CN102533792A

CN102533792A - Transformed cryX gene and application thereof

Info

Publication number: CN102533792A
Application number: CN2011103967677A
Authority: CN
Inventors: 耿丽丽; 束长龙; 刘东明; 张�杰; 宋福平; 黄大昉
Original assignee: Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Current assignee: Zhongzhi Kechuang Biotechnology Co., Ltd.
Priority date: 2010-06-02
Filing date: 2010-06-02
Publication date: 2012-07-04
Anticipated expiration: 2030-06-02
Also published as: CN102533792B

Abstract

The invention relates to a transformed cryX gene and application of the transformed cryX gene, which belongs to the field of biotechnology. The transformed cryX gene has a sequence shown as SEQ ID NO3 and is applied to transform microorganisms or plants so that the microorganisms or plants express toxicity to related pests and overcomes and postpones the generation of drug resistance of pests on engineering bacteria. The experiment shows that the maximum content of the expressed CryX protein accounts for 0.21% of total soluble proteins.

Description

The cryX gene and the application thereof of transforming

The application is that number of patent application is " 201010196386X ", and denomination of invention is divided an application for " to the desinsection cryX gene and the application thereof of the high virulence of lepidoptera pest ".

Technical field

The present invention relates to biological technical field, particularly relate to new killing gene cryX and the application thereof of bacillus thuringiensis the high virulence of lepidoptera pest.

Background technology

Insect pest is one of major reason that causes crop production reduction, and the loss that reduces insect pest is the important channel that increases grain and fodder crop output.Global according to statistics grain and fodder crop ultimate production every year because of insect pest cause with a toll of 14%, the financial loss that directly causes to agriculture prodn is up to hundreds billion of dollars.The loss paddy rice underproduction 10% that China causes because of insect pest every year, wheat yield 20%, the cotton underproduction be [Xia Qizhong, Zhang Mingju, anti-insect pest of the plant gene and application thereof, Ezhou college journal, 2005, (5): 56-60.] more than 30%.Employing sprays means of prevention such as chemical pesticide and biotic pesticide no doubt can alleviate insect to the causing harm of farm crop, but chemical pesticide causes environmental pollution, and the biotic pesticide cost is higher.For a long time, spray chemical insecticide in a large number, not only can strengthen the resistance of insect, beneficial insect and other ecosystem are wrecked, and serious environment pollution, improve production cost, destroy the eubiosis.Therefore, reduce the sterilant usage quantity, the development of modern plant protection technology has become one of the problem that must face in the Sustainable development agricultural.

Tribactur (Bacillus thuringiensis, be called for short Bt) is a kind of distribution gram positive bacterium widely, is a kind of strong and to the avirulent entomopathogen of natural enemy, to higher animal and people's nontoxicity to the insect virulence.It is that research is at present goed deep into the most, the most widely used microbial pesticide, and 16 order 3000 various pests are had activity.Bt can form insecticidal crystal protein in the gemma formation phase, and (Insecticidal CrystalProteins ICPs), also claims delta-endotoxin (delta-endotoxin) [Bravo.A.; Gill S.S., Sober ó n M.Bacillus thuringiensis Mechanisms and Use.Comprehensive Molecular Insect Science Elsevier, 2005; 175～206.], its shape, structure and size all have substantial connection [Schnepf.E, Crickmore.N with its virulence; Van Rie.J., Lereclus.D, Baum.J; Feitelson.J, Zeigler.D.R., Dean.D.H.Bacillus thuringiensis and its pesticidal crystal proteins.Microbiol.Mol.Biol.Rev; 1998,62 (3): 775-806.].From 1981, Schnepf and Whiteley cloned the cry1Aa1 gene of first coding delta-endotoxin, have found and cloned 412 kinds of ICPs genes by in June, 2008.The Tribactur insecticidal crystal protein is because of its good disinsection effect, to person poultry harmless [De Maagd R.A.; Bravo A.; Crickmore N.How Bacillus thuringiensis has evolved specific toxins to col onize the insect world.Trends Genet, 2001,17:193～199.]; Free from environmental pollution, thereby Bt has obtained using the most widely in the biological control of insect.

