CN102559672A - Recombinant sea cucumber lysozyme N-terminal peptide, preparation method and application thereof - Google Patents

Abstract

The invention relates to recombinant expression for an N-terminal peptide of a lysozyme (SjLys) gene (GenBank registration number: EF036468) which is sourced from a sea cucumber (Stichopus japonicus). The recombinant expression comprises the following steps: first, establishing a recombinant expression plasmid pET-32a-SjLys-N; and then, transforming the recombinant expression plasmid into an escherichia coli Rosetta (DE3) pLysS cell, and thus obtaining a gene engineering bacterial strain capable of efficiently expressing the recombinant sea cucumber lysozyme N-terminal peptide. Through optimization of a fermentation medium and fermentation conditions, an expression product of the lysozyme N-terminal peptide prepared from the gene engineering bacterial strain has more than 50 percent of solubility and has a high product yield; the prepared recombinant sea cucumber lysozyme N-terminal peptide has a broad-spectrum antimicrobial activity; and especially, after the product is heated for 40min at the temperature of 100 DEG C, the antibacterial activity thereof is unchanged, which is very beneficial to the development of sea cucumber lysozyme polypeptide as a feed additive.

Description

A kind of recombinant sea cucumber antalzyme N end polypeptide, its preparation method and application

Technical field

The invention belongs to biological technical field, relate to the engineering bacteria preparation method that recombinant sea cucumber antalzyme N end polypeptide efficiently expresses, optimization for fermentation technology and obtain the soluble polypeptide product of high yield, and the product of preparation is carried out the research of broad spectrum antibiotic activity.

Background technology

N,O-Diacetylmuramidase is a kind of alkaline enzyme of ability hydrolysis mucopolysaccharide, and the hydrolysis of β-1,4 glycosidic link in its ability catalysis bacteria cell wall between mucopolysaccharide-acetylmuramic acid and the N-acetylglucosamine causes lysis, and content is overflowed and made bacterial death.It extensively is present in tissue, body fluid and the secretory product of nature plant-animal and mikrobe, in the immune defense system of living organism, plays a significant role.N,O-Diacetylmuramidase is widely used in industries such as medicine, food and feed at present as natural antiseptic-germicide, immunostimulant and sanitas.In recent years along with sea life fish, shrimps, shellfish and precious marine product, like the quick growth of cultured outputs such as sea cucumber, abalone, the consequent be during sea farming is produced quality deterioration, the breed level is low, disease is spread unchecked and problem such as environmental pollution.The problem of in aquaculture and Production of Livestock and Poultry, using microbiotic to bring at present also more and more receives people's attention; The one, the resistance problem; The 2nd, the drug residue problem; Its spinoff is very important, and people do not hope that to sacrifice human health be the raising that cost exchanges sea-food, animal products production performance for.Under this severe situation; The prominent position that advantage and the promoter action prophylactic treatment aspect of N,O-Diacetylmuramidase aspect animal cultivation shown it, its green, safety, non-harmful characteristics have been represented the direction of following fodder additives and animal health article.

Difference according to N,O-Diacetylmuramidase space structure, immunological characteristic and catalytic activity can be divided into 6 types usually: c-type (chicken-type) N,O-Diacetylmuramidase, g-type (goose-type) N,O-Diacetylmuramidase, i-type (invertebrate-type) N,O-Diacetylmuramidase; Plant-sourced (plant lysozyme) N,O-Diacetylmuramidase; Microbial source (bacterial lysozyme) N,O-Diacetylmuramidase; Phage (phage lysozyme) N,O-Diacetylmuramidase.Along with people's is invested the ocean to the sight of developing new drug and functional foodstuff in recent years, and the research interest of i-type N,O-Diacetylmuramidase is also grown to even greater heights, and in seashells, shrimp, starfish, sea urchin, sea cucumber, has found i-type N,O-Diacetylmuramidase in succession.

