CN102533768B

CN102533768B - siRNA for treating HBV

Info

Publication number: CN102533768B
Application number: CN 201210022628
Authority: CN
Inventors: 田志刚; 韩秋菊; 张彩; 张建
Original assignee: Shandong University
Current assignee: Shandong University
Priority date: 2010-09-16
Filing date: 2010-09-16
Publication date: 2013-03-27
Anticipated expiration: 2030-09-16
Also published as: CN102533768A

Abstract

The invention discloses siRNA (small interfering RNA) for treating HBV (hepatitis B virus), which has a sequence shown in SEQ ID NO.3. The siRNA can be artificially synthesized or synthesized through in vivo transcription. After the siRNA transfects HepG2.2.15 cell for 24 hours and 48 hours, the siRNA can reduce the expression of HBx gene, the content of HBsAg and HBeAg in the cell and supernate is also obviously reduced, and the effect of 3p-siRNA is more obvious than that of chemically synthesized siRNA. The siRNA can be applied to medicaments for resisting the HBV.

Description

A kind of siRNA that treats HBV

Technical field

The present invention relates to the siRNA of a kind of HBV of being used for the treatment of, belong to the genetically engineered field.

Background technology

At present, the whole world has 4.2 hundred million HBV carrier approximately, and it is one of disease that has a strong impact on human health that HBV infects.The generation of chronic HBV infection and hepatic fibrosis, liver cancer is closely related.But most Chronic HBV patient does not achieve desired results under the therapeutic modality of routine.Although Interferon, rabbit can suppress copying of HBV, HBV can pass through to suppress secretion and the function of Interferon, rabbit, thus the Antiviral Mechanism of antagonism body, and finally cause body to be in immune tolerance state.Such as, in chronically infected patient's peripheral blood and liver infiltrating cells, the ratio of regulatory T cells is significantly increased.In addition, HBsAg, HBeAg and other virokine can directly suppress the innate immune response of TLR mediation.The HBV polysaccharase can be blocked the IFN-β secretion of RIG-I and TLR3 mediation.

At present, the RNAi technology has been widely used in anti-HBV research.No matter be cell levels, or the HBV animal model, the siRNA molecule is all obtained obvious anti-HBV effect.The RNAi interference medicament will become the from now on emphasis of research.

Can design a kind of molecule, can specific reticent HBV genes involved, the generation that can induce IFN simultaneously, thus can improve the immune tolerance state that HBV causes.The appearance of the 3p-siRNA that HBx is special is so that such imagination becomes possibility, for the treatment of HBV provides good directive significance.

Summary of the invention

For above-mentioned prior art, for the deficiency of HBV treatment present situation, the invention provides the siRNA of a kind of HBV of being used for the treatment of.

The present invention is achieved by the following technical solutions:

A kind of siRNA that is used for the treatment of HBV, its sequence is shown in SEQ ID NO.1:

SEQ ID NO.1：GGUCUUACAUAAGAGGACU。

Or: shown in SEQ ID NO.2:

SEQ ID NO.2：GGACGUCCUUUGUUUACGU。

Or: shown in SEQ ID NO.3:

SEQ ID NO.3：CCGACCUUGAGGCAUACUU。

The siRNA that is used for the treatment of HBV of the present invention prepares by the following method:

1.siRNA design

(1) at first analyzing the HBV hypotype of studying is the ayw type, and its sequence is shown in SEQ ID NO.4.

(2) for the sequence of HBV x gene, design is used the siRNA design software for the reticent RNA of the specificity of HBV x gene, sets correlation parameter and comprises that the length of siRNA is 19 base sequences; The GC ratio is between 35-50.Utilize BLAST to carry out the comparison of gene database potential sequence, get rid of the sequence with other encoding sequence homologies.

(3) chemosynthesis siRNA is directly synthetic by the sharp rich company in Guangzhou, and its target spot is identical with 3p-siRNA, and sequence sees Table 1, and sequence table SEQ ID NO.1-SEQ ID NO.3.