The routine transgenic anti-insect plants that beat the world in 1996 is got permission to use in the U.S., and the gene that it uses is from Bt cry1Ac.In ensuing several years, change the pest-resistant corn of cry1Ab gene, change the appearances apart such as pest-resistant potato of cry3Aa gene.In China, since the formal popularization of beginning in 1998 contains the Insect Resistant Cotton of cry1Ac/cry1A gene, by generally plantation.In genetically modified crops business-like first 12 years (1996-2007), owing to can obtain continual and steady income, peasant planting genetically modified crops amount increases year by year.Had 1,400 ten thousand smallholders and the latifundium of 25 countries to plant the genetically modified crops of 1.34 hundred million hectares (3.3 hundred million acres) in 2009, increased by 7% than 2008, promptly 9,000,000 hectares (2,200 ten thousand acres) reach all time high; " proterties or real area " increased by 8% accordingly, promptly compares 1.66 hundred million hectares in 2008, increased by 1,400 ten thousand hectares, reaches 1.8 hundred million hectares in 2009.The genetically modified crops cultivated area has increased by 80 times beyond example in the period of 1996 to 2009, and render transgenic becomes the crop technology that utilization is the fastest on the agriculture modern history.

Because the anti insect gene kind of present commercial transgenic pest-resistant crop is more single, so the big area popularizing planting exists insect sanctuary to reduce the risk that rises with pest resistance to insecticide.Therefore need constantly to separate the incompatible risk of avoiding pest resistance to insecticide to rise of genome high virulence or new.

Therefore; Screening and separating clone Bt killing gene new, high virulence can enrich the killing gene resource, for genetically modified crops and engineering strain provide new gene source; Improve the pest-resistant effect of Bt transgenic product; And can reduce the resistance risk of insect, avoid new eco-catastrophe to come, have important economy, society and ecological benefits the Bt toxalbumin.

Summary of the invention

The present invention provides a kind of new bacillus thuringiensis crystal insecticidal protein gene sequence that lepidoptera pests such as small cabbage moth, Pyrausta nubilalis (Hubern)., bollworm is had high virulence; To be applied to transform mikrobe; Make it to show toxicity, and overcome, delay the resistance generation of insect engineering bacteria to relevant insect.

To the killing gene PROTEIN C ryX of the high virulence of lepidoptera pest, it has the 31st-601 amino acids sequence shown in SEQ ID NO2.

To the killing gene PROTEIN C ryX of the high virulence of lepidoptera pest, it has the aminoacid sequence shown in SEQ ID NO2.

To the killing gene cryX of the high virulence of lepidoptera pest, its nucleotide sequence coded above-mentioned killing gene PROTEIN C ryX.

To the killing gene cryX of the high virulence of lepidoptera pest, it has the nucleotide sequence shown in SEQ ID NO1.

To the killing gene cryX of the high virulence of lepidoptera pest, it has the nucleotide sequence shown in SEQ ID NO3.

A kind of expression vector, it contains above-mentioned killing gene cryX.

Said expression vector is pUX, and its structure as shown in Figure 4.

The application of killing gene cryX in the control lepidoptera pest to the high virulence of lepidoptera pest.

Said being applied as processed sterilant with above-mentioned killing gene PROTEIN C ryX and is used to prevent and treat lepidoptera pest, perhaps changes above-mentioned killing gene cryX over to express anti-lepidoptera pest in plant or the mikrobe characteristic.

Said plant is a corn.

The present invention is from bacterial strain T03B001 (preserving number: BGSC No.4 AP1; The public can obtain from plant protection institute of the Chinese Academy of Agricultural Sciences) a new gene obtaining of clone; Total length is 1.8Kb, and its nucleotides sequence is classified SEQ ID NO1 as, and its amino acid sequence coded is 600 and sees shown in the SEQ ID NO2; Through the analysis ratio, 31 of this Argine Monohydrochloride sequence is that this proteic insecticidal activity is regional to 601 amino acids.

Through insecticidal activity assay, this gene protein has high virulence to small cabbage moth, Pyrausta nubilalis (Hubern)., bollworm.

To above-mentioned insecticidal activity region amino acid sequence, the present invention designs and has synthesized the dna sequence dna that is used for the transgenic plant exploitation, shown in SEQ ID NO3.This composition sequence imports in the corn, and Pyrausta nubilalis (Hubern). is had anti-insect activity preferably.

