CN102533768A - siRNA for treating HBV - Google Patents
siRNA for treating HBV Download PDFInfo
- Publication number
- CN102533768A CN102533768A CN2012100226282A CN201210022628A CN102533768A CN 102533768 A CN102533768 A CN 102533768A CN 2012100226282 A CN2012100226282 A CN 2012100226282A CN 201210022628 A CN201210022628 A CN 201210022628A CN 102533768 A CN102533768 A CN 102533768A
- Authority
- CN
- China
- Prior art keywords
- sirna
- hbv
- cell
- dna
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses siRNA (small interfering RNA) for treating HBV (hepatitis B virus), which has a sequence shown in SEQ ID NO.3. The siRNA can be artificially synthesized or synthesized through in vivo transcription. After the siRNA transfects HepG2.2.15 cell for 24 hours and 48 hours, the siRNA can reduce the expression of HBx gene, the content of HBsAg and HBeAg in the cell and supernate is also obviously reduced, and the effect of 3p-siRNA is more obvious than that of chemically synthesized siRNA. The siRNA can be applied to medicaments for resisting the HBV.
Description
Technical field
The present invention relates to a kind of siRNA that is used to treat HBV, belong to the genetically engineered field.
Background technology
At present, the whole world has 4.2 hundred million HBV carrier approximately, and it is one of disease that has a strong impact on human health that HBV infects.The generation of chronic HBV infection and hepatic fibrosis, liver cancer is closely related.But most Chronic HBV patient does not achieve desired results under the therapeutic modality of routine.Although Interferon, rabbit can suppress duplicating of HBV, HBV can pass through to suppress the secretion and the function of Interferon, rabbit, thus the antiviral mechanism of antagonism body, and finally cause body to be in immune tolerance state.Such as, to soak in the cell chronically infected patient's peripheral blood and liver, the ratio of regulatory T cells has obvious increase.In addition, HBsAg, HBeAg and other the virokine inherent immunity that can directly suppress TLR mediation is replied.The HBV polysaccharase can be blocked the IFN-β secretion of RIG-I and TLR3 mediation.
At present, the RNAi technology has been widely used in anti-HBV research.No matter be cell levels, or the HBV animal model, the siRNA molecule is all obtained tangible anti-HBV effect.The RNAi interference medicament will become emphasis of future research.
Can design a kind of molecule, can specific reticent HBV genes involved, the generation that can induce IFN simultaneously, thus can improve the immune tolerance state that HBV causes.The appearance of the 3p-siRNA that HBx is special makes such imagination become possibility, for the treatment of HBV provides better guide significance.
Summary of the invention
To above-mentioned prior art, the deficiency to HBV treatment present situation the invention provides a kind of siRNA that is used to treat HBV.
The present invention realizes through following technical scheme:
A kind of siRNA that is used to treat HBV, its sequence is shown in SEQ ID NO.1:
SEQ?ID?NO.1：GGUCUUACAUAAGAGGACU。
Or: shown in SEQ ID NO.2:
SEQ?ID?NO.2：GGACGUCCUUUGUUUACGU。
Or: shown in SEQ ID NO.3:
SEQ?ID?NO.3：CCGACCUUGAGGCAUACUU。
The siRNA that is used to treat HBV of the present invention prepares through following method:
1.siRNA design
(1) at first analyzing the HBV hypotype of being studied is the ayw type, and its sequence is shown in SEQ ID NO.4.
(2) to the sequence of HBV x gene, design is used the siRNA design software to the reticent RNA of the specificity of HBV x gene, sets correlation parameter and comprises that the length of siRNA is 19 base sequences; The GC ratio is between 35-50.Utilize BLAST to carry out the comparison of gene database the potential sequence, get rid of and other encoding sequence homologous sequences.
(3) chemosynthesis siRNA is directly synthetic by the sharp rich company in Guangzhou, and its target spot is identical with 3p-siRNA, and sequence is seen table 1, and sequence table SEQ ID NO.1-SEQ ID NO.3.