Table 1 chemosynthesis siRNA sequence

Name	Type	Sequence 5′-＞3
			siRNA1-sense	RNA	GGUCUUACAUAAGAGGACUdTdT
siRNA1-sense	RNA	AGTCCTCTTATGTAAGACCdTdT
			siRNA2-sense	RNA	GGACGUCCUUUGUUUACGUdTdT
siRNA2-ansense	RNA	ACGTAAACAAAGGACGTCCdTdT
			siRNA3-sense	RNA	CCGACCUUGAGGCAUACUUdTdT
siRNA3-ansense	RNA	AAGUAUGCCUCAAGGUCGGdTdT

(4) the synthetic required dna profiling design of 3p-siRNA: (5 ' extreme direction) adds 6 bases G ATCAC before the T7 Promoter sequence.

2.3p-siRNA preparation process

(1) corresponding single stranded DNA (synthetic by the Beijing Liuhe Huada Genomics Technology Co., Ltd) sequence of the HBx-siRNA sequence of synthetic subsidiary T7promoter sees Table 2.

Table 2 is used for the dna profiling of in-vitro transcription

Name	Type	Sequence 5′-＞3
			siRNA-1GGGs-s	DNA	GATCACTAATACGACTCACTATAGGGGGTCTTACATAAGAGGACTTT
siRNA-1GGGs-a	DNA	AAAGTCCTCTTATGTAAGACCCCCTATAGTGAGTCGTATTAGTGATC
			siRNA-1GGGa-a	DNA	AAGGTCTTACATAAGAGGACTCCCTATAGTGAGTCGTATTAGTGATC
siRNA-1GGGa-s	DNA	GATCACTAATACGACTCACTATAGGGAGTCCTCTTATGTAAGACCTT
			siRNA-2GGGs-s	DNA	GATCACTAATACGACTCACTATAGGGGGACGTCCTTTGTTTACGTTT
siRNA-2GGGs-a	DNA	AAACGTAAACAAAGGACGTCCCCCTATAGTGAGTCGTATTAGTGATC
			siRNA-2GGGa-a	DNA	AAGGACGTCCTTTGTTTACGTCCCTATAGTGAGTCGTATTAGTGATC
siRNA-2GGGa-s	DNA	GATCACTAATACGACTCACTATAGGGACGTAAACAAAGGACGTCCTT
			siRNA-3GGGs-s	DNA	GATCACTAATACGACTCACTATAGGGCCGACCTTGAGGCATACTTTT
siRNA-3GGGs-a	DNA	AAAAGTATGCCTCAAGGTCGGCCCTATAGTGAGTCGTATTAGTGATC
			siRNA-3GGGa-a	DNA	AACCGACCTTGAGGCATACTTCCCTATAGTGAGTCGTATTAGTGATC
siRNA-3GGGa-s	DNA	GATCACTAATACGACTCACTATAGGGAAGTATGCCTCAAGGTCGGTT

(2) preparation of double-stranded Oligo DNA (the in-vitro transcription test kit is available from Takara company).

1. synthetic strand Oligo DNA is processed water dissolution with DEPC, be mixed with the dna solution of 100pmol/ μ l.

2. by following component preparation Oligo DNA annealing reaction liquid, as shown in table 3;

Table 3

10×Annealing Buffer	2μl
		100pmol/μl Oligo A*	2μl
100pmol/μl Oligo B*	2μl
		DEPC processes H ₂O	14μl

* A, B must match, and the situation of specifically matching is as follows:

Oligo-1 and Oligo-2; Oligo-3 and Oligo-4;

N-Oligo-1 and n-Oligo-2; N-Oligo-3 and n-Oligo-4.

Above-mentioned Oligo DNA annealing reaction liquid is placed on the pcr amplification instrument, process after 2 minutes for 95 ℃, be cooled to 25 ℃ through 45 minutes, then kept 10 minutes at 25 ℃.This moment, a pair of strand Oligo DNA just formed double-stranded Oligo DNA through annealing, and the concentration of double-stranded Oligo DNA is: 10pmol/ μ l.Use after this solution dilution (using DEPC to process water) should being become 4pmol/ μ l when carrying out In vitro transcription.

(3) in-vitro transcription reaction

1. by following component preparation RNA in-vitro transcription reaction solution, as shown in table 4:

Table 4

10×Transcription Buffer	2μl
		ATP Solution	2μl
GTP Solution	2μl
		CTP Solution	2μl
UTP Solution	2μl
		RNase Inhibitor	0.5μl
T7 RNA Polymerase	2μl
		RNase free ddH ₂O	5.5μl

Double-stranded Oligo dna solution (Oligo-1/-2) * of 4pmol/ μ l	1μl
		Double-stranded Oligo dna solution (Oligo-3/-4) * of 4pmol/ μ l	1μl
Add up to	20μl

2. slightly centrifugal after mentioned solution evenly being mixed, responsive transcription liquid is collected in the reaction tubes bottom, 42 ℃ were reacted 16 hours.