Description of drawings

Fig. 1 cryX positive colony PCR identifies

Wherein 1,1.9kb PCR product M, λ/Eco130I

The expression of Fig. 2 CryX in colibacillus

Fig. 3 sequence alignment figure

Query is SEQ ID NO3

Sbjct is original cryX sequence, i.e. SEQ ID NO1

Fig. 4 expression vector pUX makes up schema

The enzyme that Fig. 5 expression of plants carries pU1Ai is cut evaluation

M wherein: λ DNA/Eco130I, 1:pU1Ai/Sac I+BamH I, 2:pT8A/Sac I+BamH I, 3:p3300-Ubi/Sac I+BamH I

Fig. 6 resistant plant PCR detects

M:DM2000 P:pUX CK: negative control 1～9: part transfer-gen plant

CryX albumen accounts for the soluble proteins ratio in Fig. 7 PCR positive plant

Fig. 8 T0 is for the Pyrausta nubilalis (Hubern). biological activity determination of transfer-gen plant

A, B: unconverted plant C: transfer-gen plant

Embodiment

Bacterial strain T03B001 (preserving number: BGSC No.4 AP1, the public can obtain from plant protection institute of the Chinese Academy of Agricultural Sciences) insecticidal activity assay

Inoculation to the LB solid medium, was cultivated 72 hours, to gemma and crystal release.Gemma and crystal are washed with aqua sterilisa, and suspension is got up, and the concentration that is diluted to every milliliter of 100,000,000 gemma is used for insecticidal activity assay.With small cabbage moth, Pyrausta nubilalis (Hubern)., bollworm, measure insecticidal activity to lepidoptera pest.The result shows that the gemma mixed crystal of this concentration has high reactivity to small cabbage moth, Pyrausta nubilalis (Hubern)., bollworm.The mortality ratio of three kinds of examination worms all is 100%.

Design primer amplification cryX full-length gene

With the solexa method to the T03B001 gene order-checking.

Utilize the Bt killing gene of having reported to carry out genescreen as the comparison DB.The result is as shown in the table, and wherein the gene of contig00361 coding is the most similar with cry1Ca, but score (score) also has only 174, explains that this is a new gene.

QueryName	Score	E-value	Overlap/total	Identity	SbjectName
						contig00023	5586	0	2923/2958	98	cry9eb
contig00360	6912	0	3506/3510	99	cry9da
						contig00360	2290	0	1440/1536	93	cry9da
contig00361	174	0	154/176	82	cry1Ca
						contig00363	5388	0	2894/2955	97	cry9aa

According to the gene design of contig00361 coding a pair of primer (LIU5/LIU3), sequence is following:

LIU5-ATGAATTCAAAGGAACATGATTATCT

LIU3-TTCAACAGGAATAAATTCAATTTTATCC

Through the method for pcr amplification, be masterplate with the genome of T03B001, clone cryX full length gene is seen Fig. 1, connects the pEB expression vector and obtains positive colony.The recombinant expression vector plasmid called after pEBs6 that obtains.

Use the pfuDNA polysaccharase, carry out pcr amplification with following system.。

10×PCR?buffer	5μL
		dNTP(10mM)	1μL
Primer is to (10mM)	1 μ L/
		Template	1uL
PfuDNA polysaccharase (5U/ μ L)	0.5μL

Ultrapure water is mended to 50 μ L, and mixing is centrifugal, adds Yellow Protopet 2A 30 μ L.

Amplification cycles: 94 ℃ of sex change 1 minute, 54 ℃ of annealing 1 minute, 72 ℃ were extended 4 minutes, 25 circulations, last 72 ℃ were extended 10 minutes.As shown in Figure 1.

The cryX full-length gene order is analyzed

Positive colony is checked order, obtain the full length gene sequence.

Connectivity scenario

Supply volume to 10 μ L with ultrapure water, abundant mixing, 16 ℃ of connection 4h or 4 ℃ of connections are spent the night.

The conversion scheme

1. picking list bacterium colony is in 5ml LB concussion overnight cultures;

2. be inoculated in the LB liquid nutrient medium by 1% inoculum size, 37 ℃, 230rpm cultivates 2-2.5hr, (OD ₆₀₀=0.5-0.6);

3.4 ℃, 4, the centrifugal 10min of 000rpm;

4. abandon supernatant, add the 0.1M CaCl of precooling ₂The 50ml suspension cell places on ice more than the 30min;

5.4 ℃, 4, the centrifugal 10min of 000rpm reclaims cell;

6. ice the 0.1M CaCl of precooling with 2-4ml ₂Re-suspended cell is distributed in the 200 μ l/0.5mL centrifuge tubes, in 4 ℃ of preservations (can preserve a week).