The N,O-Diacetylmuramidase of commercialization use mainly extracts from egg white at present, belongs to c-type N,O-Diacetylmuramidase.Because the source is limited, complex manufacturing, N,O-Diacetylmuramidase output is limited, holds at high price, and is difficult to satisfy the increasing market requirement.Therefore, utilizing the genetically engineered recombinant technology to efficiently express N,O-Diacetylmuramidase becomes very important means, especially produces sea cucumber i-type N,O-Diacetylmuramidase and has very important using value.Discover; Sea cucumber i-type N,O-Diacetylmuramidase is different with egg white c-type N,O-Diacetylmuramidase; The latter only plays anti-microbial effect to gram-positive microorganism; And sea cucumber i-type N,O-Diacetylmuramidase is not only to gram-positive microorganism, and Gram-negative bacteria is all had significant anti-microbial effect, especially the pathogenic bacteria (vibrios and pseudomonas) that causes the aquatic animal serious plant disease usually had tangible antibacterial effect.Simultaneously, sea cucumber i-type N,O-Diacetylmuramidase have stronger antimycotic, antiviral, increase ability such as immunizing power, and have characteristics such as good biocompatibility,, nontoxicity non-stimulated to organizing.

Sea cucumber i-type N,O-Diacetylmuramidase (hereinafter to be referred as sea cucumber antalzyme) gene in 2007 in our laboratory separated first and identify (referring to Yang Xijian, etc. the constructional feature of sea cucumber i-type lysozyme gene and coded product thereof. Chinese biological chemistry and molecular biosciences journal; 2007,23 (7): 542-547).In recent years; We carry out the sea cucumber antalzyme gene recombinant expressed respectively in intestinal bacteria and pichia spp cell again; And the anti-microbial activity of recombinant protein carried out studying (referring to Wang Xiuxia; Deng. the recombinant expressed and antimicrobial spectrum analysis of extra large stichopus japonicus i-type lysozyme gene. biotechnology journal, 2009,25 (2): 189-194; Gu Yuefeng, etc. sea cucumber antalzyme gene clone and the expression and purification in pichia spp. Dalian Polytechnic University's journal, 2010,29 (5): 317-320).But the problem that exists at present; The one, the recombinant sea cucumber antalzyme gene is expressed in Bacillus coli cells; There is (being that zymoprotein does not dissolve) in its antalzyme protein with the inclusion body form, and is follow-up loaded down with trivial details to this proteic sex change and renaturation manipulation, and the production of enzyme that obtains is low, active unstable; The 2nd, recombinant sea cucumber antalzyme gene expressing quantity in the pichia spp cell is very low.These two bottleneck problems have seriously hindered the process of sea cucumber antalzyme research to the industrialization test, and domestic and international several laboratory all runs into similar problem when all kinds of lysozyme genes of research are expressed.Through to the analysis of sea cucumber antalzyme gene structure, the N end regions of the finding sea cucumber antalzyme beta-glycosidase of possibly having encoded is active, and the C end regions isopeptide enzymic activity of possibly having encoded.Therefore, we are divided into two sections with the sea cucumber antalzyme gene at design, carry out recombinant expressed sea cucumber antalzyme N end and the C end polypeptide of being prepared into respectively, verify its characteristic and function again, and do comparison and analysis with sea cucumber antalzyme.The invention relates to the preparation method and the application of recombinant sea cucumber antalzyme N end polypeptide.

Summary of the invention

The object of the present invention is to provide a kind of gene engineering preparation method that has broad spectrum antibiotic activity, efficiently expresses the sea cucumber antalzyme polypeptide.The technical scheme that the present invention adopts is: to N,O-Diacetylmuramidase (SjLys) gene (the GenBank number of registration: EF036468) carry out the recombinant expressed of N end polypeptide of the extra large stichopus japonicus (Stichopus japonicus) that derives from autonomous isolation identification.Utilize design synthetic primer, the gene of amplification sea cucumber antalzyme polypeptide; With the prokaryotic expression carrier pET-32a-SjLys-N that makes up, transform Rosetta (DE3) pLysS cell, obtain the genetic engineering bacterium of plant height efficient expression recombinant sea cucumber antalzyme N end polypeptide.With the lysozyme polypeptide that described genetic engineering bacterium is produced, through fermention medium and Optimizing Conditions of Fermentation, its expression product has the solubility more than 50%, and product yield is high.The recombinant sea cucumber antalzyme N end polypeptide of producing has broad spectrum antibiotic activity, and especially through 100 ℃ of heating 40min, the anti-microbial activity of this polypeptide products remains unchanged basically.The research proof, anti-microbial activity, stability and the production efficiency of sea cucumber antalzyme N end polypeptide all are superior to sea cucumber antalzyme, are not applied to prepare fodder additives, food preservatives, antibiotic alternative medicine etc. with can having harm.

