PsPR10P796 promoter of the invention has high root specific induced expression activity and can enhance the root specific transcription level of downstream stress resistance gene, so as to enhance the stress resistance capacity of transgenic plants.

Description

A kind of PsPR10P796 promotor and application thereof

(1) technical field

The present invention relates to a kind of promotor and application thereof, particularly a kind of PsPR10P796 promotor and application thereof.

(2) background technology

Promotor is that DNA goes up the zone that combines RNA polymerase and form the transcription initiation mixture.Foreign gene relies on the regulating and controlling effect of promotor to it in the intravital expression of genetically modified crops, and the expression amount deficiency often can not get desirable transgenic plant.Therefore, selecting suitable plant promoter is to strengthen the exogenous gene expression matter of utmost importance.The genetic expression scope of controlling according to promotor is different with mode, and promotor can be divided into constitutive promoter and specificity promoter.Under the control of composition type expression promoter, foreign gene all can be expressed with all etap at all sites of transgenic plant.Foreign gene continues in plant, expresses efficiently and not only cause waste, causes that toward the contact meeting form of plant changes, and influences the g and D of plant.For foreign gene is effectively played a role in plant materials, can reduce disadvantageous effect again simultaneously to plant, people more and more pay attention to the research of specificity promoter in recent years.Along with updating of roots of plants specific expressing promoter research; Some roots of plants different expression gene and enhancement sequences have been separated at present; Thereby these sequences can be in the expression of root specificity or priority activation promotor gene; The cis-acting elements that exists responsible root-specific to express in the promotor is induced by foeign element or specific protein is regulated and control, and comprises tissue-specific promoter and abduction delivering type promotor.For example from the gp that is rich in oxyproline (HRGP) gene of tobacco; But although the very low root-specific of its expression level; In tobacco lateral root induction process; Its promotor performance short period of time enlivens in pericycle and endodermis, and is particularly active strong in the later stage root generation histocyte, belongs to tissue-specific promoter.

Abduction delivering is meant that vegetable cell is owing to the variation of environment causes Expression of Related Genes.Exist a cover defense mechanism in the plant materials and tackle poor environment, in this process, the environmental induction gene promoter plays a part crucial.Root absorbs moisture and nutrient for plant from soil, keep normal growth and have vital role.Under environment-stress; Affected at first organ is a root tissue, if root induction type specificity promoter is applied to make resistant gene specifically expressing in root cell in the plant stress resistance gene engineering; So just can reduce energy expenditure; The render transgenic plant does not influence normally again and grows when obtaining resistance, and genetically engineered degeneration-resistant, disease-resistant worm is had crucial meaning.

(3) summary of the invention

The object of the invention provides a kind ofly can regulate and control the efficient specifically expressing of goal gene in the PsPR10P796 of plant roots tissue promotor, and is applied to the plant stress-resistance genetically engineered.

The technical scheme that the present invention adopts is:

A kind of PsPR10P796 promotor, said promotor contain the nucleotide sequence shown in following any one group of nucleotide sequence: a, the SEQ.ID.NO.1; B, with SEQ.ID.NO.1 shown in nucleotide sequence complementary sequence; The present invention does not get rid of replacement, disappearance or the modified nucleotide sequences of above-mentioned a or the said sequence of b being carried out one or more bases yet; Or the nucleotide sequence that has at least 90% homology with above-mentioned a or the said sequence of b.

Further, described PsPR10P796 promotor is preferably the promotor that contains the nucleotide sequence shown in the SEQ.ID.NO.1.

The gene order that a kind of DNA construct, said DNA construct comprise described PsPR10P796 promotor and carry out with it being operatively connected.

A kind of carrier, said carrier contain described promotor or described DNA construct.

A kind of reconstitution cell, described reconstitution cell comprise described promotor or described DNA construct or described carrier.

Further, described reconstitution cell is preferably recombinant Bacillus coli cells or reorganization agrobatcerium cell.

A kind of plant callus or plant that contains described promotor or described DNA construct or described carrier or said reconstitution cell.

Further, described plant callus or plant optimization are tobacco.

The application of described PsPR10P796 promotor in the plant stress-resistance genetically engineered.

Further; Described PsPR10P796 promotor is applied as the PsPR10P796 promotor in the application in antireversal gene tobocco in the plant stress-resistance genetically engineered; Adversity gene is placed PsPR10P796 promotor downstream; Make up plant expression vector, carrier is imported tobacco, obtain antireversal gene tobocco.