7. get 200 μ l competent cells and be connected the abundant mixing of product, ice bath 30min with 5 μ L.

8.42 ℃ heat shock 1.5min, ice bath 3min.

9. add 800 μ l LB substratum and cultivate 45min for 37 ℃.

10. get 200 μ l coated plates, add corresponding microbiotic, and IPTG, X-gal, 37 ℃ of cultivations.

Full length gene 1.8kb sees SEQ ID NO1, and translation albumen is totally 601 amino acid, sees SEQ ID NO2.Through being utilized in line analysis instrument (http://blast.ncbi.nlm.nih.gov/Blast.cgi) comparison; Use albumen conserved structure regional data base comparison (Conserved Domain Database) to analyze, 31 to 601 amino acids of this Argine Monohydrochloride sequence SEQ ID NO2 are these proteic insecticidal activity zones.

The expression of cryX

Extract JM110 positive colony plasmid, transform Rosetta (λ DE3), the IPTG abduction delivering.

The abduction delivering process is following:

1) activated spawn (37 ℃, 12hr);

2) 10% be inoculated in (37 ℃, 2hr) in the LB substratum;

3) add inductor IPTG, 150rpm, 18-22 ℃ of low temperature induction 4-20h;

4) centrifugal collection thalline adds 10mM TrisCl (pH 8.0) and suspends;

5) broken thalline (ultrasonic disruption is complete);

Centrifugal 12,4 ℃ of 000rpm 10min;

Collect supernatant and precipitate each 10-15 μ L, respectively electrophoresis detection.

The polyacrylamide gel configuration as follows.

Last appearance: go up appearance 10-15 μ l, electrophoresis: 130-150V constant voltage.

Dyeing and decolouring: take out gel behind the electrophoresis, behind distilled water flushing, put into staining fluid, about 60rpm vibration dyeing 1hr, about decolouring 2hr, decolour to the gel background transparent in the destainer, rinsing to protein band is clear in the clear water.The cryX gene can be expressed the albumen (see figure 2) of about 66kD.

Insecticidal activity assay

With small cabbage moth, Pyrausta nubilalis (Hubern)., bollworm is that example is measured albumen to lepidopterous insecticidal activity, see by table 1, table 2, and 3, the result can know that CryX albumen has high virulence to lepidoptera pest.

Biological activity determination result such as the table 1 of responsive small cabbage moth, each concentration repeats 4 times, whenever repeats to connect 15 of worms.

Table 1, CryX is to the biological activity determination of responsive small cabbage moth

The biological activity determination result of responsive small cabbage moth shows that CryX has high virulence to responsive small cabbage moth.

Biological activity determination to responsive Ostrinia furnacalis is seen table 2, and each concentration repeats 3 times, whenever repeats to connect 24 of worms

Table 2, the biological activity determination of the responsive Ostrinia furnacalis of CryX

Biological activity determination result to responsive Ostrinia furnacalis shows that the responsive Ostrinia furnacalis of CryX has high virulence.

Biological activity determination to bollworm is seen table 3, and each concentration repeats 3 times, whenever repeats to connect 24 of worms.

The biological activity determination result of the responsive bollworm of table 3CryX

Biological activity determination result to responsive bollworm shows that the biological activity of the responsive bollworm of CryX shows as efficient inhibition and grows.The application of CryX albumen in transgenic plant

The dna sequence dna that can be used for the transgenic plant exploitation has been synthesized in proteic insecticidal activity region amino acid sequence design according to CryX, like SEQ ID NO3.Removed 19 of polyadenylation signals, GC content has improved 15.2%.It is 50.4% characteristic that this sequence has GC content; Contain the sequence that helps expression of plants, specifically see SEQ3.Added the Ω sequence nucleotide sequence at upstream region of gene, added the endoplasmic reticulum signal for locating at gene 3 ' end.

This composition sequence is imported in the corn by composing type Ubiquitin promoters driven, and the Pyrausta nubilalis (Hubern). snout moth's larva is had anti-insect activity preferably.