One side of the present invention is to protect a kind of primer sequence of recombinant sea cucumber antalzyme N end polypeptide, and its primer sequence is respectively, forward primer: SEQ ID NO:1; Reverse primer: SEQ ID NO:2.

Another aspect of the present invention is to protect a kind of plasmid of recombinant sea cucumber antalzyme N end polypeptide; Its preparation method is following: with sea cucumber antalzyme SjLys gene is template; With above-mentioned forward primer: SEQ ID NO:1 and reverse primer: the gene fragment that SEQ ID NO:2 is increased is connected among the coli expression carrier pET32a (+), makes up recombinant expression plasmid.

Another aspect of the present invention is to protect a kind of genetic engineering bacterium of express recombinant sea cucumber antalzyme N end polypeptide, and its preparation method comprises: above-mentioned plasmid is transformed Rosetta (DE3) pLysS host cell obtain the recombination engineering bacteria.

Another aspect of the present invention is to protect a kind of preparation method of recombinant sea cucumber antalzyme N end polypeptide, and it comprises:

1. abduction delivering: cultivate above-mentioned recombination engineering bacteria, and use the IPTG abduction delivering;

2. separate and purifying: collect 1. products obtained therefrom of step, through the nickel ion affinity chromatograph column purification, and concentrated with ultra-filtration membrane; Again with making finished product after the concentrating sample desalination.

Concrete, in above-mentioned method, the condition of its abduction delivering and separation and purification comprises:

3. abduction delivering

In the liquid nutrient medium of optimizing, 37 ℃, 160rpm shaking culture are to OD with recombination engineering bacteria mentioned above ₆₀₀Reach 0.6-0.8, in culture system, adding IPTG again is 0.5mmol/L to final concentration, and 28 ℃, 150rpm inducing culture 8h collect fermented liquid;

Wherein, the liquid nutrient medium of optimization is meant: in the LB substratum, add two kinds of microbiotic, i.e. 100mg/L penbritin and 34mg/L paraxin, and interpolation 5g/L glucose, 0.3g/L MgSO ₄7H ₂O and 1g/L K ₂HPO ₄3H ₂O;

4. separate and purifying

The fermented liquid that 3. step collects is centrifugal, collect and the washing thalline multigelation; With the resuspended thalline of phosphate buffered saline buffer, and add after Triton X-100 is 1% to final concentration, through the broken bacterium of ice-bath ultrasonic; Centrifugal collection supernatant; Through nickel ion affinity chromatograph post His Trap HP column purifying, collect the fusion rotein component of recombinant sea cucumber antalzyme polypeptide, use molecular weight cut-off albumen to be concentrated into 8～10mg/mL as the Millipore ultra-filtration membrane of 5kDa; Again with concentrating sample through the desalination of Sephadex G-25 gel chromatography, collect the fusion rotein component, lyophilize obtains the product of recombinant sea cucumber antalzyme N end polypeptide.

Another aspect of the present invention is to protect a kind of recombinant sea cucumber antalzyme N end polypeptide that utilizes above-mentioned method to obtain.

Another aspect of the present invention is to protect a kind of fodder additives, food preservatives, antibiotic alternative medicine and application in the sea farming production field that utilizes above-mentioned recombinant sea cucumber antalzyme N end polypeptide preparation.

Following each experimental implementation that the invention described above relates to; Comprise: experimental implementation methods such as gene fragment is connected among the coli expression carrier pET32a (+), plasmid transforms Rosetta (DE3) pLysS host cell, nickel ion affinity chromatograph column purification, ultra-filtration membrane concentrate, sample desalination are the experimental technique that those skilled in the art use always; So do not do once more and give unnecessary details, the said part of specific embodiment among concrete visible the present invention.

Character of innovation of the present invention is:

1. efficiently express and prepare solubility recombinant sea cucumber antalzyme N end polypeptide, solved key issues such as the albumen solubility that current sea cucumber antalzyme industrialization runs into is low, enzymic activity is low.

2. genetic engineering bacterium provided by the invention is produced recombinant sea cucumber antalzyme N end polypeptide, has the output height, and working condition and step are simple, and reaction conditions is easy to control, and therefore the advantage that production cost is low is applicable to large-scale production.