Promotor nucleotide sequence provided by the invention is from America east white pine (Pinus strobus).

The present invention utilizes homologous clone and RACE technology to obtain America east white pine PsPR10 upstream region of gene 796bp sequence promotor; Its Nucleotide is shown in SEQ.ID.NO.1; Concrete grammar is following: the present invention extracts DNA from the east white pine root of America; According to other plant PR10 upstream region of gene dna sequence dna of having issued in the international gene pool (GenBank), the design primer, sequence is following:

F1：AAAAGCTTCTCGAGATGACTCTT

R1：CATTTTCAACTCTCT?CGCAACTA

Utilize above-mentioned primer to carry out conventional polymerase chain reaction (PCR).The PCR product is connected transformed into escherichia coli DH5 α competent cell with cloning vector (pEASY-T), screens positive recombinant then, carry out the sequence order-checking, according to the sequences Design primer that obtains, primer sequence is following:

F796：AAAAGCTTGGTGATTACTCCAACAAAATC

R2： AAGGATCCCATTTTCAACTCTCTCGCAAC

With America east white pine root DNA is that template is carried out pcr amplification; The PCR product is connected transformed into escherichia coli DH5 α competent cell with cloning vector (pEASY-T), screens positive recombinant then, carry out the sequence order-checking; Obtain a 796bp promoter sequence, with this sequence called after PsPR10P796.

This promoter sequence SEQ.ID.NO.1 information is following:

Length: 796bp

Type: nucleic acid

Chain: two strands

Source: America east white pine (Pinus ttrobus)

-796GTGAT TACTCCAACA

-781AAATCTAATC?CATCAATAAA?AATGTACACA?AACTAATTTT?CATTTAATCT?TTTTCTGCCC

-721ATTTAATAAA?AAGATCAAAA?TTCTGGCAGC?CGAATATTTG?GTCTTTTGAA?CTTAACGAAT

-661ATATATATAT?CCACTGAAAA?GTCATTTTGA?AATATATGCA?TTCCACGGTA?GCGATGGCAC

-601GGCGTTGGTG?AATGTAGAAG?CCTTTGTAAG?CAATTTACGG?CGTCTTTGAC?ATTTGTGTAT

-541CTCTTCTAGA?TGGGTTAACA?ACACGGACTG?ACAAAACCGC?GGTGGTTAGG?GAAGTTAGAA

-481ACGATATTCA?TTGAAGGATC?AGCCTGTAAA?TAAATAAATA?AAAACAAATT?ATCCATTTCA

-421TGTCTTATCT?TGTTATCTGG?TCGTATCTAC?TCTTTGTCAT?TAATCGTCTC?TGAAAGTGGG

-361AACCGGAACC?GGAATCGTCT?CTTGTCATTA?GATGAGAAGA?GAAATAACAA?ATCACCATGG

-301GATCTAGAAA?CATCCATCCA?TTCCGTTTAT?TCAAAGTCAG?CACACACAGT?GGGGTCCGGG

-241GGATCGTTGT?CCTTTAGGAC?TTATCGAAAC?CAGGCATGGA?GCTCGGTATT?GTCGGCCACA

-181AAGGCCAAGG?GTTCAATAAG?AAAACCCAAG?TAGTTGGCAT?TATGTGCGTC?CATCGGTCAG

-121TCCAAATAAC?AAATAGTCAC?TTTCGAGTCT?CATGTCATTA?CCTACGCGCT?CTCTTTAATG

-61?TACAGATTTT?AAAGGTTTGT?AAACGACTAC?TATAAATACG?GGCTCGTCTA?GTGCAGTTGA

-1 GAACAAGGAG?CTTTGTGCGA?TAATATTGAA?GAAATATAAG?TATTGTGTAG?TTGCGAGAGA

60 GTTGAAAATG

Negative sign is represented promoter sequence among the promoter sequence SEQ.ID.NO.1, and the promotor downstream sequence represented in positive sign.

Compared with prior art; Beneficial effect of the present invention is mainly reflected in: the invention provides a kind of new PsPR10P796 promotor; It is active to have the different abduction delivering of higher Gent, can improve the different transcriptional level of downstream adversity gene Gent, thereby can strengthen the transgenic plant anti-adversity ability.

(4) description of drawings

Fig. 1 transgene tobacco receives the unlike signal molecule to induce back GUS ability to express under the PsPR10P796 promoters driven, and (A～B) is that T3 is for the control treatment transgene tobacco; (C～H) handle: NaCl, N.F,USP MANNITOL, polyoxyethylene glycol, dormin, jasmonic, Whitfield's ointment for the T3 transgene tobacco utilizes following signaling molecule respectively.