SEQ?ID?NO?3

GGATCCAAGCTTTCTAGACCCGGGCC TATTTTTACAACAATTACCAACAACAACAAACAACAAACAA CATTACAATTACTATTTACAATTACATGAACTCAAAGGAGCACGACTACCTAAAGGTGTGTAATGACTTGAGCGATGCCAACATTAACATGGAGCGGTTTGACAAGAATGATGCGCTGGAAATCGGCATGTCCATCGTCTCCGAACTTATCGGTATGATTCCAGGCGGAACAGCCTTGCAGTTCGTGTTCAATCAGTTGTGGTCTCGTCTGGGTGACTCTGGCTGGAATGCGTTCATGGAACACGTGGAAGAGTTGATTGATACGAAGATCGAAGGGTATGCCAAGAACAAAGCCTTATCAGAACTCGCAGGCATTCAGAGAAACCTTGAGACCTACATCCAACTGCGCAACGAATGGGAGAACGACATCGAGAACTCCAAGGCTCAAGGCAAGGTAGCCAACTATTACGAGAGTCTTGAGCAGGCGGTTGAGAGGAGCATGCCTCAGTTTGCAGTGGAAAACTTTGAGGTACCACTTTTGACTGTCTACGTGCAAGCTGCCAATCTTCACTTGCTCCTCCTGAGGGATGTGTCAGTGTATGGCAAGTGCTGGGGTTGGTCGGAGCAGAAGATCAAGATCTACTACGACAAGCAGATCAAGTACACCCATGAGTACACCAATCACTGTGTCAACTGGTATAACAAAGGCCTTGAGAGACTCAAAAACAAAGGTTCCTCCTACCAAGACTGGTACAACTATAATCGCTTCCGCAGAGAGATGACTCTTACTGTTCTCGACATCGTTGCTCTCTTCCCGCACTATGATGTCCAGACGTATCCGATAACCACCGTTGCTCAGCTAACCAGGGAAGTGTACACGGATCCGCTGCTTAACTTCAACCCCAAACTCCACTCCGTGTCCCAACTGCCTAGCTTCAGCGACATGGAGAATGCGACCATCCGGACTCCACATCTGATGGAGTTCCTCCGGATGCTAACCATCTACACAGATTGGTACAGTGTGGGCAGGAACTACTACTGGGGTGGACATCGCGTGACGTCCTACCATGTAGGTGGCGAGAATATACGATCACCTCTGTATGGTCGGGAGGCCAACCAAGAGGTTCCCAGAGACTTCTACTTCTATGGACCGGTCTTCAAGACGCTCTCAAAGCCGACTCTAAGACCACTGCAGCAGCCTGCACCAGCTCCTCCGTTCAATCTCCGTAGCCTGGAGGGAGTCGAGTTCCACACTCCCACAGGTAGCTTCATGTATCGCGAGAGAGGGTCGGTAGATTCCTTCAATGAGTTGCCCCCCTTCAATCCAGTTGGGTTACCTCACAAGGTCTACAGTCACCGTCTGTGTCATGCGACGTTTGTTCGCAAGTCTGGGACCCCCTATCTCACAACAGGAGCCATCTTTTCGTGGACACATCGCAGTGCTGAAGAGACCAACACCATAGAATCGAACATCATTACGCAGATCCCGTTAGTCAAAGCGTATCAGATTGGGTCAGGCACTACTGTCAGGAAAGGCCCAGGCTTCACAGGAGGGGACATACTTCGAAGGACAGGTCCTGGCACCTTTGGCGACATGAGGATAAACATCAATGCACCACTCTCTCAGAGGTACCGTGTCAGGATTCGCTACGCCTCTACGACAGATCTCCAGTTCGTCACGAGCATCAATGGGACCACCATCAACATTGGCAACTTCCCGAAGACGATCAACAATCTGAACACTCTGGGTTCTGAGGGCTACCGGACAGTCTCGTTTAGCACTCCCTTCAGCTTCTCGAATGCACAAAGTATCTTTCGACTGGGCATACAAGCGTTTTCTGGGGTTCAAGAAGTGTATGTGGACAAGATTGAGTTTATTCCGGTTGAA GAACTTTGATAAGGTACCCTCGAGGAGCTCTCCGAATTC

Underscore is the Ω sequence, and frame is a KEDL endoplasmic reticulum signal for locating, and BamH I, HindIII, XbaI, XmaI, SmaI, NcoI have been added in the upper reaches, and SacI, EcoRI restriction enzyme site have been added in downstream, are convenient to vector construction.

Composition sequence and original nucleotides sequence are shown 83.75% similarity.The comparison situation is seen Fig. 3.