3. recombinant sea cucumber antalzyme N end polypeptide has broad spectrum antibiotic activity, and has good thermostability and enzyme stability alive, and safe and harmless, can be applicable to prepare fodder additives, food preservatives, antibiotic alternative medicine etc.

Description of drawings

Fig. 1 is the gene fragment of pcr amplification SjLys-N; Swimming lane wherein, M:50bp DNA ladder marker; The 1:PCR amplified production;

Fig. 2 is the Western blotting analytical results figure of recombinant sea cucumber antalzyme N end polypeptide; Swimming lane wherein, M: accurate protein molecular weight standard; The thalline of bacterial strain fermentation liquor before 1:IPTG induces; 2:IPTG induces the thalline of back bacterial strain fermentation liquor; 3:Western blotting detects the sample in the swimming lane 1; 4:Western blotting detects the sample in the swimming lane 2;

Fig. 3 is the SDS-PAGE figure as a result of abduction delivering and the purifying of recombinant sea cucumber antalzyme N end polypeptide; Swimming lane wherein, M: protein molecular weight standard; The thalline of bacterial strain fermentation liquor before 1:IPTG induces; 2:IPTG induces the thalline of back bacterial strain fermentation liquor; 3: the throw out after inductive bacterial strain fermentation liquor somatic cells is broken; 4: the supernatant after inductive bacterial strain fermentation liquor somatic cells is broken; 5: the sample in the swimming lane 4 is through Ni ²⁺-NTA affinity column purified recombinant albumen.

Embodiment

Following non-limiting example can make those of ordinary skill in the art more fully understand the present invention, but does not limit the present invention in any way.

Used extra large stichopus japonicus (Stichopus japonicus) among the following embodiment comes from area, Changhai County, Dalian, and the GenBank number of registration of its sea cucumber antalzyme (SjLys) gene is EF036468;

Primer sequence is synthetic, dna sequencing is to be accomplished by the Huada Gene Research Center, Beijing;

It is to be accomplished by TaKaRa Biotechnology (Dalian) company that Western blotting analyzes;

Intestinal bacteria Rosetta (DE3) pLysS competent cell and expression vector pET-32a (+) are available from Novagen (U.S.) company;

Bacillus coli DH 5 alpha, cloning vector pMD 18-T, RNAiso Plus reagent, TaKaRa One Step RNA PCR Kit (AMV) test kit, restriction endonuclease, T ₄Dna ligase, Taq archaeal dna polymerase, DNA ladder marker and albumen lower molecular weight marker are all available from TaKaRa Biotechnology (Dalian) company;

Plasmid extracts and agarose gel electrophoresis DNA reclaims test kit all available from TIANGEN Biotech (Beijing) Co., Ltd.;

HisTrap HP column is available from GE Healthcare (U.S.) company;

Other reagent are the home-made analytical pure.

Embodiment 1 efficiently expresses the preparation of the genetic engineering bacterium of recombinant sea cucumber antalzyme N end polypeptide

1. the amplification of sea cucumber antalzyme N end polypeptide gene sequence

(1) according to the gene order of sea cucumber antalzyme, designs two pairs of Auele Specific Primers, in forward and reverse sequence, introduce Nco I and EcoR I restriction enzyme site respectively.Its sequence is:

Forward primer: SEQ ID NO:1

TGA CCATGGCTATGCAAGTTCCTTCTGAT

Reverse primer: SEQ ID NO:2

CCAG GAATTCTCACTTCAGCCTAGCATCC

The pcr amplified fragment scope is that total length is 147bp (containing 49aa) from sea cucumber antalzyme amino acid Gln 21 to Lys 69, is the gene fragment of SjLys-N.

(2) get fresh extra large stichopus japonicus intestines sample, according to RNAiso Plus reagent explanation extracted total RNA.

(3) be template with the total RNA of this Trepang intestine, use TaKaRa One Step RNA PCR Kit (AMV) to carry out RT-PCR gene amplification, its reaction system is:

The RT-PCR loop parameter is: 50 ℃ of 30min, 94 ℃ of 2min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 45s, 35 circulations; 72 ℃ are extended 10min.

Question response is got 5 μ L PCR products after finishing, and with 1.7% agarose gel electrophoresis testing goal gene, and the purpose band is reclaimed test kit through agarose gel electrophoresis DNA reclaim purifying.The electrophoretic analysis result shows (Fig. 1), and amplification gene fragment SjLys-N presents the specificity bright band near 150bp, with the big or small basically identical of expection fragment (147bp).