(5) embodiment

Below in conjunction with specific embodiment the present invention is described further, but protection scope of the present invention is not limited in this:

Based on this uncured tobacco fast growth, life cycle are short, the isolated culture regenerative power is strong and characteristics such as genetic transformation efficiency height, in following embodiment, be that example specifies the present invention with the tobacco.

Ammonia benzyl LB solid medium, LB solid medium, MS substratum, YEP substratum, MS liquid nutrient medium, presorting of MS substratum, MS minimum medium, MS root media, 1/2MS substratum and composition thereof are common practise.

Embodiment 1: the clone of the regulation and control efficient specifically expressing of goal gene east white pine PsPR10P796 promotor in the America of plant roots tissue

1.DNA extract: (TransGen Beijing) extracts America east white pine genomic dna, as template to utilize DNA of plants to extract test kit.

2.PR10 upstream region of gene dna sequence dna amplification

Utilize primers F 1:AAAAGCTTCTCGAGATGACTCTT and R1:CATTTTCAACTCTCT CGCAACTA to carry out pcr amplification; System is following: 10 * Buffer5 μ L; 10mmoL/L dNTP 2 μ L, each 25pmol of PCR primer, dna profiling 1 μ L (about 200ng); Taq enzyme 2U adds sterilization distilled water to 50 μ L.The PCR reactions step is: 94 ℃ of preparatory sex change 5min; 93 ℃ of sex change 30sec, 50 ℃ of annealing 30sec, 72 ℃ are extended 90sec, circulate 30 times; Last 72 ℃ are extended 10min.1% agarose gel electrophoresis, (TransGen Beijing) reclaims fragment to utilize glue to reclaim test kit; With the gained fragment be connected into the pEASY-T carrier (TransGen, Beijing), transformed into escherichia coli DH5 α competent cell (TransGen; Beijing), utilize ammonia benzyl LB solid medium screening positive recombinant then, the performing PCR of going forward side by side is identified; Carry out the sequence order-checking then, obtain a 1750bp sequence.

3.PsPR10P796 promotor obtains

Utilize primers F 796:AAAAGC TTG TGATTACTC CAACAAAAT C and R2:AAG GAT CCC ATT TTC AAC TCT CTC GCAAC to carry out pcr amplification; System is following: 10 * Buffer, 5 μ L; 10mmoL/L dNTP 2 μ L, each 25pmol of PCR primer, dna profiling 1 μ L (the 1750bp sequence that obtains with step 2 is a template); Taq enzyme 2U adds sterilization distilled water to 50 μ L.The PCR reactions step is: 94 ℃ of preparatory sex change 5min; 93 ℃ of sex change 30sec, 50 ℃ of annealing 30sec, 72 ℃ are extended 60sec, circulate 30 times; Last 72 ℃ are extended 10min.1% agarose gel electrophoresis, (TransGen Beijing) reclaims fragment to utilize glue to reclaim test kit; The gained fragment is connected into the pEASY-T carrier, and transformed into escherichia coli DH5 α competent cell utilizes the LB solid medium screening positive recombinant that contains 50mg/mL ammonia benzyl then; The performing PCR of going forward side by side is identified; Carry out the sequence order-checking then, obtain a 796bp sequence, called after PsPR10P796 promotor.

Embodiment 2: the structure of expression vector establishment and reconstitution cell:

(1) according to isolating PsPR10P796 promotor nucleotide sequence, the design primer:

Forward primer: 5 '-AA AAGCTTGGTGATTACTCCAACAAAATC-3 '

Drawing horizontal line partly is the HindIII restriction enzyme site

Reverse primer: 5 '-AA GGATCCCATTTTCAACTCTCTCGCAAC-3 '

Drawing horizontal line partly is BamH I restriction enzyme site

With this promotor total length order-checking plasmid is template, utilizes above-mentioned forward and reverse primer to carry out the PCR reaction.

(2) get step (1) PCR product 2 μ L and cloning vector pEASY-T (TransGen; Beijing) connect transformed into escherichia coli DH5 α competent cell (TransGen; Beijing), overnight cultures on the LB solid medium that contains kantlex (50mg/L) is screened positive recombinant then; Carry out PCR and identify, obtain positive intestinal bacteria.