Table 1 chemosynthesis siRNA sequence
| Name | Type | Sequence?5′-＞3 |
| siRNA1-sense | RNA | GGUCUUACAUAAGAGGACUdTdT |
| siRNA1-sense | RNA | AGTCCTCTTATGTAAGACCdTdT |
| siRNA2-sense | RNA | GGACGUCCUUUGUUUACGUdTdT |
| siRNA2-ansense | RNA | ACGTAAACAAAGGACGTCCdTdT |
| siRNA3-sense | RNA | CCGACCUUGAGGCAUACUUdTdT |
| siRNA3-ansense | RNA | AAGUAUGCCUCAAGGUCGGdTdT |
(4) the synthetic required dna profiling design of 3p-siRNA: (5 ' extreme direction) added 6 bases G ATCAC before the T7Promoter sequence.
2.3p-siRNA the preparation process
(1) the corresponding single stranded DNA of HBx-siRNA sequence of synthetic subsidiary T7promoter (synthetic by the Beijing Liuhe Huada Genomics Technology Co., Ltd) sequence is seen table 2.
Table 2 is used for the dna profiling of in-vitro transcription
| Name | Type | Sequence?5′-＞3 |
| siRNA-1GGGs-s | DNA | GATCACTAATACGACTCACTATAGGGGGTCTTACATAAGAGGACTTT |
| siRNA-1GGGs-a | DNA | AAAGTCCTCTTATGTAAGACCCCCTATAGTGAGTCGTATTAGTGATC |
| siRNA-1GGGa-a | DNA | AAGGTCTTACATAAGAGGACTCCCTATAGTGAGTCGTATTAGTGATC |
| siRNA-1GGGa-s | DNA | GATCACTAATACGACTCACTATAGGGAGTCCTCTTATGTAAGACCTT |
| siRNA-2GGGs-s | DNA | GATCACTAATACGACTCACTATAGGGGGACGTCCTTTGTTTACGTTT |
| siRNA-2GGGs-a | DNA | AAACGTAAACAAAGGACGTCCCCCTATAGTGAGTCGTATTAGTGATC |
| siRNA-2GGGa-a | DNA | AAGGACGTCCTTTGTTTACGTCCCTATAGTGAGTCGTATTAGTGATC |
| siRNA-2GGGa-s | DNA | GATCACTAATACGACTCACTATAGGGACGTAAACAAAGGACGTCCTT |
| siRNA-3GGGs-s | DNA | GATCACTAATACGACTCACTATAGGGCCGACCTTGAGGCATACTTTT |
| siRNA-3GGGs-a | DNA | AAAAGTATGCCTCAAGGTCGGCCCTATAGTGAGTCGTATTAGTGATC |
| siRNA-3GGGa-a | DNA | AACCGACCTTGAGGCATACTTCCCTATAGTGAGTCGTATTAGTGATC |
| siRNA-3GGGa-s | DNA | GATCACTAATACGACTCACTATAGGGAAGTATGCCTCAAGGTCGGTT |
[0025](2) preparation of double-stranded Oligo DNA (the in-vitro transcription test kit is available from Takara company).
1. synthetic strand Oligo DNA is dissolved with the DEPC treating water, be mixed with the dna solution of 100pmol/ μ l.
2. by following component preparation Oligo DNA annealing reaction liquid, as shown in table 3;
Table 3
| 10×Annealing?Buffer | 2μl |
| 100pmol/μl?Oligo?A * | 2μl |
| 100pmol/μl?Oligo?B * | 2μl |
| DEPC handles H 2O | 14μl |
*A, B must match, and the situation of specifically matching is following:
Oligo-1 and Oligo-2; Oligo-3 and Oligo-4;
N-Oligo-1 and n-Oligo-2; N-Oligo-3 and n-Oligo-4.