2. make up and efficiently express recombinant sea cucumber antalzyme N end polypeptide gene engineering bacteria

(1) the SjLys-N gene fragment that amplification is obtained, behind Nco I and EcoR I restriction enzymes double zyme cutting, its target gene fragment of purifying and recovering; Again with linearizing pMD18-T carrier behind Nco I and EcoR I double digestion by T ₄Dna ligase connects, 16 ℃ of reaction overnight, construction recombination plasmid pMD18-SjLys-N.Get connection product 5 μ L and add in the competent cell of the 50 μ L bacillus coli DH 5 alphas that thaw ice bath 30min; Put into 42 ℃ of heating 45s again, put 2min in the ice immediately; Add SOC liquid nutrient medium 945 μ L then, 37 ℃ of following shaking culture 60min promptly obtain transforming the e.colidh5 conversion fluid that sea cucumber antalzyme N holds polypeptide gene.

(2) an amount of this conversion fluid is coated 37 ℃ of incubated overnight in the LB solid medium that contains 100mg/L penbritin (Amp), picking list bacterium colony extracts recombinant plasmid after the LB liquid nutrient medium that contains 100mg/L Amp is cultivated respectively.Carry out enzyme with Nco I and EcoR I Restriction Enzyme and cut rear electrophoresis, obtain the gene fragment of SjLys-N.

LB liquid nutrient medium preparation: Tryptones 10g, yeast extract 5g, NaCl 10g; Each components dissolved in the 900mL deionized water, is transferred pH to 7.0 with 1mol/L NaOH, and moisturizing is to 1000mL again, high pressure steam sterilization.In addition, the LB solid medium need add agar powder 15g/L.Medium sterilization is cooled to about 60 ℃, adds corresponding microbiotic by concentration requirement.

(3) the SjLys-N gene fragment is connected with coli expression carrier pET32a (+), makes up recombinant expression plasmid pET32a-SjLys-N, be transformed into bacillus coli DH 5 alpha, make the genetic engineering bacterium that contains sea cucumber antalzyme N end polypeptide.Entrust the biotech company of specialty to check order this genetic engineering bacterium, confirm that they contain complete SjLys-N gene fragment.

(4) the genetic engineering bacterium extracting recombinant plasmid pET32a-SjLys-N that has built from step 2 (3); Be transformed in intestinal bacteria Rosetta (DE3) the pLysS competent cell; And get 50 μ L and coat on the LB solid medium that contains 100mg/L penbritin (Amp) and 34mg/L paraxin (Cam) 37 ℃ of incubated overnight.Picking list colony inoculation is in containing 100mg/LAmp respectively, and in the LB liquid nutrient medium of 34mg/L Cam, 37 ℃ of shaking culture 14～16h extract recombinant plasmid and do PCR and enzyme and cut to detect and identify whether the gene fragment size of inserting is correct.The picking transformant carries out sequencing again, the exactness of checking recombinant expression plasmid reading frame, and the sea cucumber antalzyme N that promptly obtains efficiently expressing holds the genetic engineering bacterium of polypeptide, called after pET32a-SjLys-N/Rosetta (DE3) pLysS.

Abduction delivering and the Western blotting of embodiment 2 recombinant sea cucumber antalzyme N end polypeptide in intestinal bacteria detects

The genetic engineering bacterium of the sea cucumber antalzyme N end polypeptide that structure is correct is inoculated in and contains 100mg/L Amp, in the LB liquid nutrient medium of 34mg/L Cam and 10g/L glucose, and 37 ℃ of following 160rpm shaking culture 14～16h.Be inoculated in according to the inoculum size of volume ratio 1% then and contain 100mg/L Amp, 34mg/L Cam, and in the LB liquid nutrient medium of 5g/L glucose, 37 ℃ of following 160rpm shaking culture are to OD ₆₀₀Reach 0.6～0.7, take out 1mL bacterium liquid as inducing preceding control sample.Adding inductor IPTG again is 0.5mmol/L to the fermented liquid final concentration, and 28 ℃ of following 120rpm inducing culture 10h take out 1mL bacterium liquid as inducing the back sample.The thalline of last centrifugal fermented liquid collecting precipitation is with this Recombinant Protein Expression situation of 15%SDS-PAGE Preliminary detection.Electrophoresis result shows ( swimming lane 1 and 2 among Fig. 2), and reorganization SjLys-N obviously has more 1 specificity bright band about about 23kDa.