(4) purifying of siRNA

1. in above-mentioned reaction solution, add water saturated acid phenol/chloroform/primary isoamyl alcohol (25: 24: 1), fully be inverted up and down and mix rear room temperature, 10,000rpm, centrifugal 5 minutes.

2. upper strata (water layer) moved in another new 1.5ml centrifuge tube, add 99.5% ethanol of the sodium-acetate (pH5.6) of 5M of equivalent and 4 times of amounts.

3. after room temperature leaves standstill 5 minutes, 4 ℃, centrifugal 10 minutes of 12,000rpm.

4. remove the ethanol that adds 1ml 75% after the supernatant liquor, 4 ℃, centrifugal 5 minutes of 12,000rpm

5. remove supernatant liquor, the DEPC of the slight dry rear 50 μ l of adding processes the water dissolution precipitation.

6. get 1 μ l and dilute 10 times with DEPC water, wherein 2 μ l are used for measuring the OD260nm value, and remaining 8 μ l carry out 4% agarose gel electrophoresis affirmation RNA purity.

7. according to the concentration of measuring, the mentioned solution dilution for 20pmol/ μ l solution, is carried out the RNA interference experiment.

(the above-mentioned precipitation that obtains in 5. namely is 3p-siRNA, and its sequence is seen sequence table SEQ ID NO.1-SEQ ID NO.3)

Above-mentioned experimental technique if no special instructions, all adopts this area normal experiment method, and above-mentioned experiment reagent is the commercially available prod.

(both do not have difference in sequence to the present inventor with the above-mentioned chemosynthesis siRNA that obtains and the 3p-siRNA of in-vitro transcription, unique difference be exactly in-vitro transcription 5 ' triphosphoric acid is arranged) behind transfection HepG2.2.15 cell 24h and the 48h, the expression that discovery all can be reduced the HBx gene, the content of HBsAg and HBeAg also obviously descends in the cell and in the supernatant, and more remarkable than chemosynthesis of the action effect of 3p-siRNA.

The 3p-siRNA of siRNA of the present invention, especially in-vitro transcription, behind the transfection HepG2.2.15 cell, the activation of RIG-I path can be obviously induced in discovery, and the generation of inducing interferon and antiviral protein is so that it is more obvious in anti-HBV effect.Can be used as the medicinal application of anti-HBV.

Description of drawings

Fig. 1 is the electrophorogram of in-vitro transcription 3p-siRNA.

Fig. 2 is that the silence effect of HBx-3p-siRNA in the HepG2.2.15 cell detects.

Fig. 3 is the content that 3p-siRNA can suppress the HBsAg in the cell conditioned medium.

Fig. 4 be 3p-siRNA can suppress in the cell conditioned medium the content of HBeAg.

Fig. 5 is the expression that 3p-siRNA can suppress intracellular HBsAg, wherein, and A:siRNA1; B:siRNA2; C:siRNA3; D:3p-siRNA1; E:3p-siRNA2; F:3p-siRNA3; G:Scramble.

Fig. 6 is the expression that 3p-siRNA can suppress intracellular HBcAg, wherein, and A:siRNA1; B:siRNA2; C:siRNA3; D:3p-siRNA1; E:3p-siRNA2; F:3p-siRNA3; G:Scramble.

Fig. 7 is obviously inducing interferon generation of 3p-siRNA, and wherein, A shows that than chemosynthesis siRNA, 3p-siRNA more obviously induces the generation of IFN-α mRNA; What B figure represented is that IFN-β is in the expression of mRNA level; What C figure showed is that luciferase reporter gene detects inducing of IFN-β.

Fig. 8 is the obviously generation of inducing anti-disease toxalbumin of 3p-siRNA, and wherein, A shows that 3p-siRNA can induce the expression of RIG-I, simultaneously the expression of energy inducing anti-disease toxalbumin MxA and ISG15; B shows that 3p-siRNA can activate the MAPK signal path; C shows that 3p-siRNA can activate NF-κ B signal path.