Above-mentioned Oligo DNA annealing reaction liquid is placed on the pcr amplification appearance, handle after 2 minutes for 95 ℃, be cooled to 25 ℃, kept 10 minutes at 25 ℃ then through 45 minutes.This moment, a pair of strand Oligo DNA just formed double-stranded Oligo DNA through annealing, and the concentration of double-stranded Oligo DNA is: 10pmol/ μ l.Use after should this solution dilution (using the DEPC treating water) being become 4pmol/ μ l when carrying out the in-vitro transcription experiment.
(3) in-vitro transcription reaction
1. by following component preparation RNA in-vitro transcription reaction solution, as shown in table 4:
Table 4
| 10×Transcription?Buffer | 2μl |
| ATP?Solution | 2μl |
| GTP?Solution | 2μl |
| CTP?Solution | 2μl |
| UTP?Solution | 2μl |
| RNase?Inhibitor | 0.5μl |
| T7RNA?Polymerase | 2μl |
| RNase?free?ddH 2O | 5.5μl |
[0038]
| The double-stranded Oligo DNA solution (Oligo-1/-2) of 4pmol/ μ l * | 1 μ l |
| The double-stranded Oligo DNA solution (Oligo-3/-4) of 4pmol/ μ l * | 1 μ l |
| Add up to | 20 μ l |
2. with slightly centrifugal behind the above-mentioned solution uniform mixing, responsive transcription liquid is collected in the reaction tubes bottom, 42 ℃ were reacted 16 hours.
(4) purifying of siRNA
1. in above-mentioned reaction solution, add water saturated acid phenol/chloroform/primary isoamyl alcohol (25: 24: 1), fully be inverted up and down and mix back room temperature, 10,000rpm, centrifugal 5 minutes.
2. upper strata (water layer) moved in another new 1.5ml centrifuge tube, add 99.5% the ethanol of sodium-acetate (pH5.6) and 4 times of amounts of the 5M of equivalent.
3. after room temperature leaves standstill 5 minutes, 4 ℃, 12, centrifugal 10 minutes of 000rpm.
4. remove the ethanol that adds 1ml 75% after the supernatant, 4 ℃, 12, centrifugal 5 minutes of 000rpm
5. remove supernatant, slight dry back adds the DEPC treating water dissolution precipitation of 50 μ l.
6. get 1 μ l with 10 times of DEPC water dilutions, wherein 2 μ l are used to measure the OD260nm value, and remaining 8 μ l carry out 4% agarose gel electrophoresis affirmation RNA purity.
7. according to the concentration of measuring, be 20pmol/ μ l solution, carry out the RNA interference experiment above-mentioned solution dilution.
(the above-mentioned deposition that obtains in 5. promptly is 3p-siRNA, and its sequence is seen sequence table SEQ ID NO.1-SEQ ID NO.3)
Above-mentioned experimental technique if no special instructions, all adopts this area normal experiment method, and above-mentioned experiment reagent is the commercially available prod.
(both do not have difference to contriver of the present invention on sequence with the 3p-siRNA of above-mentioned chemosynthesis siRNA that obtains and in-vitro transcription; Unique difference be exactly in-vitro transcription 5 ' triphosphoric acid is arranged) behind transfection HepG2.2.15 cell 24h and the 48h; Find all can reduce the HBx expression of gene; The also obviously decline of content of HBsAg and HBeAg in the cell and in the supernatant, and the action effect of 3p-siRNA more remarkable than chemosynthesis.
The 3p-siRNA of siRNA of the present invention, especially in-vitro transcription, behind the transfection HepG2.2.15 cell, the activation of RIG-I path can be obviously induced in discovery, and the generation of inducing interferon and antiviral protein makes it more obvious in anti-HBV effect.Can be used as the medicinal application of anti-HBV.
Description of drawings
Fig. 1 is the electrophorogram of in-vitro transcription 3p-siRNA.
Fig. 2 is that the silence effect of HBx-3p-siRNA in the HepG2.2.15 cell detects.
Fig. 3 can suppress the content of the HBsAg in the cell conditioned medium for 3p-siRNA.
Fig. 4 for 3p-siRNA can suppress in the cell conditioned medium the content of HBeAg.