In order to verify whether recombinant plasmid pET32a-SjLys-N really obtains expressing in intestinal bacteria, utilize Penta-His antibody capable and recombinant sea cucumber polypeptide generation specificity bonded characteristics in the Western blotting analysis to detect.After the sample of above-mentioned reorganization SjLys-N genetic engineering bacterium before inducing and the thalline sample of inducing secondary fermentation liquid carried out 15% SDS-PAGE electrophoresis, be transferred on PVDF (PVDF) film, be placed on and contain in the 1.5%BSA sealing damping fluid, 4 ℃ keep flat and spend the night.Add the Penta-His antibody of dilution in 1: 1000, carry out antibody response 1h one time.With Tris-HCl damping fluid (pH7.4) washing that contains 0.1% (v/v) Tween 20 2 times, again with after washing Tris-HCl damping fluid (pH 7.4) flushing 3 times, adds the rabbit anti-mouse igg monoclonal antibody of HRP mark of 1: 1000 dilution, carry out secondary antibodies and react 1h.Repeat again to wash film once after, add the TrueBlue peroxidase substrate at last, colour developing 1min post analysis.Analytical results explanation (swimming lane 3 and 4 among Fig. 2), the specific combination can take place with Penta-His antibody in reorganization SjLys-N albumen about 23kDa, thereby proves that this recombinant protein has obtained correct expression really in intestinal bacteria.

The fermentation optimization and the separation and purification of the genetic engineering bacterium of embodiment 3 recombinant sea cucumber antalzyme N end polypeptide

1. the optimization of fermention medium

The basic medium of the genetic engineering bacterium of fermentation culture recombinant sea cucumber antalzyme N end polypeptide is the LB liquid nutrient medium that contains microbiotic 100mg/LAmp and 34mg/L Cam.On this basis, carried out the medium optimization experiment, comprised and add glucose (2g/L, 5g/L, 10g/L; ), MgSO ₄7H ₂O (0.1g/L, 0.3g/L, 0.5g/L; ), and K ₂HPO ₄3H ₂O (0.5g/L, 1g/L, 1.5g/L; ).Add the IPTG inductor and carry out the recombinant polypeptide induction expression of protein, the fermented liquid that obtains is collected supernatant and is analyzed the wherein content of soluble proteins after cytoclasis.Analyze through SDS-PAGE, confirm that the Optimal compositions of fermentation medium prescription is: containing 100mg/L Amp, in the LB substratum of 34mg/L Cam, adding 5g/L glucose, 0.3g/L MgSO ₄7H ₂O, 1g/L K ₂HPO ₄3H ₂O.

2. the optimization of fermentation inducement condition

The optimization experiment of optimal conditions of fermentation comprises: induce leavening temperature (25 ℃, 28 ℃, 30 ℃, 35 ℃); IPTG inductor concentration (0.2mmol/L, 0.5mmol/L, 0.8mmol/L, 1.0mmol/L); Induce fermentation time (4h, 6h, 8h, 10h); Shaking table revolution after inducing (220rpm, 180rpm, 150rpm, 120rpm).The genetic engineering bacterium of sea cucumber antalzyme N end polypeptide is under the condition of above-mentioned optimal medium prescription, and 37 ℃, 160rpm shaking culture are to OD ₆₀₀Reach 0.6-0.8, add inductor and induce fermentation, test each inductive condition.The fermented liquid that obtains is at last collected supernatant and is analyzed the wherein content of soluble proteins after cytoclasis.Analyze through SDS-PAGE, confirm that the best induces fermentation condition to be: IPTG concentration is 0.5mmol/L, 28 ℃, and 150rpm, inducing culture 8h.

3. induce the fermentation result under the top condition

Induce under the fermentation condition at above-mentioned optimal medium prescription and the best, detect the genetic engineering bacterium of recombinant sea cucumber antalzyme N end polypeptide and whether can efficient induction express, and whether the recombinant protein after expressing has solubility.Adopt biological software Bandscan5.0 to analyze the electrophoresis result of SDS-PAGE, the thalline expression amount after reorganization SjLys-N induces accounts for about 75% (swimming lane 2 among Fig. 3) of total protein content; And this thalline contains the proteic amount of reorganization SjLys-N in its supernatant of cytoclasis post analysis and throw out, and the result contains target protein more than 50% (swimming lane 4 among Fig. 3) in its supernatant.This shows that reorganization SjLys-N polypeptide can efficiently express in intestinal bacteria, and most of albumen of expressing can exist with soluble form.