Embodiment

Following examples will help those of ordinary skill in the art further to understand the present invention, but not limit in any form the present invention.

Experimental technique among the embodiment if no special instructions, all adopts this area routine techniques, and experiment reagent is the commercially available prod.

Embodiment

1, chemosynthesis siRNA's is synthetic:

Design siRNA for the HBV X gene: according to the siRNA principle of design three couples of siRNA are transferred to directly synthetic siRNA sequence of the sharp rich company in Guangzhou, see Table 1, and sequence table SEQ ID NO.1-SEQ ID NO.3.

2, the in-vitro transcription of 3p-siRNA:

(1) target spot and sequence and chemosynthesis siRNA are in full accord.

(2) the corresponding single stranded DNA of HBx-siRNA sequence of synthetic subsidiary T7 promoter sees Table 2.

(3) preparation of double-stranded Oligo DNA: synthetic strand Oligo DNA is processed water dissolution with DEPC, be mixed with the dna solution of 100pmol/ μ l.

1. press the preparation of component shown in the table 3 Oligo DNA annealing reaction liquid.

2. above-mentioned Oligo DNA annealing reaction liquid is placed on the pcr amplification instrument, process after 2 minutes for 95 ℃, be cooled to 25 ℃ through 45 minutes, then kept 10 minutes at 25 ℃.This moment, a pair of strand Oligo DNA just formed double-stranded Oligo DNA through annealing, and the concentration of double-stranded Oligo DNA is: 10pmol/ μ l.Use after this solution dilution (using DEPC to process water) should being become 4pmol/ μ l when carrying out In vitro transcription.

(4) in-vitro transcription reaction

1. press the preparation of component shown in the table 4 RNA in-vitro transcription reaction solution.

(5) purifying of siRNA

4. remove the ethanol that adds 1ml 75% after the supernatant liquor, 4 ℃, centrifugal 5 minutes of 12,000rpm.

6. get 1 μ l and dilute 10 times with DEPC water, wherein 2 μ l are used for measuring the OD260nm value, and remaining 8 μ l carry out 4% agarose gel electrophoresis affirmation RNA purity, and as shown in Figure 1, as can be seen from Figure 1,3p-siRNA successfully transcribes, and clip size is 21bp.

3,3p-siRNA can suppress the expression of HBx

With the HepG2.2.15 cell as research object, use Lipofectamin 2000 (available from invitrogen) to carry out the transfection of chemosynthesis siRNA and in-vitro transcription 3p-siRNA, behind the transfection 24h, extract cell total rna, carry out quantitative pcr amplification HBV X gene with primer with 5 ' end primer 5 '-CCGTCTGTGCCTTCTCATCTGC-3 ' and 3 ' end primer 5 '-ACCAATTTATGCCTACAGCCTCC-3 '.The PCR reaction conditions is: 95 ℃ of denaturation 10min; 95 ℃ of sex change 30s, 60 ℃ of annealing 30s, 72 ℃ are extended 30s, 45 circulations.The expression level of HBx, GAPDH compares as confidential reference items, and as shown in Figure 2, among Fig. 2, X-coordinate represents respectively the different treatment group of siRNA, 3p-siRNA, and ordinate zou represents HBx with respect to the expression of reference gene GAPDH.As can be seen from Figure 2, siRNA and 3p-siRNA all can obviously suppress the expression of HBV X gene, and the inhibition of 3p-siRNA is more obvious.

4,3p-siRNA can suppress the copying of HBV in the cell conditioned medium

Behind the transfection HepG2.2.15 cell, behind the transfection 3p-siRNA24h, with the HBV DNA copy number in the quantitative PCR detection supernatant.Get cell conditioned medium liquid, add isopyknic DNA concentrated solution, fully mixing; Boiled centrifugal 5 minutes of 12,000rpm 10 minutes; Supernatant liquor is used for being PCR.The Auele Specific Primer of HBV S is: upstream 5 ' ATCCTGCTGCTATGCCTCATCTT 3 ', downstream 5 ' ACAGGGGGAAAGCCCTACGAA 3 '; Fluorescent probe is 5 ' FAM-TGGCTAGTTTACAGTGCCATTTG TAMRA 3 ', and as cancellation fluorescence, reaction conditions is 93 ℃ of denaturations 2 minutes to the FAM fluorophor as fluorescence report TAMRA; 95 ℃ of sex change 30s, 55 ℃ of annealing 45s, 45 circulations.