Fig. 5 can suppress the expression of intracellular HBsAg for 3p-siRNA, wherein, and A:siRNA1; B:siRNA2; C:siRNA3; D:3p-siRNA1; E:3p-siRNA2; F:3p-siRNA3; G:Scramble.
Fig. 6 can suppress the expression of intracellular HBcAg for 3p-siRNA, wherein, and A:siRNA1; B:siRNA2; C:siRNA3; D:3p-siRNA1; E:3p-siRNA2; F:3p-siRNA3; G:Scramble.
Fig. 7 is obviously inducing interferon generation of 3p-siRNA, and wherein, A shows that than chemosynthesis siRNA, 3p-siRNA more obviously induces the generation of IFN-α mRNA; What B figure represented is the expression of IFN-β in the mRNA level; What C figure showed is that luciferase reporter gene detects inducing of IFN-β.
Fig. 8 is the obviously generation of inducing anti-disease toxalbumin of 3p-siRNA, and wherein, A shows that 3p-siRNA can induce the expression of RIG-I, simultaneously the expression of ability inducing anti-disease toxalbumin MxA and ISG15; B shows that 3p-siRNA can activate the MAPK signal path; C shows that 3p-siRNA can activate NF-κ B signal path.
Embodiment
Following examples will help those of ordinary skill in the art further to understand the present invention, but not limit the present invention in any form.
Experimental technique among the embodiment if no special instructions, all adopts this area routine techniques, and experiment reagent is the commercially available prod.
Embodiment
1, chemosynthesis siRNA's is synthetic:
Design siRNA to the HBV X gene: according to the siRNA principle of design three couples of siRNA are transferred to the directly synthetic siRNA sequence of the sharp rich company in Guangzhou, see table 1, and sequence table SEQ ID NO.1-SEQ ID NO.3.
2, the in-vitro transcription of 3p-siRNA:
(1) target spot and sequence and chemosynthesis siRNA are in full accord.
(2) the corresponding single stranded DNA of HBx-siRNA sequence of synthetic subsidiary T7promoter is seen table 2.
(3) preparation of double-stranded Oligo DNA: synthetic strand Oligo DNA with the dissolving of DEPC treating water, is mixed with the dna solution of 100pmol/ μ l.
1. press the preparation of component shown in the table 3 Oligo DNA annealing reaction liquid.
2. above-mentioned Oligo DNA annealing reaction liquid is placed on the pcr amplification appearance, handle after 2 minutes for 95 ℃, be cooled to 25 ℃, kept 10 minutes at 25 ℃ then through 45 minutes.This moment, a pair of strand Oligo DNA just formed double-stranded Oligo DNA through annealing, and the concentration of double-stranded Oligo DNA is: 10pmol/ μ l.Use after should this solution dilution (using the DEPC treating water) being become 4pmol/ μ l when carrying out the in-vitro transcription experiment.
(4) in-vitro transcription reaction
1. press the preparation of component shown in the table 4 RNA in-vitro transcription reaction solution.
2. with slightly centrifugal behind the above-mentioned solution uniform mixing, responsive transcription liquid is collected in the reaction tubes bottom, 42 ℃ were reacted 16 hours.
(5) purifying of siRNA
1. in above-mentioned reaction solution, add water saturated acid phenol/chloroform/primary isoamyl alcohol (25: 24: 1), fully be inverted up and down and mix back room temperature, 10,000rpm, centrifugal 5 minutes.
2. upper strata (water layer) moved in another new 1.5ml centrifuge tube, add 99.5% the ethanol of sodium-acetate (pH5.6) and 4 times of amounts of the 5M of equivalent.
3. after room temperature leaves standstill 5 minutes, 4 ℃, 12, centrifugal 10 minutes of 000rpm.
4. remove the ethanol that adds 1ml 75% after the supernatant, 4 ℃, 12, centrifugal 5 minutes of 000rpm.
5. remove supernatant, slight dry back adds the DEPC treating water dissolution precipitation of 50 μ l.