4. the separation of product and purifying

Low-temperature centrifugation collect the thalline induce after the fermentation (4 ℃, 1000rpm, 10min), with phosphate buffered saline buffer (1 * PBS, pH 7.4) washing thalline twice, with thalline multigelation several.Add 1 * PBS damping fluid (pH 7.4) of precooling according to the twice of thalline weight in wet base volume, and add Triton-100 to final concentration be volume ratio 1%, with resuspended thalline.This bacteria suspension is put ultrasonic degradation cell in the ice bath, power 400W, and ultrasonic 1s leaves standstill 3s, and co-processing 10min is thickness extremely no longer.Through 4 ℃, the centrifugal 15min of 12000rpm, get supernatant and deposition respectively and carry out the SDS-PAGE detection again.Collect supernatant ,-20 ℃ of preservations are subsequent use.

Preparing 1mL HisTrap HP column (is Ni ²⁺-NTA affinity column), with 10 times of column volume distilled water flushing pillars, with the binding buffer liquid of 10 times of column volumes (500mmol/L NaCl, pH 7.4 for 40mmol/L imidazoles, 20mmol/L sodium radio-phosphate,P-32 solution) balance.Above-mentioned supernatant samples through ultrasonic degradation with the flow velocity upper prop of about 1.0mL/min, is washed post with the binding buffer liquid of 25 times of column volumes again after 0.22 μ m filtering membrane is handled; Use elutriant (the 150mmol/L imidazoles of 10 times of column volumes at last; The 20mmol/L sodium radio-phosphate,P-32 solution, 500mmol/L NaCl, pH 7.4); Wash-out purpose recombinant protein SjLys-N, the fusion rotein component of collecting the sea cucumber antalzyme polypeptide.Use molecular weight cut-off albumen to be concentrated into 8～10mg/mL again as the Millipore ultra-filtration membrane of 5kDa.Concentrating sample through the desalination of Sephadex G-25 gel chromatography, is collected the fusion rotein component, and lyophilize obtains the refined prod (swimming lane 5 among Fig. 3) that recombinant sea cucumber antalzyme N holds polypeptide respectively.

The mensuration of embodiment 4 recombinant sea cucumber antalzyme N end polypeptide bacteriostatic activity

Adopt the agar plate diffusion process to measure the inhibition zone size of recombinant sea cucumber antalzyme N end polypeptide to part gram-positive microorganism and Gram-negative bacteria, (mm) representes with its radius.Take by weighing the some grams of lyophilized powder of SjLys-N earlier, be dissolved among 1 * PBS (pH7.4), utilize the Bradford method to confirm that its proteic content is at 100 μ g/mL.The negative control of this experiment be empty carrier pET-32a (+) in E.coli Rosetta (DE3) pLysS, induce the fermentation and purifying protein, be prepared into lyophilized powder after, more quantitatively to protein content be 100 μ g/mL.

Get gram-positive microorganism; Streptococcus aureus (Staphylococcus aureus) and micrococcus lysodeikticus (Micrococcus lysodeikticus); And Gram-negative bacteria, intestinal bacteria K88 (Escherichia coli), Vibrio parahaemolyticus (Vibrio parahaemolyticus); Vibrio anguillarum (Vibrio anguillarium), Pseudomonas aeruginosa (Pseudomonas aeruginosa) and Aeromonas hydrophila (Aeromonas hydrophila) are as indicator.With these bacteriums 37 ℃, 200rpm incubated overnight in the LB liquid nutrient medium, be diluted to OD ₆₀₀Be about 0.001, bacteria concentration is about 3.0 * 10 ⁹CFU/ml.Get above-mentioned selected bacterium liquid of 100 μ L and 20mL, 50 ℃ the rapid mixing of LB solid medium, and pave the plate cooling, test as follows again:

Test one: containing on the flat board of above-mentioned a certain specific indicator, placing 2 aseptic Oxford cups, adding the reorganization SjLys-N solution of 100 μ L reorganization SjLys-N stoste and 100 ℃ on warp, heating 40min processing respectively.