Among Fig. 3, Query:SEQ3

Sbjct: original cryX sequence

Alignment?of?query(upper?line)and?subject(lower?line)

Identity＝83.75％(1510/1803)Gap＝0.00％(0/1803)

Plant expression vector construction

With BamH I and Sac I double digestion intermediate carrier p3300-Ubi; The carrier segments that reclaims is linked to each other with cryX fragment with same two digestion with restriction enzyme respectively; Make up flow process and see Fig. 4; Enzyme is cut evaluation (Fig. 5) and is proved that plant expression vector pUX makes up successfully, and this carrier contains the cryX gene that is driven by constitutive promoter Ubiquitin, and selection markers is the bar gene.Maize genetic transforms

The controlled pollination of corn

(1) after corn is taken out hero, entangles tassel, pin with safety pin below, collect pollen with big pocket;

(2) before female Honoka silk is not extracted out, it is entangled with tiny pocket, and not good with pin;

(3) in previous day of pollination, when filigree stretches out about 2cm and grows, cut off the top of filigree with scissors, promote its elongation;

(4) second days, after the filigree elongation, pollinate (preceding for maternal, the back is a male parent) according to combination: neat 31 * comprehensive 31;

(5) fasten swatch after the pollination, write the kind and the date of pollination, results after 10～12 days;

The peeling off and cultivating of rataria

(1) the female fringe of the corn that will newly gather in the crops removes bract, filigree, and filigree must go totally, and available spirit lamp is the filigree burning-off of Ex-all not; Remove the part end to end of female fringe with pocket knife;

(2) female fringe is immersed in the 30sec that sterilizes in 70% ethanol;

(3) female fringe is taken out, be immersed in 2.5% hypochlorous acid receive in sterilization 10～15min, can in solution, add several Tween20;

(4) clean 3 times with aqua sterilisa, wipe the residual globule, place sterile environment subsequent use with filter paper;

(5) rifle formula tweezers are inserted female fringe from the top, hold tweezers with left hand, the right hand cuts upper part of seed with the scalpel that the #21 blade is housed;

(6) change the #10 blade, point of a knife is inserted between the pericarp and endosperm of seed bottom, endosperm is chosen;

The rataria that (7) will be bonded in endosperm top or the top pericarp with point of a knife is transferred on the inducing culture, and operation is careful, and does not damage rataria.Note plumular axis (flat one side) during placement downwards, scultellum makes progress, and every ware is placed 20～30 approximately;

(8) 27～28 ℃ of dark cultivations for 3～4 weeks make it to begin dedifferentiation, form callus; After this, select the callus succeeding transfer culture that growth is rapid, quality is crisp, color is vivid, per 2～3 all subcultures are once selected well-grown callus to prepare particle gun and are transformed;

(9) at preshot 4hr, the callus that will be cut into small pieces is transferred to the height that contains 0.4M N.F,USP MANNITOL and is oozed on the substratum;

(10) after the shooting, callus is oozed at height continue overnight cultures on the substratum, transfer to then on the inducing culture, recover to cultivate a week.

Carrying out corn with particle gun transforms

(1) opens super clean bench, with inner surperficial and inner with particle gun of 70% ethanol wiping super clean bench;

(2) open uv lamp, sterilization 30min;

(3) prepare little bullet by abovementioned steps;

(4) be prone to sliver, little missile-borne body, barrier sterilization (place 70% ethanol 1.0min, be placed on natural air drying on the filter paper);

(5) open gas cylinder, regulate pressure to 2,000psi;

(6) by preceding method little missile-borne body and little bullet are installed;

(7) will be prone to sliver, barrier and little missile-borne body is installed in the stationary installation; Shooting parameter is: Gap distance:20mm; Little missile-borne body flying distance (Macroprojectile flight distance): 10mm; Little bullet flying distance (Particle flight distance): 7cm; Pressure: 1,350psi; Vacuum tightness: 25inches Hg.;

(8) be placed on petridish on the pallet, callus is all concentrated in the pallet intermediary circle, pallet is inserted shelves second from the bottom;

(9) open the power supply of particle gun;

(10) open vacuum pump;

(11) close the door of particle gun, press " vacuumizing " key (Vac), when the vacuum meter reading reaches 25inches Hg., make key place " keeping (Hold) " shelves;

(12) pressing " shooting (Fire) " is good for up to the shooting end;

(13) press " venting " and be good for, the vacuum meter reading is made zero;

(14) open the particle gun door, take out petridish, build lid and also seal with sealing film;

(15) repeat above-mentioned steps, transform until accomplishing.