6. get 1 μ l with 10 times of DEPC water dilutions, wherein 2 μ l are used to measure the OD260nm value, and remaining 8 μ l carry out 4% agarose gel electrophoresis affirmation RNA purity, and as shown in Figure 1, as can beappreciated from fig. 1,3p-siRNA successfully transcribes, and clip size is 21bp.
7. according to the concentration of measuring, be 20pmol/ μ l solution, carry out the RNA interference experiment above-mentioned solution dilution.
3,3p-siRNA can suppress the expression of HBx
With the HepG2.2.15 cell as research object; Use Lipofectamin 2000 (available from invitrogen) to carry out the transfection of chemosynthesis siRNA and in-vitro transcription 3p-siRNA; Behind the transfection 24h; Extract cell total rna, carry out quantitative pcr amplification HBV X gene with 5 ' end primer 5 '-CCGTCTGTGCCTTCTCATCTGC-3 ' and 3 ' end primer 5 '-ACCAATTTATGCCTACAGCCTCC-3 ' with primer.The PCR reaction conditions is: 95 ℃ of preparatory sex change 10min; 95 ℃ of sex change 30s, 60 ℃ of annealing 30s, 72 ℃ are extended 30s, 45 circulations.The expression level of HBx, GAPDH compares as confidential reference items, and is as shown in Figure 2, and among Fig. 2, X-coordinate is represented siRNA, treatment group that 3p-siRNA is different respectively, and ordinate zou is represented the expression of HBx with respect to internal control gene GAPDH.As can beappreciated from fig. 2, siRNA and 3p-siRNA all can obviously suppress the expression of HBV X gene, and the inhibition effect of 3p-siRNA is more obvious.
4,3p-siRNA can suppress the duplicating of HBV in the cell conditioned medium
Behind the transfection HepG2.2.15 cell, behind the transfection 3p-siRNA24h, with the HBV DNA copy number in the quantitative PCR detection supernatant.Get cell conditioned medium liquid, add isopyknic DNA liquid concentrator, fully mixing; Boiled 10 minutes, 12, centrifugal 5 minutes of 000rpm; Supernatant is used to be PCR.The Auele Specific Primer of HBV S is: the upper reaches 5 ' ATCCTGCTGCTATGCCTCATCTT 3 ', downstream 5 ' ACAGGGGGAAAGCCCTACGAA 3 '; Fluorescent probe is 5 ' FAM-TGGCTAGTTTACAGTGCCATTTG TAMRA 3 ', and as cancellation fluorescence, reaction conditions is 93 ℃ of preparatory sex change 2 minutes to the FAM fluorophor as fluorescence report TAMRA; 95 ℃ of sex change 30s, 55 ℃ of annealing 45s, 45 circulations.
5,3p-siRNA can suppress the content of the HBsAg in the cell conditioned medium
As research object, use Lipofectamin 2000 to carry out the transfection of 3p-siRNA, behind the transfection 48h with the HepG2.2.15 cell; The collecting cell supernatant; With the content of the HBsAg in the ELISA test kit detection supernatant, as shown in Figure 3, among Fig. 3; X-coordinate is represented siRNA, treatment group that 3p-siRNA is different respectively, and ordinate zou is represented the content of HBsAg.As can beappreciated from fig. 3, siRNA and 3p-siRNA all can obviously suppress the content of HBsAg in the cell conditioned medium, and the inhibition effect of 3p-siRNA is more obvious.
6,3p-siRNA can suppress in the cell conditioned medium the content of HBeAg
As research object, use Lipofectamin 2000 to carry out the transfection of 3p-siRNA, behind the transfection 48h with the HepG2.2.15 cell; The collecting cell supernatant; With the content of the HBsAg in the ELISA test kit detection supernatant, as shown in Figure 4, among Fig. 4; X-coordinate is represented siRNA, treatment group that 3p-siRNA is different respectively, and ordinate zou is represented the content of HBeAg.As can beappreciated from fig. 4, siRNA and 3p-siRNA all can obviously suppress the content of HBeAg in the cell conditioned medium, and the inhibition effect of 3p-siRNA is more obvious.