(3) utilize plasmid extraction kit (TransGen; Beijing) extract the positive colibacillary plasmid that above-mentioned steps (2) obtains, plasmid is cut with HindIII and BamH I enzyme, be connected with the pBI121 expression vector of cutting with same restrictions enzyme enzyme; Connect product transformed into escherichia coli DH5 α competent cell; Overnight cultures on the LB solid medium that contains kantlex (50mg/L) is carried out PCR evaluation and plasmid enzyme restriction evaluation to the bacterium colony that grows then, obtains expression vector pBI121.

(4) get 5 μ l expression vector pBI121, add 200 μ l Agrobacterium competent cells (Agrobacterium tumefaciens), mixing; Ice bath 5min utilizes liquid nitrogen freezing 1min again, places 37 ℃ of water-bath incubation 5min, ice bath 2min then rapidly; Add 800 μ l YEB liquid nutrient mediums, at 28 ℃, 250r/min cultivates 4～5h; With pipettor nutrient solution is transferred to YEB solid medium (containing 100 μ g/ml Rifampins, 50 μ g/ml kantlex) surface, evenly coats whole flat board; Be inverted for 28 ℃ and cultivate 1～2d, can see mono-clonal, picking list bacterium colony extracts plasmid with micro-alkaline process, carries out PCR and enzyme and cuts detection, obtains the reorganization agrobatcerium cell.

Embodiment 3: the acquisition of transfer-gen plant

(1) this uncured tobacco (Nicotiana tabacum) seed is seeded in the MS substratum, and 25 ℃ are cultured to 5～6 leaf periods, subsequent use.

(2) the reorganization Agrobacterium of picking embodiment 2 acquisitions (carrying the single bacterium colony of Agrobacterium of recombinant plasmid) is inoculated in the YEP substratum that contains the 50mg/L kantlex; 28 ℃; 250rpm, shaking culture 48h are to the logarithmic growth later stage, and bacterium liquid is for use with 10 times of MS liquid nutrient medium dilutions.

(3) get the tobacco leaf that step (1) cultivates and cut into 5mm * 5mm fritter, place presorting of MS substratum, 28 ℃, illumination is 16h/d, and 2000Lux cultivates 2d in advance, obtains the tobacco leaf explant after the cultivation in advance.

(4) the tobacco leaf explant after the preparatory cultivation of step (3) is immersed 5～10min in above-mentioned steps (2) the bacterium liquid, blot unnecessary bacterium liquid with sterilization filter paper, change the MS minimum medium over to, the low light level, is cultivated 2d altogether by 28 ℃.

(5) the tobacco leaf explant after step (4) is cultivated altogether with the MS substratum washing that contains penbritin 250mg/L 1 time, blots with filter paper earlier with the sterilized water washing that contains penbritin 250mg/L 3 times more then; Change over to and contain kantlex 100mg/L, on the MS substratum of penbritin 250mg/L, 25 ℃ of constant temperature culture are when bud grows to 1cm; After downcutting bud, bud changed over to contain kantlex 50mg/L, in the MS root media of penbritin 250mg/L; Cultivate hestening rooting for 25 ℃, after taking root, move in the flowerpot of sterile soil; Cultivate the receipts seed for 25 ℃ in the greenhouse, obtain T1, T2 and T3 for the transgene tobacco seed.

(6) evaluation of transgenic positive plant: the T1, T2 and the T3 that obtain in the step (5) is first with 70% ethanol disinfection, 30～60s for the transgene tobacco seed, and 10% Youxiaolin sterilization 15min is with aqua sterilisa rinsing at least 4 times; Remove the agar of most water adding 0.2%, seed is evenly distributed to 1/2MS substratum (containing the 50mg/L kantlex) surface; Change in the illumination box and cultivated 10 days, leaf color is positive seedling (a tobacco transgenic positive plant) for green seedling, and extracts tobacco transgenic positive plant leaf genomic dna, the transgenic positive plant that utilizes the PCR checking to obtain.