The screening of transformed calli and the regeneration of plant

(1) callus after will transforming places dark, and 28 ℃ of overnight cultures are transferred to then and cultivated on the N6 inducing culture 5～7 days;

(2) callus is transferred on the screening culture medium (contained PPT20mg/L), two all subcultures are once selected normal, the WD callus of color and luster, discard the callus of aging death.The culture of every ware is too much unsuitable, and the callus piece should be tried one's best littler, and makes callus be close to substratum;

(3) behind the subculture 3～4 times, callus being moved on the N6 division culture medium, is to cultivate under bright/dark=16/8,28 ℃ of condition in the photoperiod, and per two all subcultures once;

(4) the callus cutting of green bud will take place;

(5) when plantlet length to 1～when 2cm was high, (containing the MS root media) continuation cultivation in the triangular flask was advanced in transfer;

When (6) 3～4 leaf phases and root system are flourishing, seedling is moved in the small flower, move into hot-house culture; The big flowerpot of two weeks back immigration is until blossoming and bearing fruit.

The PCR of transfer-gen plant detects

The extraction of transfer-gen plant genomic dna-SDS method

1. the blade that takes by weighing 0.2g is put into the 1.5ml centrifuge tube, with the abundant grind into powder of liquid nitrogen.

2. add 500 μ l SDS-Buffer (500mM NaCl, pH 8.0 for 100mM Tris, 50mM EDTA), mixing.Add 20 μ l 20%SDS again, mixing is placed on 65 ℃ of water-baths 10 minutes gently.

3. add 250 μ l 5M KAC, mixing was placed 30 minutes on ice.

4.4 ℃ centrifugal, 12000rpm, 10 minutes.

5. get supernatant, move in the new centrifuge tube, add in isopyknic Virahol, ice bath 5 minutes.

6.4 ℃ centrifugal, 12000rpm, 10 minutes.

7. abandon supernatant, 70% washing with alcohol twice behind the vacuum-drying DNA, adds the dissolving of 40 μ l aseptic double-distilled waters, and-20 ℃ of preservations are subsequent use.

PCR detects

The PCR reaction conditions

94 ℃ of preparatory sex change 5min

72 ℃ are extended 10min

16 ℃ of 1min termination reactions

Detect primer:

Jc1XF：AAAGCCTTATCAGAACTCGC

Jc1XR：GACATCATAGTGCGGGAAGA

Obtain 9 strain resistant plants through resistance screening, extract the resistant plant genome, do template, carry out PCR and detect, obtain 5 strain PCR positive plants (Fig. 6) altogether with it.Extract PCR positive plant soluble proteins, No. 3 the highest 0.21% of the total soluble proteins that account for of the proteic content of plant CryX.(see figure 7)

The biological activity determination of PCR positive plant

The PCR positive plant is transplanted, when plant strain growth to 6～8 leaves, the Pyrausta nubilalis (Hubern). newly hatched larvae is connected in the lobus cardiacus, as negative control, it is other to connect worm 2 all " Invest, Then Investigate "s food leaf-size classes with unconverted plant.The result shows; After manual work connects the worm Pyrausta nubilalis (Hubern).; Insect-resistance performance between the transfer-gen plant individual plant has certain difference: transfer-gen plant shows as resistance to Pyrausta nubilalis (Hubern)., does not have or have only the worm channel (Fig. 8) of very little Pyrausta nubilalis (Hubern). harm, and it is serious that unconverted plant is stung food by Pyrausta nubilalis (Hubern).; The blade worm channel is big and the worm channel number is many, has had influence on the normal growth of plant.

Table 4T ₀Insect-resistance statistics for transfer-gen plant

Claims

1. the cryX gene of transforming, it has the nucleotide sequence shown in SEQ ID NO3.

2. expression vector, it contains the cryX gene of the described transformation of claim 1.

3. statement carrier as claimed in claim 2, it is pUX, structure is as shown in Figure 4.

4. the application of cryX gene in murdering lepidoptera pest of the described transformation of claim 1, said application changes claim 2 or 3 described expression vectors in plant or the mikrobe over to, expresses the characteristic of anti-lepidoptera pest.

5. application as claimed in claim 4, said plant are corn.

6. application as claimed in claim 4, said lepidoptera pest are bollworm, Ostrinia furnacalis, small cabbage moth.