7,3p-siRNA can suppress the expression of intracellular HBsAg
As research object, use Lipofectamin 2000 to carry out the transfection of 3p-siRNA, behind the transfection 48h with the HepG2.2.15 cell; The collecting cell supernatant; With the expression of HBsAg in the immunohistochemical methods method detection cell, as shown in Figure 5, as can beappreciated from fig. 5; SiRNA and 3p-siRNA all can obviously suppress the expression of HBsAg in the born of the same parents, and the inhibition effect of 3p-siRNA is more obvious.
8,3p-siRNA can suppress the expression of intracellular HBcAg
As research object, use Lipofectamin 2000 to carry out the transfection of 3p-siRNA, behind the transfection 48h with the HepG2.2.15 cell; The collecting cell supernatant; With the expression of HBsAg in the immunohistochemical methods method detection cell, as shown in Figure 6, as can beappreciated from fig. 6; SiRNA and 3p-siRNA all can obviously suppress the expression of HBcAg in the born of the same parents, and the inhibition effect of 3p-siRNA is more obvious.
9, the obviously generation of inducing interferon of 3p-siRN
Analyze 3p-siRNA and can obviously suppress duplicating and expressing of HBV.Analyze its mechanism, be illustrated in 3p-siRNA in performance RNAi effect, the obviously generation of inducing interferon and antiviral protein.With the HepG2.2.15 cell as research object; Use Lipofectamin 2000 to carry out the transfection of 3p-siRNA, behind the transfection 24h, detect the abduction delivering of Interferon, rabbit with the method for quantitative PCR method and resorcinolphthalein reporter gene; As shown in Figure 7; Wherein, X-coordinate is represented siRNA, treatment group that 3p-siRNA is different respectively, and A figure ordinate zou is represented the expression of IFN-α with respect to internal control gene GAPDH; B figure ordinate zou is represented the expression of IFN-β with respect to internal control gene GAPDH; C figure ordinate zou is represented the multiple of inducing of IFN-β.As can beappreciated from fig. 7, siRNA and 3p-siRNA all can cause the abduction delivering of Interferon, rabbit, and 3p-siRNA induce effect more obvious.
10, the obviously generation of antiviral protein of 3p-siRNA
With the HepG2.2.15 cell as research object; Use Lipofectamin 2000 to carry out the transfection of 3p-siRNA, behind the transfection 48h, detect the abduction delivering of antiviral protein with Western blot method; As shown in Figure 8; As can beappreciated from fig. 8,3p-siRNA is the expression of inducing anti-disease toxalbumin obviously, and this inducing action is induced RIG-I with 3p-siRNA and activate the MAPK in RIG-I downstream relevant with NF-κ B signal path.