Test two: containing on the flat board of above-mentioned a certain specific indicator, placing 2 aseptic Oxford cups, adding 100 μ L reorganization SjLys-N stoste and negative control sample solution respectively.

The flat board of all tests is placed 30 ℃ of incubated overnight, measure inhibition zone.The test triplicate, results averaged.Table 1 is depicted as the inhibition zone size of this product after recombinant sea cucumber antalzyme N end polypeptide and the heat treated; The result finds that this recombinant sea cucumber antalzyme N end polypeptide all has restraining effect to Gram-negative bacteria and positive bacteria; Especially gram negative pathogenic bacteria vibrios common in the sea-food there is the obvious suppression effect; And the SjLys-C after the heated and inactivated remains unchanged to the bacteriostasis of Gram-negative bacteria and positive bacteria basically; Explain that this product has thermostability preferably, application as fodder additives is highly profitable to the sea cucumber antalzyme polypeptide for this.

Table 1 reorganization SjLys-N polypeptide bacteriostatic activity is measured

* use the purified extraction albumen of fermented liquid of negative control pET-32a (+)/E.coli Rosetta (DE3) pLysS, measure its bacteriostatic activity to above-mentioned all bacteriums, the result does not all detect inhibition zone.

Claims (7)

1. recombinant sea cucumber antalzyme N holds the primer sequence of polypeptide, and it is characterized in that: primer sequence is respectively, forward primer: SEQ ID NO:1; Reverse primer: SEQ ID NO:2.

2. the plasmid of recombinant sea cucumber antalzyme N end polypeptide; It is characterized in that; The preparation method comprises: with N,O-Diacetylmuramidase SjLys gene is template, and the gene fragment that the described primer sequence of claim 1 is increased is connected among the coli expression carrier pET32a (+), makes up recombinant expression plasmid.

3. the genetic engineering bacterium of an express recombinant sea cucumber antalzyme N end polypeptide is characterized in that the preparation method comprises: the described plasmid of claim 2 is transformed Rosetta (DE3) pLysS host cell obtain the recombination engineering bacteria.

4. the preparation method of recombinant sea cucumber antalzyme N end polypeptide is characterized in that the preparation method comprises:

1. abduction delivering: cultivate the described recombination engineering bacteria of claim 3, and use the IPTG abduction delivering;

2. separate and purifying: collect 1. products obtained therefrom of step, through the nickel ion affinity chromatograph column purification, and concentrated with ultra-filtration membrane; Again with making finished product after the concentrating sample desalination.

5. method according to claim 4 is characterized in that, the condition of abduction delivering and separation and purification comprises:

3. abduction delivering

In the liquid nutrient medium of optimizing, 37 ℃, 160rpm shaking culture are to OD with the described recombination engineering bacteria of claim 3 ₆₀₀Reach 0.6-0.8, in culture system, adding IPTG again is 0.5mmol/L to final concentration, and 28 ℃, 150rpm inducing culture 8h collect fermented liquid;

Wherein, the liquid nutrient medium of optimization is meant: in the LB substratum, add two kinds of microbiotic, i.e. 100mg/L penbritin and 34mg/L paraxin, and interpolation 5g/L glucose, 0.3g/L MgSO ₄7H ₂O and 1g/L K ₂HPO ₄3H ₂O;

4. separate and purifying

The fermented liquid that 3. step collects is centrifugal, collect and the washing thalline multigelation; With the resuspended thalline of phosphate buffered saline buffer, and add after Triton X-100 is 1% to final concentration, through the broken bacterium of ice-bath ultrasonic; Centrifugal collection supernatant; Through nickel ion affinity chromatograph post His Trap HP column purifying, collect the fusion rotein component of recombinant sea cucumber antalzyme polypeptide, use molecular weight cut-off albumen to be concentrated into 8～10mg/mL as the Millipore ultra-filtration membrane of 5kDa; Again with concentrating sample through the desalination of Sephadex G-25 gel chromatography, collect the fusion rotein component, lyophilize obtains the product of recombinant sea cucumber antalzyme N end polypeptide.

6. the recombinant sea cucumber antalzyme N according to claim 4 or 5 described methods acquisitions holds polypeptide.

7. the application of recombinant sea cucumber antalzyme N end polypeptide as claimed in claim 6 in preparation fodder additives, food preservatives, antibiotic alternative medicine, sea farming production field.

Images