Embodiment 4: promotor improves root genetic expression capability analysis

The T3 that the foregoing description 3 is obtained places NaCl (200mM) respectively for tobacco transgenic positive plant; Under N.F,USP MANNITOL (300mM) and polyoxyethylene glycol (15%) stress conditions; Or foliage spray Whitfield's ointment (5mM); Dormin (100 μ M) and jasmonic (100 μ M), and handle as contrasting with corresponding sterilized water.After 24 hours, GUS dyeing detects PsPR10P796 promotor downstream gus gene expression activity in the transgene tobacco, and the result sees Fig. 1, and (A～B) is that T3 is for the control treatment transgene tobacco; (C～H) T3 utilizes following signaling molecule to handle respectively for transgene tobacco: NaCl, N.F,USP MANNITOL, polyoxyethylene glycol, dormin, jasmonic, Whitfield's ointment.Induce experiment through above stress-inducing and signaling molecule, find that the PsPR10P796 promotor can activate downstream gus gene expression activity and significantly raise, reach 1200pM mg ^-1Min ^-1, explain that the PsPR10P796 promotor has the different abduction delivering ability of higher Gent.This gene can rice transformation etc. farm crop, improve it and anti-ly coerce ability, have great economy and social value.

SEQUENCE?LISTING

 

< 110>Hangzhou Pedagogic University

 

< 120>a kind of PsPR10P796 promotor and application thereof

 

<130>

 

<160> 1

 

<170> PatentIn?version?3.4

 

<210> 1

<211> 796

<212> DNA

<213> Unknown

 

<220>

<223> PsPR10P796

 

<400> 1

gtgattactc?caacaaaatc?taatccatca?ataaaaatgt?acacaaacta?attttcattt 60

 

aatctttttc?tgcccattta?ataaaaagat?caaaattctg?gcagccgaat?atttggtctt 120

 

ttgaacttaa?cgaatatata?tatatccact?gaaaagtcat?tttgaaatat?atgcattcca 180

 

cggtagcgat?ggcacggcgt?tggtgaatgt?agaagccttt?gtaagcaatt?tacggcgtct 240

 

ttgacatttg?tgtatctctt?ctagatgggt?taacaacacg?gactgacaaa?accgcggtgg 300

 

ttagggaagt?tagaaacgat?attcattgaa?ggatcagcct?gtaaataaat?aaataaaaac 360

 

aaattatcca?tttcatgtct?tatcttgtta?tctggtcgta?tctactcttt?gtcattaatc 420

 

gtctctgaaa?gtgggaaccg?gaaccggaat?cgtctcttgt?cattagatga?gaagagaaat 480

 

aacaaatcac?catgggatct?agaaacatcc?atccattccg?tttattcaaa?gtcagcacac 540

 

acagtggggt?ccgggggatc?gttgtccttt?aggacttatc?gaaaccaggc?atggagctcg 600

 

gtattgtcgg?ccacaaaggc?caagggttca?ataagaaaac?ccaagtagtt?ggcattatgt 660

 

gcgtccatcg?gtcagtccaa?ataacaaata?gtcactttcg?agtctcatgt?cattacctac 720

 

gcgctctctt?taatgtacag?attttaaagg?tttgtaaacg?actactataa?atacgggctc 780

 

gtctagtgca?gttgag 796

Claims (10)

1. a PsPR10P796 promotor is characterized in that said promotor contains the nucleotide sequence shown in following any one group of nucleotide sequence: a, the SEQ.ID.NO.1; B, with SEQ.ID.NO.1 shown in nucleotide sequence complementary sequence.

2. PsPR10P796 promotor as claimed in claim 1 is characterized in that said promotor is the promotor that contains the nucleotide sequence shown in the SEQ.ID.NO.1.

3. a DNA construct is characterized in that the gene order that said DNA construct comprises the described PsPR10P796 promotor of claim 1 and carries out with it being operatively connected.

4. a carrier is characterized in that said carrier contains described promotor of claim 1 or the described DNA construct of claim 3.

5. a reconstitution cell is characterized in that described reconstitution cell comprises the described promotor of claim 1 or described DNA construct of claim 3 or the described carrier of claim 4.

6. reconstitution cell as claimed in claim 5 is characterized in that described reconstitution cell is recombinant Bacillus coli cells or reorganization agrobatcerium cell.

7. a plant callus or plant that contains claim 1 or 2 described promotors or the described DNA construct of claim 3 or described carrier of claim 4 or the said reconstitution cell of claim 5.

8. plant callus as claimed in claim 7 or plant are tobacco.

9. according to claim 1 or claim 2 the application of PsPR10P796 promotor in the plant stress-resistance genetically engineered.

10. the application of PsPR10P796 promotor as claimed in claim 9 in the plant stress-resistance genetically engineered; It is characterized in that the described PsPR10P796 of being applied as promotor is in the application in antireversal gene tobocco; Adversity gene is placed PsPR10P796 promotor downstream; Make up plant expression vector, carrier is imported tobacco, obtain antireversal gene tobocco.

Images