Claims (1)
1. siRNA who treats HBV, it is characterized in that: its sequence is shown in SEQ ID NO.3: SEQ ID NO.3:CCGACCUUGAGGCAUACUU.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210022628 CN102533768B (en) | 2010-09-16 | 2010-09-16 | siRNA for treating HBV |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210022628 CN102533768B (en) | 2010-09-16 | 2010-09-16 | siRNA for treating HBV |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102826130A Division CN101948834B (en) | 2010-09-16 | 2010-09-16 | siRNA for treating HBV |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102533768A true CN102533768A (en) | 2012-07-04 |
| CN102533768B CN102533768B (en) | 2013-03-27 |
Family
ID=46341800
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210022628 Expired - Fee Related CN102533768B (en) | 2010-09-16 | 2010-09-16 | siRNA for treating HBV |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102533768B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9227956B2 (en) | 2013-04-17 | 2016-01-05 | Pfizer Inc. | Substituted amide compounds |
| CN105368860A (en) * | 2014-08-29 | 2016-03-02 | 石药集团中奇制药技术（石家庄）有限公司 | Recombinant plasmid carrier and construction method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030206887A1 (en) * | 1992-05-14 | 2003-11-06 | David Morrissey | RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA) |
| CN101235372A (en) * | 2008-02-29 | 2008-08-06 | 苏先狮 | HBV core area resisting siRNA expression template and application |
| CN101603042A (en) * | 2008-06-13 | 2009-12-16 | 厦门大学 | The RNA disturbance target point that can be used for treating hepatitis B virus infection |
-
2010
- 2010-09-16 CN CN 201210022628 patent/CN102533768B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030206887A1 (en) * | 1992-05-14 | 2003-11-06 | David Morrissey | RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA) |
| CN101235372A (en) * | 2008-02-29 | 2008-08-06 | 苏先狮 | HBV core area resisting siRNA expression template and application |
| CN101603042A (en) * | 2008-06-13 | 2009-12-16 | 厦门大学 | The RNA disturbance target point that can be used for treating hepatitis B virus infection |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9227956B2 (en) | 2013-04-17 | 2016-01-05 | Pfizer Inc. | Substituted amide compounds |
| CN105368860A (en) * | 2014-08-29 | 2016-03-02 | 石药集团中奇制药技术（石家庄）有限公司 | Recombinant plasmid carrier and construction method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102533768B (en) | 2013-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101948834B (en) | siRNA for treating HBV | |
| Pollicino et al. | Replicative and transcriptional activities of hepatitis B virus in patients coinfected with hepatitis B and hepatitis delta viruses | |
| Cheng et al. | Let-7b is a novel regulator of hepatitis C virus replication | |
| Xie et al. | MicroRNAs associated with HBV infection and HBV-related HCC | |
| Wang et al. | The gRNA-miRNA-gRNA ternary cassette combining CRISPR/Cas9 with RNAi approach strongly inhibits hepatitis B virus replication | |
| Coppola et al. | Lowered expression of microRNA-125a-5p in human hepatocellular carcinoma and up-regulation of its oncogenic targets sirtuin-7, matrix metalloproteinase-11, and c-Raf | |
| CN108929870B (en) | siRNA molecule for inhibiting HBV and application thereof | |
| KR20230070330A (en) | Methods for the treatment of hepatitis b and hepatitis d virus infections | |
| CN102191246B (en) | Multi-target interfering nucleic acid molecule and application thereof | |
| Kwon et al. | Profiling of plasma‐derived exosomal RNA expression in patients with periodontitis: A pilot study | |
| Gao et al. | Inhibition of hepatitis B virus gene expression and replication by artificial microRNA | |
| CN102533768B (en) | siRNA for treating HBV | |
| CN102533767A (en) | siRNA for treating HBV | |
| Khlaiphuengsin et al. | Human miR-5193 triggers gene silencing in multiple genotypes of hepatitis B virus | |
| CN101077883A (en) | Small interference RNA sequence of hepatitis B virus gene and preparation method thereof | |
| CN101024088A (en) | B-type hepatitis virus micro ribonucleic-acid interference moleculars and its designing method | |
| CN101979556B (en) | Small interfering ribose nucleic acid (siRNA) targeting molecule and application thereof | |
| CN107557464A (en) | Forecast model and detection kit for the reaction of interferon treatment in chronic hepatitis B early stage virology | |
| Zhou et al. | Establishment of a screening system for selection of siRNA target sites directed against hepatitis B virus surface gene | |
| CN101979553B (en) | siRNA molecule for interfering HBV gene and antiviral application thereof | |
| Jiao et al. | Downregulation of HBx mRNA in HepG2. 2.15 cells by small interfering RNA | |
| EP3881850B1 (en) | Composition for inhibiting replication of hepatitis b virus | |
| CN102399820B (en) | Small interfering RNA directed at HPV16 E7 gene and its application | |
| CN1648250A (en) | Smal linterference ribonucleic acid sequence of hepatitis B virus gene and preparing method | |
| CN101979555B (en) | Small interference RNA molecule and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130327 Termination date: 20140916 |
|
| EXPY | Termination of patent right or utility model |