5,3p-siRNA can suppress the content of the HBsAg in the cell conditioned medium

With the HepG2.2.15 cell as research object, use Lipofectamin 2000 to carry out the transfection of 3p-siRNA, behind the transfection 48h, the collecting cell supernatant, with the content of the HBsAg in the ELISA test kit detection supernatant, as shown in Figure 3, among Fig. 3, X-coordinate represents respectively the different treatment group of siRNA, 3p-siRNA, and ordinate zou represents the content of HBsAg.As can be seen from Figure 3, siRNA and 3p-siRNA all can obviously suppress the content of HBsAg in the cell conditioned medium, and the inhibition of 3p-siRNA is more obvious.

6,3p-siRNA can suppress in the cell conditioned medium the content of HBeAg

With the HepG2.2.15 cell as research object, use Lipofectamin 2000 to carry out the transfection of 3p-siRNA, behind the transfection 48h, the collecting cell supernatant, with the content of the HBsAg in the ELISA test kit detection supernatant, as shown in Figure 4, among Fig. 4, X-coordinate represents respectively the different treatment group of siRNA, 3p-siRNA, and ordinate zou represents the content of HBeAg.As can be seen from Figure 4, siRNA and 3p-siRNA all can obviously suppress the content of HBeAg in the cell conditioned medium, and the inhibition of 3p-siRNA is more obvious.

7,3p-siRNA can suppress the expression of intracellular HBsAg

With the HepG2.2.15 cell as research object, use Lipofectamin 2000 to carry out the transfection of 3p-siRNA, behind the transfection 48h, the collecting cell supernatant, with the expression of HBsAg in the ImmunohistochemistryMethods Methods detection cell, as shown in Figure 5, as can be seen from Figure 5, siRNA and 3p-siRNA all can obviously suppress the expression of HBsAg in the born of the same parents, and the inhibition of 3p-siRNA is more obvious.

8,3p-siRNA can suppress the expression of intracellular HBcAg

With the HepG2.2.15 cell as research object, use Lipofectamin 2000 to carry out the transfection of 3p-siRNA, behind the transfection 48h, the collecting cell supernatant, with the expression of HBsAg in the ImmunohistochemistryMethods Methods detection cell, as shown in Figure 6, as can be seen from Figure 6, siRNA and 3p-siRNA all can obviously suppress the expression of HBcAg in the born of the same parents, and the inhibition of 3p-siRNA is more obvious.

9, the obviously generation of inducing interferon of 3p-siRN

Analyze 3p-siRNA and can obviously suppress copying and expressing of HBV.Analyze its mechanism, show at 3p-siRNA in performance RNAi effect the obviously generation of inducing interferon and antiviral protein.With the HepG2.2.15 cell as research object, use Lipofectamin 2000 to carry out the transfection of 3p-siRNA, behind the transfection 24h, detect the abduction delivering of Interferon, rabbit with the method for quantitative PCR method and fluorescein reporter gene, as shown in Figure 7, wherein, X-coordinate represents respectively the different treatment group of siRNA, 3p-siRNA, and A figure ordinate zou represents IFN-α with respect to the expression of reference gene GAPDH; B figure ordinate zou represents IFN-β with respect to the expression of reference gene GAPDH; C figure ordinate zou represents the multiple of inducing of IFN-β.As can be seen from Figure 7, siRNA and 3p-siRNA all can cause the abduction delivering of Interferon, rabbit, and 3p-siRNA induce effect more obvious.

10, the obviously generation of antiviral protein of 3p-siRNA

With the HepG2.2.15 cell as research object, use Lipofectamin 2000 to carry out the transfection of 3p-siRNA, behind the transfection 48h, detect the abduction delivering of antiviral protein with Western blot method, as shown in Figure 8, as can be seen from Figure 8,3p-siRNA is the expression of inducing anti-disease toxalbumin obviously, and this inducing action is induced RIG-I with 3p-siRNA and activate the MAPK in RIG-I downstream relevant with NF-κ B signal path.

Claims

1. siRNA who treats HBV, it is characterized in that: its sequence is shown in SEQ ID NO.3: SEQ ID NO.3:CCGACCUUGAGGCAUACUU.